ID: 1127583880

View in Genome Browser
Species Human (GRCh38)
Location 15:60363374-60363396
Sequence AGGCTTGACCTGCAACTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127583878_1127583880 9 Left 1127583878 15:60363342-60363364 CCATTTAGAGTGCGGGGGATGGA 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1127583880 15:60363374-60363396 AGGCTTGACCTGCAACTCCCAGG 0: 1
1: 0
2: 2
3: 9
4: 167
1127583876_1127583880 13 Left 1127583876 15:60363338-60363360 CCAACCATTTAGAGTGCGGGGGA 0: 1
1: 0
2: 0
3: 0
4: 36
Right 1127583880 15:60363374-60363396 AGGCTTGACCTGCAACTCCCAGG 0: 1
1: 0
2: 2
3: 9
4: 167
1127583871_1127583880 18 Left 1127583871 15:60363333-60363355 CCTTTCCAACCATTTAGAGTGCG 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1127583880 15:60363374-60363396 AGGCTTGACCTGCAACTCCCAGG 0: 1
1: 0
2: 2
3: 9
4: 167
1127583870_1127583880 29 Left 1127583870 15:60363322-60363344 CCTATTTATGTCCTTTCCAACCA 0: 1
1: 0
2: 0
3: 14
4: 235
Right 1127583880 15:60363374-60363396 AGGCTTGACCTGCAACTCCCAGG 0: 1
1: 0
2: 2
3: 9
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127583880 Original CRISPR AGGCTTGACCTGCAACTCCC AGG Intronic
900120918 1:1048313-1048335 GGGCTTCACCTGCAGCTGCCCGG + Exonic
900179320 1:1304380-1304402 AGGCTGGACCAGCCTCTCCCAGG + Intronic
901520121 1:9777239-9777261 AGGCTTGAGCCACCACTCCCAGG - Intronic
904762666 1:32817179-32817201 AGGCCTGACCTGCAGGTTCCGGG + Exonic
905293345 1:36938426-36938448 AACCTTGACCTGCTACTGCCGGG + Intronic
907809081 1:57850643-57850665 AGGCCTGGCCTGCAAGTGCCGGG + Intronic
909016304 1:70383507-70383529 AGGCTAGAGGTGCACCTCCCTGG - Intronic
912238391 1:107878220-107878242 TGACTCTACCTGCAACTCCCAGG + Intronic
912725631 1:112056949-112056971 TACCTTGACCTGCAACTTCCTGG + Intergenic
917341205 1:173979796-173979818 AGACTTTACCTGCAACTCTTAGG - Intronic
917805924 1:178613699-178613721 AAGCTGGACCTCCAACTCCTCGG + Intergenic
919043327 1:192420698-192420720 CTGCTTTACCTGCAGCTCCCTGG - Intergenic
921837304 1:219791436-219791458 AGGCTTTGGCTGCAACTCCAGGG + Intronic
922577707 1:226673835-226673857 AGGAGTGTCCTGCAACTCTCTGG - Intronic
1065275737 10:24083864-24083886 TTGCTTGACCTGCTATTCCCTGG - Intronic
1067042661 10:42963171-42963193 AGGGTTGTCGTGGAACTCCCAGG + Intergenic
1067067232 10:43110951-43110973 TGCCTTGACCTCCAGCTCCCAGG + Intronic
1067080086 10:43207893-43207915 AGGCTGGACTTGGAACTCCTGGG - Intronic
1068128013 10:52865387-52865409 GGGCTTGAGCTCCATCTCCCTGG - Intergenic
1070085746 10:73235744-73235766 AGACTAGACCTGGAACTCCTGGG + Intronic
1070289617 10:75105685-75105707 AGGCTGGACCAGCAACTGCGGGG - Intronic
1070826302 10:79392202-79392224 AGGCCTGGCCTGCACCTGCCAGG + Intronic
1071570149 10:86692291-86692313 AGGCTTGGTGTGCAACTTCCGGG + Intronic
