ID: 1127588323

View in Genome Browser
Species Human (GRCh38)
Location 15:60398161-60398183
Sequence GGGGCCGCTCCCGCGTGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 218}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127588323_1127588339 28 Left 1127588323 15:60398161-60398183 CCGCGCCACGCGGGAGCGGCCCC 0: 1
1: 0
2: 0
3: 9
4: 218
Right 1127588339 15:60398212-60398234 GCCCGGCCGAGGCTGCCCCGAGG 0: 1
1: 0
2: 4
3: 44
4: 288
1127588323_1127588337 17 Left 1127588323 15:60398161-60398183 CCGCGCCACGCGGGAGCGGCCCC 0: 1
1: 0
2: 0
3: 9
4: 218
Right 1127588337 15:60398201-60398223 CCTCCGAGAAAGCCCGGCCGAGG 0: 1
1: 0
2: 0
3: 3
4: 94
1127588323_1127588333 11 Left 1127588323 15:60398161-60398183 CCGCGCCACGCGGGAGCGGCCCC 0: 1
1: 0
2: 0
3: 9
4: 218
Right 1127588333 15:60398195-60398217 CCCTGCCCTCCGAGAAAGCCCGG 0: 1
1: 0
2: 1
3: 15
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127588323 Original CRISPR GGGGCCGCTCCCGCGTGGCG CGG (reversed) Intronic
900100704 1:960884-960906 GGGGCCGCTTCCGAGGGCCGGGG + Intronic
900412034 1:2516940-2516962 GGGGCCCCTCCTGCCTGGCAGGG + Intronic
900512619 1:3067782-3067804 GGGGTCGCGCCCGCGATGCGGGG - Intergenic
900641143 1:3688605-3688627 GGGGCCACACCCCCTTGGCGTGG - Intronic
900797461 1:4717402-4717424 AGGGCCCCTCCTGGGTGGCGAGG - Intronic
901641177 1:10694001-10694023 CGGGCCGCTCCTGCGGGGCGGGG - Intronic
901659292 1:10788700-10788722 GGGGCAGCTCCCGGGTGAGGAGG - Intronic
906214514 1:44030999-44031021 GGGGGAGCTCCTGCGTGGGGTGG - Intronic
906481637 1:46203308-46203330 GGGTCCCCGCCCGCGCGGCGCGG - Intronic
906640670 1:47438852-47438874 GGAGCTGCTGCTGCGTGGCGGGG + Exonic
906650194 1:47507824-47507846 GGGGCCCCTCCCGCTCAGCGGGG + Intergenic
907216629 1:52869989-52870011 GGGGCGGCTGCCGGGTGGAGGGG + Intronic
912505298 1:110151621-110151643 TGGGCCGCTCCCCAGGGGCGCGG + Intronic
912844778 1:113069244-113069266 GGGGCAGCTGCCGGGTGGAGGGG - Intergenic
913519484 1:119631662-119631684 GCGGCCGCTGCCAGGTGGCGGGG + Intronic
914230973 1:145764631-145764653 GGGGCGGCTGCCGGGTGGAGGGG - Intronic
915112787 1:153575225-153575247 GGGGCGGCTGCCGGGTGGAGGGG - Intergenic
916050061 1:161029752-161029774 GGGGCGGCTGCCGGGTGGAGGGG - Intronic
918048316 1:180954291-180954313 AAGGCCGCTTCCGCGAGGCGGGG + Intergenic
919657667 1:200213649-200213671 GGGTGCACTTCCGCGTGGCGAGG + Intergenic
919891999 1:201982571-201982593 GGGGCGGGGCCCGCGCGGCGGGG + Intronic
922804142 1:228377051-228377073 GGGGCCGCTTCAGCGTGGTGCGG + Exonic
923684206 1:236142639-236142661 GGGGGCGCTGCCGCGCGGCCGGG - Exonic
923744403 1:236686815-236686837 CGGGCCGCCCGCGCGTGGTGGGG + Intronic
1063393559 10:5666167-5666189 GGGGCCGTTGCCCAGTGGCGGGG - Intronic
1064109120 10:12523069-12523091 GGGGCGGCTGCCGGGTGGAGGGG + Intronic
1064402824 10:15035564-15035586 GGGGCGGATCCCACGTGGCTTGG - Intronic
