ID: 1127581322

View in Genome Browser
Species Human (GRCh38)
Location 15:60341666-60341688
Sequence GTGTCAAATCAGACTGAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127581318_1127581322 21 Left 1127581318 15:60341622-60341644 CCCATCGTGGGATGTGGGCTGTT No data
Right 1127581322 15:60341666-60341688 GTGTCAAATCAGACTGAGATTGG No data
1127581315_1127581322 28 Left 1127581315 15:60341615-60341637 CCAGCTTCCCATCGTGGGATGTG No data
Right 1127581322 15:60341666-60341688 GTGTCAAATCAGACTGAGATTGG No data
1127581319_1127581322 20 Left 1127581319 15:60341623-60341645 CCATCGTGGGATGTGGGCTGTTC No data
Right 1127581322 15:60341666-60341688 GTGTCAAATCAGACTGAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127581322 Original CRISPR GTGTCAAATCAGACTGAGAT TGG Intergenic
No off target data available for this crispr