1072107606 10:92289667-92289689 AGGCTGGTCTTGCAACTCCTGGG - Intronic
1073311729 10:102547609-102547631 AGGCTAGTCCTTGAACTCCCAGG - Intronic
1075369321 10:121921604-121921626 AGGCCTGAACTGCAGCTGCCTGG + Intronic
1077626042 11:3772537-3772559 AGGCATGAGCTGCAGCACCCAGG - Intronic
1077675925 11:4192853-4192875 AGGCTTGGTCTGCAACTGCGGGG + Intergenic
1078328633 11:10400736-10400758 AGGCTTGCTCTGCCACTCCGAGG + Intronic
1078926094 11:15876390-15876412 AAGGTTGACCTGAACCTCCCAGG - Intergenic
1079853909 11:25575631-25575653 AGGCTTGCCTTGCTTCTCCCTGG - Intergenic
1082011005 11:47449433-47449455 AGGCTGGACCTGCAGGTCCGGGG + Intergenic
1084659895 11:70540489-70540511 AGGCTGGACATGAGACTCCCAGG - Intronic
1085125548 11:73999823-73999845 AGGGTTGACCTAAAACTCCTTGG - Intergenic
1085519772 11:77131063-77131085 AGGCTTGAGCTGGAGCCCCCTGG + Intronic
1086079559 11:82889280-82889302 AGACTTGGCCTCAAACTCCCGGG - Intronic
1089268228 11:117282180-117282202 AGGCTTCTGCTGAAACTCCCCGG + Exonic
1091487008 12:899342-899364 TGGCTCAACCTCCAACTCCCAGG + Intronic
1096208702 12:49745175-49745197 ATGCTTTCCCTGCCACTCCCAGG - Intronic
1101402977 12:104404353-104404375 AGGCTGGATCTGCAGTTCCCAGG - Intergenic
1103795792 12:123502290-123502312 AGGCTGGACCGGCCACTGCCGGG + Intronic
1104386597 12:128356309-128356331 AGCCTTCAGCTGCAAATCCCTGG + Intronic
1104775952 12:131390180-131390202 AGGCCTGCCCTGCAACCCCCAGG - Intergenic
1105433872 13:20360902-20360924 ACCTTTGAACTGCAACTCCCTGG + Intergenic
1105761986 13:23523650-23523672 AGGCTAGACCTGCAACACGAAGG - Intergenic
1106943067 13:34798517-34798539 AGGCTTGGTCTGGAACTCCTAGG - Intergenic
1115753027 14:36508803-36508825 AGGCTGGAGCTGCAAAGCCCTGG - Intronic
1118671098 14:68128354-68128376 AGGTTTGACCTGAAAATTCCAGG - Intronic
1118721820 14:68599886-68599908 AGGCTTCACTTGCAGGTCCCAGG + Intronic
1121801933 14:96781736-96781758 AGGCATGCCCAGCAACACCCGGG + Intergenic
1121867740 14:97378520-97378542 TGTCTTGACCTTCAGCTCCCAGG - Intergenic
1122839072 14:104445983-104446005 AGGCTGGACCTGCAGCGACCCGG - Intergenic
1125883988 15:43214875-43214897 AGGCTCAACCTGCTTCTCCCAGG + Intronic
1127029464 15:54845786-54845808 AGGCATGAGCTGCAGCGCCCAGG - Intergenic
1127583880 15:60363374-60363396 AGGCTTGACCTGCAACTCCCAGG + Intronic
1128517387 15:68351194-68351216 AGGCTTTACCATCAAATCCCTGG - Intronic
1130421577 15:83753113-83753135 TTGCTTGACCTGCAAAACCCTGG + Intronic
1130558941 15:84944003-84944025 AGGCTTGGCCTTCAAGGCCCAGG - Intronic
1130894357 15:88158775-88158797 AGGCCTGGCCTCCACCTCCCCGG - Intronic
1131587911 15:93716037-93716059 TGGCAGGACCTCCAACTCCCAGG - Intergenic
1133683639 16:8145107-8145129 AGGCTTGACCTTGAACTCCTGGG - Intergenic
1134023505 16:10937941-10937963 AGGCTAGACCTGGACCTCCCTGG + Intronic