1065688541 10:28309742-28309764 GGGGCGGATCCCTCGTGGCTTGG + Intronic
1066150122 10:32607039-32607061 GGGGCAGATCCCCCGTGGCTTGG + Intronic
1066697911 10:38094837-38094859 GGGGAAGCGCCCGCGGGGCGGGG + Intronic
1067937187 10:50623028-50623050 AGGGCTGCCCCCGCGGGGCGGGG - Intronic
1070581478 10:77723548-77723570 GAGGCAGCTCCCTCGTGGCTTGG + Intergenic
1071601111 10:86959157-86959179 GTAGCCGCTCCCGTGTGGAGAGG - Intronic
1072772423 10:98152821-98152843 GGGGCGGCTGCCGGGTGGAGGGG - Intronic
1077208807 11:1358532-1358554 GGGGCAGCAGCCGGGTGGCGTGG - Intergenic
1077329230 11:1976698-1976720 GGGGGCGCTCCGGCGAGGCTGGG - Intronic
1077839681 11:5961056-5961078 GGGGCGGCTGCCGGGTGGAGGGG - Intergenic
1078122414 11:8523546-8523568 GGGGCGGCTGCCGGGTGGAGGGG - Intronic
1082065109 11:47893082-47893104 GGGGCGGCTGCCGGGTGGAGGGG - Intergenic
1083654590 11:64223408-64223430 GGGCCCGCTCCCGCGTCGACAGG - Exonic
1083886855 11:65577227-65577249 GGGGCCTCACCCGCCAGGCGGGG + Intronic
1089148544 11:116347393-116347415 GGGGCGGCTGCCGGGTGGGGGGG - Intergenic
1090686654 11:129129218-129129240 GGGGCAGCTGCCGGGTGGAGGGG - Intronic
1090686667 11:129129258-129129280 GGGGCAGCTGCCGGGTGGAGGGG - Intronic
1202812209 11_KI270721v1_random:31877-31899 GGGGGCGCTCCGGCGAGGCTGGG - Intergenic
1092537330 12:9402715-9402737 GAGGCACCTCCCGCGAGGCGGGG + Intergenic
1092557349 12:9570583-9570605 GAGGCACCTCCCGCGAGGCGGGG - Intergenic
1093927815 12:24926261-24926283 GGGGCGGCTGCCGGGTGGAGGGG - Intronic
1095113911 12:38330563-38330585 GGGGCGGCTGCCGGGTGGAGGGG + Intergenic
1096156745 12:49345422-49345444 CTGGCCGCTCCCGCGGGGCCGGG + Intergenic
1101885187 12:108656131-108656153 GGGGCGGCTGCCGGGTGGAGGGG - Intronic
1105308525 13:19186110-19186132 AGGGCAGCTCCCGCATGGGGAGG - Intronic
1105975444 13:25468706-25468728 GGGGCGGCTCTCCCGGGGCGGGG + Intronic
1106232310 13:27830146-27830168 GGGGCCGCACCTGCCGGGCGCGG - Intergenic
1106304185 13:28495318-28495340 GGGGCCGAGCGCGCGTGGGGAGG + Intergenic
1108370312 13:49761950-49761972 GGGGCGGCTGCCGGGTGGAGGGG - Intronic
1108373314 13:49792181-49792203 CAGGCCGCGCCCGCGTGACGGGG + Intronic
1111956039 13:94759346-94759368 GGGGCCGCTCCCGCCCTGCGCGG - Intergenic
1116061102 14:39925193-39925215 GGGGCAGATCCCGCATGGCTTGG - Intergenic
1116409112 14:44601490-44601512 GGGGCGGCTGCCGGGTGGAGGGG - Intergenic
1119325884 14:73759426-73759448 GGGGCCGCGCCCGGGTGGGCGGG + Intronic
1124335074 15:28849846-28849868 GGGGCGGCTGCCGGGTGGAGGGG + Intergenic
1126815187 15:52447199-52447221 GGGGCGGCTCCCTCATGGCTTGG + Intronic
1127103312 15:55588470-55588492 GGGGCCGCTGCCTCGTCCCGCGG + Intronic
1127588323 15:60398161-60398183 GGGGCCGCTCCCGCGTGGCGCGG - Intronic
1128643365 15:69356962-69356984 GGGGCAGATCCCTCGTGGCTTGG + Intronic
