ID: 1127586888

View in Genome Browser
Species Human (GRCh38)
Location 15:60386922-60386944
Sequence AGCTGCGTCCTGAAATAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 71}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127586886_1127586888 2 Left 1127586886 15:60386897-60386919 CCCAAGAATAAAGAAAACAGAGT 0: 1
1: 0
2: 5
3: 63
4: 830
Right 1127586888 15:60386922-60386944 AGCTGCGTCCTGAAATAGACAGG 0: 1
1: 0
2: 0
3: 6
4: 71
1127586887_1127586888 1 Left 1127586887 15:60386898-60386920 CCAAGAATAAAGAAAACAGAGTA 0: 1
1: 0
2: 2
3: 64
4: 789
Right 1127586888 15:60386922-60386944 AGCTGCGTCCTGAAATAGACAGG 0: 1
1: 0
2: 0
3: 6
4: 71
1127586885_1127586888 3 Left 1127586885 15:60386896-60386918 CCCCAAGAATAAAGAAAACAGAG 0: 1
1: 0
2: 7
3: 82
4: 946
Right 1127586888 15:60386922-60386944 AGCTGCGTCCTGAAATAGACAGG 0: 1
1: 0
2: 0
3: 6
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127586888 Original CRISPR AGCTGCGTCCTGAAATAGAC AGG Intronic
901773349 1:11542511-11542533 AGCTGCGTCCTGAAGGAGAAGGG - Intergenic
905916721 1:41689690-41689712 AGCTGCTCCCTGAAATAGTCGGG - Intronic
916483471 1:165236030-165236052 AGCTTCGCCCTGGACTAGACTGG + Intronic
916851678 1:168710812-168710834 TGCTGAGACCTGAAAAAGACAGG - Intronic
924926810 1:248691817-248691839 AGCTGCGTCCTGAGGTGGGCGGG - Intergenic
1074885147 10:117687288-117687310 AGCTGAATCCTGAACTGGACTGG - Intergenic
1080001277 11:27352974-27352996 AGCTGTGTCCTGAAGGAGACTGG - Intronic
1084938864 11:72601692-72601714 AGCTGGGGCCTGAAACAGTCTGG + Intronic
1087221164 11:95547710-95547732 AGCTGGGTCCTGCAAGAAACAGG - Intergenic
1088420111 11:109636072-109636094 AGCTGCCCCCAGAAACAGACTGG - Intergenic
1091509250 12:1105268-1105290 AGCTGCGTACTGAAATACGATGG - Intronic
1096309664 12:50509544-50509566 AGCTACGTGATGAAACAGACAGG - Intronic
1102190887 12:110987455-110987477 AGTTGCATCCAGAAATAGACTGG + Intergenic
1107381243 13:39858564-39858586 AGCTGGCTCCTCCAATAGACTGG - Intergenic
1109753262 13:66724265-66724287 AGCTGTGTCCTTGAAGAGACAGG + Intronic
1110193119 13:72754646-72754668 AACTGCATCCTGAAATAGGATGG - Exonic
1111122417 13:83871246-83871268 AGCTTAGTCCTCACATAGACTGG - Intergenic
1114886496 14:26858398-26858420 AACTGTGTACTGAAGTAGACTGG - Intergenic
1116864960 14:50024518-50024540 AGCTGCCTGCTGAAAGAGAAAGG - Intergenic
1119481550 14:74961282-74961304 AGCTGGGTCCTGGAAGAGCCTGG - Intergenic
1122794566 14:104199621-104199643 GGCTGCGTCCTGAATCACACTGG + Intergenic
1125087171 15:35743846-35743868 AGCTGTGGCCTGAAGTACACAGG - Intergenic
1127586888 15:60386922-60386944 AGCTGCGTCCTGAAATAGACAGG + Intronic
1128519204 15:68364548-68364570 AGCTGCTTCCTGGAATGCACAGG + Intronic
1131699412 15:94918065-94918087 AGCTCCCTCCTGGAATAGAGGGG - Intergenic
1133048434 16:3102340-3102362 AGCTGCTTCCTGAAATGATCAGG + Intergenic
1133139464 16:3733583-3733605 AACTGCGTGCTGCAATATACTGG + Intronic
1137734847 16:50716198-50716220 AGGTGCAGCCTGAACTAGACAGG - Intronic
1138178027 16:54920160-54920182 AGTTGTGTCCTGCAATAAACTGG - Intergenic
1144401170 17:14903744-14903766 AGGAGAGTCCTGAAATGGACAGG - Intergenic
1147899561 17:43775119-43775141 AGCAGCTTCCCCAAATAGACTGG + Intronic
1152544327 17:80993094-80993116 AGCTGAGTCCTTAAAGAGAGGGG - Intronic