1134127672 16:11627563-11627585 AGGCGTGAGCCGCCACTCCCAGG - Intronic
1146526242 17:33569331-33569353 ATACTTGAGCTGCAAGTCCCTGG - Intronic
1148557557 17:48587542-48587564 ATCCTTGGCCTGCAATTCCCAGG + Intronic
1148589512 17:48805229-48805251 AGGCTTCTCCTGAAAATCCCAGG - Intronic
1150712811 17:67546115-67546137 TGGCATGACCTCCACCTCCCAGG - Intronic
1151439002 17:74116104-74116126 AGGCAGGAGCTGCAACTCTCTGG + Intergenic
1156208197 18:34908750-34908772 AGCCTTGACCTCCAAGTCTCAGG + Intergenic
1156309271 18:35907793-35907815 AGGCCTGGCCTGCAACACCTGGG - Intergenic
1160841163 19:1147584-1147606 AGGCTTGACCACCACCCCCCTGG - Intronic
1165230985 19:34386561-34386583 AGGCTTCACCTCAAACACCCAGG - Intronic
1168536572 19:57175273-57175295 AGGCTTGACCAGCCACTGACGGG + Intergenic
925377971 2:3401773-3401795 AGTCTTTAACTGCATCTCCCTGG - Exonic
926919837 2:17929526-17929548 AGGCTCCACCTGCAACACGCAGG + Intronic
927170243 2:20363226-20363248 AGGCCTGACCTGCATACCCCGGG + Intergenic
927428379 2:23006069-23006091 AGGGTTGAGCTGTCACTCCCAGG - Intergenic
927556988 2:24042121-24042143 AGGCGTGAGCTGCCACACCCAGG - Intronic
928531076 2:32191815-32191837 AGGCTGGACCCTGAACTCCCAGG - Intronic
929172962 2:38949632-38949654 AGGCCTGGCTTGCTACTCCCTGG - Intronic
930069598 2:47355461-47355483 AGCCTTGACCTTCACCTCCCAGG + Intronic
932189230 2:69725082-69725104 TGGCTTGACCTGCGTCTCCTGGG - Intronic
932597906 2:73105679-73105701 AGGCATGACCTGCTTCTCCTGGG - Intronic
935375106 2:102387675-102387697 AGGCTCCACCATCAACTCCCTGG + Intronic
935889744 2:107663508-107663530 AGGCTAGACCTCAACCTCCCAGG + Intergenic
936002000 2:108842366-108842388 AGGTTTGCCATGTAACTCCCAGG - Intronic
936139439 2:109926552-109926574 AGGCTTGTCTTGGAACTCCTGGG - Intergenic
936205257 2:110444934-110444956 AGGCTTGTCTTGGAACTCCTGGG + Intronic
943580203 2:189674960-189674982 AGACTTGTCCTGCAACCTCCTGG + Intronic
947588178 2:231369965-231369987 AGCCTTCACCTGCAAGCCCCGGG + Intronic
1170745530 20:19095419-19095441 AGCCTTCACCTGCAAGTGCCAGG + Intergenic
1171757055 20:29120218-29120240 AGACTTGCCCAGCAACTCACTGG + Intergenic
1172111303 20:32546816-32546838 AGTCTTGACTTTCAACTCCTTGG + Intronic
1173221532 20:41136692-41136714 TGGTCTGACCTGCAGCTCCCAGG - Intergenic
1174261039 20:49295467-49295489 AGGCTGGAGCTGCAAGTCCTGGG - Intergenic
1174458757 20:50668123-50668145 AGGCTTGCTCTGCCAGTCCCGGG + Intronic
1175296045 20:57909449-57909471 AGGCATGAGCTGCACCTCGCAGG - Intergenic
1175565145 20:59969183-59969205 AAGCATCACCTGCAACTCTCTGG - Intronic
1178221006 21:30659895-30659917 AGGAATGACTGGCAACTCCCAGG - Intergenic
1181038276 22:20180166-20180188 AGGCCTGCCCTGCCACCCCCGGG + Intergenic
1181734783 22:24873171-24873193 AGGCTGGACTTGGAACTCCTGGG + Intronic