1128999313 15:72319703-72319725 GGGGCAGATCCCGCGGGGCTTGG - Exonic
1129382835 15:75178637-75178659 GGGGCCGCTCCTGCAAGCCGGGG + Intergenic
1131032796 15:89200427-89200449 GGGGCGGCTCCCGGGAAGCGGGG + Exonic
1132838129 16:1964888-1964910 CGGCCCGCTCCCGCTTGGGGCGG - Intergenic
1133752128 16:8733192-8733214 GGGGCGGCTGCCGGGTGGAGGGG + Intronic
1134121256 16:11586610-11586632 TGGCCCGATCGCGCGTGGCGGGG - Intronic
1134134207 16:11668715-11668737 GGGGCCGCGCCCGCGGGCTGGGG + Intronic
1135565890 16:23510557-23510579 CCGGCCGGTCCCGCGTGGAGGGG - Intronic
1136381976 16:29900107-29900129 GGGCCCGCCCCGGCGGGGCGAGG - Intergenic
1137439079 16:48483207-48483229 GGGGCAGCTGCCGGGTGGAGGGG + Intergenic
1138450904 16:57092974-57092996 CGGGGCGCCCCCGCGTGGCCGGG - Intronic
1139327766 16:66165229-66165251 GGGGCTGCTCCTGGGTGGCCTGG - Intergenic
1139475079 16:67199066-67199088 GGGGCCGCCTCGGCGGGGCGGGG + Intergenic
1140509291 16:75495506-75495528 GGCGCCCCTCCCCCGAGGCGTGG - Intergenic
1141054802 16:80804667-80804689 GGGACCGGTCCCCCGGGGCGCGG - Intergenic
1142576534 17:912445-912467 GGGGTCTCTCCCGCGTGGTTGGG - Intronic
1142657440 17:1403381-1403403 GGGGCGGCTGCCGGGTGGAGGGG + Intergenic
1142963230 17:3564372-3564394 GGGGCAGCTGCCGGGTGGAGGGG + Intergenic
1143166805 17:4900934-4900956 GGGCTCGCTCCCGGGAGGCGGGG - Exonic
1145941150 17:28744034-28744056 AGCGCCGCTCCAGCGAGGCGCGG + Exonic
1146731284 17:35195215-35195237 GGGGCGGCTGCCGGGTGGAGGGG + Intergenic
1151591491 17:75047366-75047388 GCGGCCGTGCCCGCGGGGCGTGG - Exonic
1151611933 17:75182326-75182348 GGGGCCGCGGCGGCGGGGCGAGG - Intergenic
1153238762 18:3012859-3012881 GGGGCCGCGTCTACGTGGCGCGG + Intronic
1153815369 18:8786007-8786029 GGTGCAGCTCCCGCGCGGCTCGG - Exonic
1160594003 18:79961967-79961989 GGGACGGCTCCCTCGTGGTGGGG - Intergenic
1160766878 19:812710-812732 GGGGCTGCCCCCGCTGGGCGCGG - Exonic
1160813035 19:1021158-1021180 GGGGCCGCTCTTGCCCGGCGTGG - Exonic
1161458168 19:4380371-4380393 GGGGCCGCTTCCTCCTTGCGGGG + Intronic
1161851761 19:6740861-6740883 GGCGCCGCCCCGGCGTGGCGCGG - Intronic
1162311996 19:9913442-9913464 GGGGGCGCTCCCGGGGGGCGTGG - Intronic
1162552119 19:11363849-11363871 GGGGCTGCTCCCGGCTGGAGAGG + Intronic
1162747383 19:12806372-12806394 GGGGCCCCGCCTGCGTGGCCCGG - Intronic
1162802276 19:13118208-13118230 GGGGCCGCTCCTCCCTGGCCTGG + Intronic
1163427119 19:17245815-17245837 GCGGCCGCTCCTGCCTGGCCTGG + Exonic
1164231201 19:23290093-23290115 GGGGCGGCTGCCGGGTGGAGGGG + Intergenic
1165256032 19:34577705-34577727 GGGGGCGGGCCCGGGTGGCGTGG + Intergenic
1165852170 19:38855887-38855909 GGGGCGGCTGCCGGGTGGAGAGG + Intergenic
1165867852 19:38949914-38949936 GGGGCCGCGCGAGCGAGGCGGGG - Intronic
1166421452 19:42639686-42639708 GGGGCGGCTGCCGGGTGGAGGGG + Intronic
1168685701 19:58347834-58347856 GGGGACACTCACGTGTGGCGCGG - Intronic