1153678027 18:7472939-7472961 GGCTGCGTCCTGACATAGTAGGG - Intergenic
1159341168 18:67135510-67135532 AACTGCCTCCTGAAATAATCTGG - Intergenic
1159927829 18:74284509-74284531 AGCTGTGTCCAGAATTAGCCAGG - Intronic
927051867 2:19338089-19338111 GGCTGCATCCTGAAAAAGTCTGG + Intergenic
937429300 2:121825115-121825137 GGCTGCTTCCTGCAACAGACAGG - Intergenic
937589622 2:123597620-123597642 AGCTGCCTCCTGACATATCCAGG + Intergenic
942293282 2:174493319-174493341 AGCTAAGTCTTGAAACAGACTGG - Intergenic
946963119 2:225006002-225006024 AGGTGCCTCATGAAATAGAGTGG + Intronic
947272812 2:228356624-228356646 AGCTAGGTCCTAAAATAGAATGG - Intergenic
948192652 2:236071828-236071850 AGCAGCCTCCTGAGACAGACAGG + Intronic
1169494050 20:6096541-6096563 AGCTGCTCCATGTAATAGACAGG + Intronic
1169874025 20:10276896-10276918 AGCTGCTTTTTGAAATAGAATGG - Intronic
1171105932 20:22432370-22432392 AGCTGCGTCTTGAAATTGAGGGG + Intergenic
1171968946 20:31551400-31551422 AGCTGTGTCCAGAAAAAGAAAGG + Intronic
1177954463 21:27579912-27579934 AGCTGAGACCTAAAATAAACTGG + Intergenic
1182568359 22:31216593-31216615 AGATGCCTCCTGACATAGGCAGG + Intronic
1184244801 22:43230516-43230538 AGCTGCCCCCTGAAAGAGGCAGG - Intronic
951115231 3:18853375-18853397 AGTTTAGTCCTGAAATAGACAGG - Intergenic
952362716 3:32646901-32646923 AGCTGGGTCCTGGAAGGGACAGG - Intergenic
953547505 3:43874480-43874502 AGCTGAGTCATGAAGTAGTCAGG + Intergenic
964468248 3:157022590-157022612 AGCTGTGTCCTGAAATAAGAGGG + Intronic
966921324 3:184613498-184613520 AGCAGCCTCCTGCAGTAGACTGG - Intronic
974582894 4:63829105-63829127 AGCTACGACCAGAAATAAACTGG + Intergenic
979885642 4:126024652-126024674 AGCTGCTTCCAGAAAGAGCCAGG - Intergenic
993424970 5:87751982-87752004 CTCTGAGTCCTAAAATAGACCGG + Intergenic
993554151 5:89314733-89314755 AGCTGTGTGCTGAAATGGCCAGG - Intergenic
996492057 5:124109591-124109613 AGATGTTTCCTTAAATAGACTGG - Intergenic
1002933256 6:1649464-1649486 AAATGTGTCCTGAAATAGGCTGG - Intronic
1007061281 6:38942862-38942884 AGCTACTACCTGAAAGAGACTGG + Intronic
1011877538 6:91979514-91979536 AGCTTCGTCCTGAAATTAAATGG + Intergenic
1014474278 6:121853620-121853642 AGCTAAATCCTGAAATAGAATGG - Intergenic
1017511319 6:155116991-155117013 AGCTGAGACTTGAAGTAGACGGG + Intronic
1032197989 7:129800280-129800302 AGCTGCCACCTGGAAGAGACGGG - Intergenic
1037118767 8:15257863-15257885 AGCAGAGTACTGAAATAGAAGGG - Intergenic
1038192105 8:25332185-25332207 AGCTATGTCCTGAAATGGTCTGG + Intronic
1038447826 8:27615926-27615948 GGCTGCCTCCTGAAAAGGACTGG - Intergenic
1042676162 8:71324778-71324800 ACCTGAGTCATGAAATAGAGGGG - Intronic
1052838001 9:33265506-33265528 AGCTGAGTCCTGATGTGGACTGG - Intronic
1190731157 X:53226669-53226691 AGCTCAGTCCTGAAGTAGGCAGG - Intergenic
1190876922 X:54466561-54466583 AGCTGAGTCCTGAGGTAGAAGGG - Intronic
1194190246 X:90826198-90826220 AGCTGGTTGCTGAAATAGCCTGG + Intergenic
1196981383 X:121217608-121217630 AGCTGTCTCTTGAGATAGACAGG + Intergenic
1197189256 X:123627350-123627372 AGCCGAGTCTTGAAATGGACAGG - Intronic
1198201544 X:134424400-134424422 AGATGCCTCCTGAAATATGCAGG + Intronic
1198577823 X:138029362-138029384 AGCTTCCTCCTGAAATAAATTGG + Intergenic
1200536842 Y:4408298-4408320 AGCTGGTTGCTGAAATAGCCTGG + Intergenic