1184988801 22:48153879-48153901 AGGCCACACCTGCAAGTCCCTGG - Intergenic
1185050393 22:48551226-48551248 AGGCTGGGCCTGCAGCACCCTGG + Intronic
1185241152 22:49748496-49748518 AGGCCTGACCTGCACCTTTCAGG - Intergenic
949887124 3:8704879-8704901 AGGCTTGAAGTGAAACTCCATGG + Intronic
950426546 3:12927590-12927612 AGCCTTGTCCTGGAAGTCCCTGG - Intronic
954198826 3:49012310-49012332 AAGCTTGACCTGCCACACACGGG - Exonic
959020064 3:101179111-101179133 AGGCATGCCCTGCTACTCACTGG - Intergenic
960087603 3:113607597-113607619 AGGCTAGACTCCCAACTCCCAGG - Intronic
961492470 3:127265130-127265152 AGGCTGGAGCTGCAACTCAGTGG + Intergenic
962794557 3:138839109-138839131 AGGCATGAGCCACAACTCCCAGG - Intergenic
967298009 3:187984311-187984333 AGTCTTGCTCTGTAACTCCCGGG - Intergenic
968515856 4:1015364-1015386 GGGCTTGACCAGCAGCTCCAGGG - Intronic
968947614 4:3673841-3673863 AGGCTGGACCTGCACCTGCCAGG - Intergenic
969597748 4:8158582-8158604 AGGCTGCACCTGCAACGCCGGGG - Intronic
969618875 4:8269161-8269183 AGGCTTGACATTCACCTCCAAGG + Intergenic
970852391 4:20617118-20617140 AGGCTTCACCTGCGAGTGCCAGG + Exonic
976537488 4:86235333-86235355 AGGCTTGACTTCTAACACCCGGG - Intronic
977597450 4:98898530-98898552 AGGCTGGACCTCCACCTCCCGGG - Intronic
977899638 4:102404723-102404745 AGACTTAAACTGCAATTCCCTGG - Intronic
978036048 4:103996268-103996290 ATGCCTGTCCTCCAACTCCCTGG - Intergenic
980500606 4:133648022-133648044 AGCCTTGATCTGGAACTTCCTGG - Intergenic
980855129 4:138431168-138431190 AGCCCTGATCTGCAGCTCCCAGG + Intergenic
981151803 4:141387121-141387143 AGGCTGGATCTGGAACTCCTAGG + Intergenic
986117939 5:4798653-4798675 AGGCTTGGTCTCAAACTCCCAGG + Intergenic
992993240 5:82306801-82306823 AGGCTTGAGCTGCCATGCCCGGG + Intronic
994911658 5:105917234-105917256 GACCTTCACCTGCAACTCCCTGG + Intergenic
996239167 5:121172625-121172647 AGGCCTCACCTCCAACTCCGGGG + Intergenic
998624575 5:143831600-143831622 TAACTTGACCTGGAACTCCCTGG - Intergenic
1000321664 5:160139266-160139288 AGGCTTCATCTGCATCTTCCAGG + Intergenic
1001929748 5:175664527-175664549 AGGCTTGACCTGAGACCCCAGGG + Intronic
1001937963 5:175719465-175719487 AGGCTTGAGCCACCACTCCCGGG + Intergenic
1002101984 5:176862274-176862296 AGCCTTGCCCTGGACCTCCCGGG + Intronic
1002148740 5:177208769-177208791 TGGCGTGATCTCCAACTCCCGGG + Intronic
1002630020 5:180566862-180566884 AGGCTTGGTCTGGAACTCCTGGG + Intronic
1007711698 6:43828248-43828270 AGGCTTGGCCTGCATCTCCCAGG - Intergenic
1007711703 6:43828268-43828290 AGGCTTGGCCTGCATCTCCCAGG - Intergenic
1012990954 6:105925229-105925251 AGGCTTGTGCTGCTACTCCCAGG - Intergenic
1014871584 6:126602980-126603002 AATCTGGACCTGCAGCTCCCAGG + Intergenic
1015749856 6:136549601-136549623 AGGCCTGACCACCAAATCCCGGG + Intronic