926012964 2:9423199-9423221 GGGGCCGCGCTCCCGGGGCGCGG - Exonic
927747231 2:25633963-25633985 GGGGCGGCTGCCGGGTGGAGGGG - Intronic
928542197 2:32294271-32294293 GGGGCGGCTGCCGGGTGGAGGGG + Intronic
930665609 2:54096157-54096179 GGGGCGGCTGCCGGGTGGAGGGG + Intronic
932699929 2:73985263-73985285 GGGGCCGCTCCTCCGGTGCGGGG + Intergenic
940987323 2:160062487-160062509 GGATCCGCTTCCGCGCGGCGGGG - Exonic
942024699 2:171900030-171900052 GGGGCGGCTACCGGGTGGAGGGG - Intronic
942355618 2:175108204-175108226 GGGGCGGCTGCCGGGCGGCGGGG - Intronic
943578039 2:189653648-189653670 GGGGCAGCTGCCGGGTGGAGGGG - Intergenic
945115167 2:206401472-206401494 GGGGCAGCTGCCGGGTGGAGGGG + Intergenic
945189026 2:207166926-207166948 GCGGCGGCGCCCGCGGGGCGGGG - Intronic
945673890 2:212832805-212832827 GGAGCCGGTGCCGCGTGGCGTGG - Intergenic
946326056 2:218985226-218985248 GGGGCAGCCCGGGCGTGGCGGGG + Exonic
948886732 2:240888528-240888550 GGGGCAGCTTCCGCGTGGCCAGG + Exonic
1169441807 20:5639402-5639424 GGGGCGGCTGCCGGGTGGAGGGG + Intergenic
1172237705 20:33389335-33389357 GGGGCGGCTGCCGCGCGGAGGGG - Intronic
1172237715 20:33389375-33389397 GGGGCGGCTGCCGCGCGGAGGGG - Intronic
1172735826 20:37126011-37126033 GGGGCGGCTGCCGGGTGGAGGGG - Intronic
1176194453 20:63830941-63830963 GAGGGCGCCCCCGCGGGGCGGGG + Intronic
1180830049 22:18900478-18900500 GGGGCAGCTGCCGGGCGGCGGGG + Intergenic
1181169939 22:21002345-21002367 GGGGCCGCTCCATCGTGCCGGGG - Intergenic
1181812556 22:25412850-25412872 GGGGCAGATCCCTCGTGGCTTGG - Intergenic
1181921867 22:26326953-26326975 GGGGCCGTCCCCGCCTGGCGTGG - Intronic
1183371622 22:37435723-37435745 GGAGCCGCTCCTACGTGGTGAGG - Intergenic
1183476593 22:38039084-38039106 GGAGCCGCTCCCGGGAGGCAAGG - Intronic
1184153114 22:42649667-42649689 GGGGCCGGTCCTGCCTGGCCTGG + Intergenic
1184766842 22:46576744-46576766 GCGGGCGGTCCCGCGGGGCGCGG + Intronic
1203280140 22_KI270734v1_random:125749-125771 GGGGCAGCTGCCGGGCGGCGGGG + Intergenic
949853384 3:8440046-8440068 GGGGCGGCTTCCGGGTGGAGGGG - Intergenic
950032893 3:9863652-9863674 GGGGCCGCTCCCTGGGGTCGAGG - Intergenic
950917108 3:16657170-16657192 GGGGCAGATCCCTCGTGGCTTGG - Intronic
954540771 3:51391766-51391788 GGGGCCGAGCCCGCGTGTCCCGG + Exonic
954567074 3:51608071-51608093 GGGGCGGCTGCCGGGTGGAGGGG + Intronic
955173055 3:56584376-56584398 GGGGCGGCTGCCGGGTGGAGGGG + Intronic
957789273 3:84918821-84918843 GGGGCGGCTGCCGGGTGGAGGGG - Intergenic
960955096 3:123026387-123026409 CGGCCCACTCCCGCCTGGCGCGG + Intronic
961446443 3:126983642-126983664 GCGGCAGCTCCGGGGTGGCGGGG + Intergenic
961647431 3:128400110-128400132 GGGGCAGCTCCCTCTTGGCCAGG + Intronic
961704422 3:128773347-128773369 GGGGCGGCTGCCGGGTGGAGGGG - Intronic
961785630 3:129344976-129344998 GGGGCCGCTCCCTGGAGTCGAGG - Intergenic
962787906 3:138784985-138785007 GGGGCGGCTGCCGGGTGGAGGGG - Intronic
962788957 3:138793376-138793398 GGGGCGGATCCCGCGAGGTGAGG + Intronic
963249098 3:143086832-143086854 GGGGCGGCTGCCGGGTGGAGGGG + Intergenic
963249110 3:143086872-143086894 GGGGCGGCTGCCGGGTGGAGGGG + Intergenic
964801717 3:160565310-160565332 GGGGCGGATCCCGCGGGGCCCGG - Exonic
965650049 3:170923708-170923730 GGGGCGGCTGCCGGGTGGAGGGG - Intergenic
968493286 4:901811-901833 GGCGCCGCTCCCGATTAGCGAGG + Intronic
968512702 4:1002595-1002617 GGGTCGGCCTCCGCGTGGCGGGG + Intronic
969285434 4:6199730-6199752 GGGGCCGCGCCCCGGCGGCGCGG - Intronic
969394233 4:6910095-6910117 GGAGCCGCGGCCGCGCGGCGAGG - Intronic
970715443 4:18916640-18916662 GGGGCAGATCCCTCGTGGCTTGG + Intergenic
972385462 4:38561484-38561506 GGGGCAGATCCCTCGTGGCTTGG + Intergenic
972939728 4:44181924-44181946 GGGGCGGCTGCCGGGTGGAGGGG - Intronic
975094102 4:70437442-70437464 TGGGACGCTACAGCGTGGCGGGG - Intronic
980056544 4:128083906-128083928 GGGGCGGCTGCCGGGTGGAGGGG + Intronic
980075269 4:128287687-128287709 GCTGCCGCTCCCGCGTCGCCTGG + Exonic
983906042 4:173183883-173183905 GGGGCGGCTGCCGGGTGGAGGGG + Intronic
989068177 5:37483839-37483861 GGGGCGGCTGCCGGGTGGAGGGG + Intronic
999455661 5:151714130-151714152 GGGGCGGCTGCCGGGTGGAGGGG + Intergenic
999532666 5:152480094-152480116 GGGGCGGCTGCCGGGTGGAGGGG + Intergenic
1001418251 5:171564207-171564229 GGGGCAGATCCCTCGTGGCTTGG + Intergenic
1002291808 5:178205259-178205281 GGGGCCGCTCGCGCGCTGCCAGG + Intronic
1006187589 6:32189876-32189898 GGGGCCGCCCCCTCCAGGCGGGG - Exonic
1007523009 6:42466546-42466568 GGGGCGGCTGCCGGGTGGAGGGG - Intergenic
1008370203 6:50722948-50722970 GGGTCCGCTCCCTCTTCGCGTGG - Intronic
1010107072 6:72182617-72182639 GGCGCCGCTCGTGCCTGGCGCGG - Exonic
1010400621 6:75442038-75442060 GGGGCGGCTGCCGGGTGGAGGGG + Intronic
1011272530 6:85593889-85593911 GCGGCCGCGCACGCGCGGCGGGG - Exonic
1012899605 6:104991297-104991319 GGGGCGGCTGCCGCGCGGAGGGG + Intronic
1015626347 6:135183113-135183135 TCGGCCGCCCCCGCGGGGCGGGG + Intronic
1016123646 6:140373953-140373975 GGGGCGGCTGCCGGGTGGAGGGG + Intergenic
1017493809 6:154966431-154966453 GGGGCGGCTGCCGGGTGGAGGGG + Intronic
1017880553 6:158559994-158560016 GGGGCCGCGGGCGCGCGGCGAGG - Intronic
1019273402 7:163395-163417 GGAACCCCTCCCGTGTGGCGTGG - Intergenic
1021991866 7:26148210-26148232 GGGGCGGCTGCCGGGTGGAGGGG - Intergenic
1022187869 7:27987406-27987428 GGGGCGGCTGCCGGGTGGAGGGG - Intronic
1025000576 7:55311967-55311989 GGGGCGGCTGCCGGGTGGAGGGG - Intergenic
1026471127 7:70694663-70694685 GGGGCCGCGCTGGCGCGGCGGGG - Intronic
1028595667 7:92545058-92545080 GGGGCAGCTGCCGGGTGGAGGGG + Intergenic
1029640226 7:101815793-101815815 GGGGCCGCGCGCGCGAGGCCGGG + Intergenic
1031383635 7:121118898-121118920 GGGGCGGATCCCTCGTGGCTTGG - Intronic