1015806980 6:137119605-137119627 AGGCCTGAACTACAGCTCCCTGG + Intergenic
1016098419 6:140066814-140066836 AAGCTTGATCTGCAACTCTTGGG + Intergenic
1016683195 6:146853903-146853925 GTCCTTGACCTGCAGCTCCCTGG - Intergenic
1018529800 6:164750571-164750593 AGGCTGGACGTCCAACACCCAGG - Intergenic
1019312996 7:371794-371816 AGGCTTGACCTGGGTCTTCCAGG - Intergenic
1022790631 7:33685357-33685379 AGGCTTGGTCTCCAACTCCTGGG - Intergenic
1023253032 7:38285474-38285496 AGGGTTGGACTGCACCTCCCAGG - Intergenic
1023595985 7:41829888-41829910 GGACTAGACCTGCAGCTCCCCGG + Intergenic
1024423625 7:49200126-49200148 AGGCTTGAACTACAGCTGCCTGG + Intergenic
1024965254 7:55018710-55018732 AGGCTGGGCCTGCAAGTCCGCGG + Intergenic
1025709430 7:63893144-63893166 AGGTAAGACCTGCAGCTCCCGGG - Intergenic
1026446444 7:70488557-70488579 AGGCTTGGCCTGCAGCTTTCAGG - Intronic
1027736857 7:81943217-81943239 AGGCCTGACCTCCAACACCGGGG - Intergenic
1029481160 7:100813842-100813864 AGGCTTGTCCTGTAGCACCCAGG + Intronic
1031209062 7:118798664-118798686 GGGCTTGACCAGTAACTACCAGG - Intergenic
1033306570 7:140230239-140230261 AGCTTTGACCTCCAGCTCCCTGG + Intergenic
1034088095 7:148338619-148338641 AGGCTTCAGCTGCTACTGCCTGG + Intronic
1035076571 7:156181584-156181606 AGGCGTGAGCAGCAACACCCAGG + Intergenic
1035357988 7:158290364-158290386 AGGCTGGCCCTGCAGCTCCATGG - Intronic
1037975097 8:23203531-23203553 AGGCTCGACCTTCACCTCCAGGG + Intronic
1038596400 8:28890340-28890362 AGGCAGGAACTACAACTCCCAGG + Intergenic
1040064546 8:43134537-43134559 GGGCATGGCCTGTAACTCCCTGG + Intergenic
1043802822 8:84632204-84632226 TGGCTTGACTTGGACCTCCCAGG + Intronic
1044726271 8:95196592-95196614 CGGCTAGACCTGGAAGTCCCCGG - Intergenic
1052994920 9:34546818-34546840 AGGCTTTACCTGCGGCTCTCAGG - Intergenic
1053117709 9:35520181-35520203 AGGCTTGCCCTGCTAGTCTCTGG - Intronic
1054126692 9:61319343-61319365 AGGATAGACCTGCAAATGCCTGG - Intergenic
1056232037 9:84556918-84556940 AGCCTTGGCCTAAAACTCCCAGG - Intergenic
1061181636 9:129028083-129028105 AGGCCTCACCTGCACCGCCCGGG + Exonic
1061418675 9:130461746-130461768 AGGCTGGACCAGCACCTCCAAGG - Intronic
1189680399 X:43510134-43510156 AGGCATGAGCTGCCACACCCAGG - Intergenic
1192238748 X:69313429-69313451 AGGCCTGAGCTGCAAGTCCATGG + Intergenic
1195134051 X:101885896-101885918 AGGCTTGACCTCAAACTCCTTGG + Intronic
1195992806 X:110699393-110699415 AGGCTTGCCCTGTAATTCCCTGG + Intronic
1196434052 X:115659028-115659050 AGGCTTGAGCCACCACTCCCAGG - Intergenic
1197263267 X:124338518-124338540 AGGCTTGAGCTACCACACCCAGG - Intronic
1198564616 X:137891486-137891508 AGGCTTCACCTCCAACACCGGGG + Intergenic
1200252478 X:154560953-154560975 AGGCTGGTCTTGGAACTCCCGGG - Intronic
1200265289 X:154643463-154643485 AGGCTGGTCTTGGAACTCCCGGG + Intergenic