1035453319 7:158993027-158993049 GGGGCGGCTCCTCCGTCGCGGGG + Intergenic
1036811232 8:11868449-11868471 GGAGGCGGTCCCGCGAGGCGGGG - Intronic
1038035316 8:23682304-23682326 GGCGCCGATCGCGGGTGGCGCGG + Intronic
1038460668 8:27713915-27713937 GGGGCAGCTCCCTCATGGCTTGG + Intergenic
1049552734 8:143267886-143267908 GGGTCCGCTCCCACGGGGCTGGG + Intronic
1049816553 8:144605803-144605825 GGGGCGGCTCACGGGTGCCGTGG - Intronic
1050231172 9:3526751-3526773 GGTGCCGCCGCAGCGTGGCGCGG + Intergenic
1050512980 9:6413766-6413788 TGGGCAGCCCCCGCGAGGCGCGG + Intronic
1053381184 9:37650816-37650838 GGGGCTCCTCCCCCGGGGCGGGG + Intronic
1053736756 9:41107262-41107284 GTGGCACCCCCCGCGTGGCGGGG + Intergenic
1053737144 9:41108727-41108749 GAGGCACCTCCCGCGAGGCGGGG + Intergenic
1053737172 9:41108807-41108829 GAGGCACCTCCCGCGAGGCGGGG + Intergenic
1054691176 9:68322510-68322532 GAGGCACCTCCCGCGAGGCGGGG - Intergenic
1054691204 9:68322590-68322612 GAGGCACCTCCCGCGAGGCGGGG - Intergenic
1054691617 9:68324135-68324157 GAGGCACCCCCCGCGTGGCGGGG - Intergenic
1056054162 9:82803444-82803466 GGGGCAGATCCCTCGTGGCTTGG + Intergenic
1056992619 9:91424703-91424725 AACGCCGCACCCGCGTGGCGGGG - Intergenic
1057354407 9:94322161-94322183 GGGGCAGGGCCCGTGTGGCGGGG - Intronic
1057429448 9:94980358-94980380 GGGGGCGGTCCCGTGTGGTGAGG + Intronic
1057478662 9:95426849-95426871 GAGGCCTCTCCCCCGCGGCGGGG + Intergenic
1057490438 9:95516201-95516223 GAGGCCAGCCCCGCGTGGCGGGG - Intronic
1057653355 9:96935474-96935496 GGGGCAGGGCCCGTGTGGCGGGG + Intronic
1059405830 9:114098079-114098101 GGCGGCGCCCCCGCGGGGCGGGG - Intronic
1060128687 9:121074927-121074949 GGGGCCGCGCGCGCGTGGTCGGG - Intronic
1060280779 9:122214177-122214199 CGGGCCGGACCCGGGTGGCGGGG - Intronic
1060524749 9:124314149-124314171 CGGGCCGCTCCTGCCTGGCCAGG - Intronic
1061559543 9:131393951-131393973 GCCGCCGCTCCCGGGAGGCGCGG + Intergenic
1062162396 9:135087622-135087644 GGGGCCGCGGCCGGGAGGCGGGG - Intronic
1062414177 9:136439566-136439588 GGGGCGGCTGCCGCATGGCCCGG + Exonic
1203792180 EBV:157596-157618 GGGGGTGCTCCCGCGGGCCGCGG + Intergenic
1186922982 X:14302782-14302804 GGGGCAGCTGCCGGGTGGAGGGG + Intergenic
1187826098 X:23334518-23334540 GGGGACGCGGCCGCGCGGCGCGG + Exonic
1192352896 X:70371848-70371870 GGGGCGGCTGCCGGGTGGAGGGG + Intronic
1192464092 X:71341771-71341793 GGGGCGGCTGCCGGGTGGAGGGG + Intergenic
1192794192 X:74412750-74412772 GGGGCGGCTGCCGGGTGGAGGGG + Intergenic
1192794204 X:74412790-74412812 GGGGCGGCTGCCGGGTGGAGGGG + Intergenic
1193362198 X:80591180-80591202 GGGGCGGCTGCCGGGTGGAGGGG - Intergenic
1198600801 X:138282783-138282805 GGGGCGGCTGCCGGGTGGAGGGG + Intergenic
1199134349 X:144233143-144233165 GGGGCAGGTCCCTCGTGGCTTGG + Intergenic
1199836763 X:151599509-151599531 GGGGCGGCTGCCGGGTGGAGGGG + Intronic