ID: 1127592447

View in Genome Browser
Species Human (GRCh38)
Location 15:60439078-60439100
Sequence CTTGCTTTGCATGCAGTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127592447 Original CRISPR CTTGCTTTGCATGCAGTGTG AGG Intronic
901454968 1:9357991-9358013 CTTGCCTGGCCTGCAGGGTGGGG - Intronic
907818617 1:57944875-57944897 CTTGCTCTGCTTCCTGTGTGAGG - Intronic
907856118 1:58305595-58305617 ATTTCTTTGCATGCATTGTAAGG - Intronic
908066650 1:60413421-60413443 CTTGCTTTGGATTCAGTATTTGG + Intergenic
909021529 1:70436553-70436575 CTTGTTTTGCAAGCATTGTGTGG + Intronic
910535366 1:88291780-88291802 AATGTTTTGCATGCAGTGTGTGG + Intergenic
913648496 1:120886140-120886162 CTTGCTTTTCATGAACTATGAGG + Intergenic
913708030 1:121447958-121447980 CTTGCTTTTACTGCATTGTGTGG + Intergenic
914297997 1:146348375-146348397 CTTGCTTTTCATGAACTATGAGG - Intergenic
914527760 1:148486894-148486916 CTTGCTTTTCATGAACTATGAGG - Intergenic
914638630 1:149580171-149580193 CTTGCTTTTCATGAACTATGAGG + Intergenic
915098979 1:153484949-153484971 CTTGCCCTGCATGGAGTGTCTGG + Intergenic
916852281 1:168715702-168715724 TGGGCTTTGCATGCTGTGTGGGG - Intronic
917294285 1:173502877-173502899 ATTGCTATGCTTGCAGTTTGTGG - Intronic
917532789 1:175851983-175852005 CTTGATTATCATGCAGTGGGAGG + Intergenic
922614373 1:226952847-226952869 GTTGCTTTTCATGCAGTGGTGGG - Intronic
924094475 1:240536916-240536938 CTTGCTTTGCTTGGATTCTGTGG - Intronic
924390959 1:243556485-243556507 CTTGCCTTGGGTGCATTGTGTGG - Intronic
1063852818 10:10212278-10212300 CTTACTTTGCATATAGTGTTTGG - Intergenic
1066186648 10:33015965-33015987 CTTGCTTTGTCTGTAGTTTGTGG - Intergenic
1072395438 10:95034564-95034586 TTTGCCTTGCTTCCAGTGTGGGG + Intergenic
1072498622 10:95989301-95989323 TTTGCTTTACATCCAATGTGAGG + Intronic
1073183667 10:101602242-101602264 CTTGCTTTACATGCAGTAATGGG + Intronic
1075313439 10:121433305-121433327 CTTTCTTTGCCTGCTCTGTGGGG - Intergenic
1076815054 10:132910447-132910469 CGTGCTTTGCCTGCAGTGACGGG + Intronic
1077398163 11:2336820-2336842 CTTGCCTTGCCTGCCGTGAGAGG - Intergenic
1078392209 11:10945035-10945057 ATTGGTTGGCATGCAGTGTGGGG - Intergenic
1078436659 11:11331049-11331071 CTTGCTATGGGTGGAGTGTGGGG + Intronic
1078513967 11:12007858-12007880 CTTGCTTCTCACGCAATGTGGGG - Intronic
1080051147 11:27860309-27860331 CTATCTTTGCTTGCACTGTGTGG + Intergenic
1083482968 11:62961553-62961575 CTGCCTTTGGATGCTGTGTGAGG + Intronic
1084409166 11:68996638-68996660 CCTGTCTTGGATGCAGTGTGTGG + Intergenic
1084507344 11:69576431-69576453 TTTGCTTTGCAAGCAGTGAATGG - Intergenic
1084964934 11:72739515-72739537 CTTGCCTTGCATACTGGGTGGGG - Intronic
1085163360 11:74370305-74370327 CTTGCTTTGCACGGAGCGTGGGG - Intronic
1086137006 11:83451899-83451921 CTTTCTTTGCATGAAATGTTGGG + Intergenic
1087691880 11:101329960-101329982 CTTGCTCTCCATGCAGTGGTTGG - Intergenic
1089160630 11:116434372-116434394 CTGGCTCTGCATGCAGGATGTGG + Intergenic
1089999393 11:122941671-122941693 TTTGCTTTGTATTCAGTGTTAGG + Intronic
1092938452 12:13385828-13385850 CTTTCTTTGCATGCATTGGCAGG + Intronic
1095279683 12:40335582-40335604 CTTGCTCTGGATGCAGGGTTAGG - Intronic
1096217782 12:49808133-49808155 CTGGCTTTGTGTGGAGTGTGTGG - Intronic
1096428420 12:51523337-51523359 CTTGCTGGGCATGCACTGTGGGG - Intergenic
1096992441 12:55815830-55815852 CATATTTTGCATGCAGTTTGAGG - Intronic
1103425316 12:120829131-120829153 CTGTTTTTGCATACAGTGTGAGG - Intronic
1104808882 12:131608027-131608049 CTCACTTTGCATGCAGTGGCTGG + Intergenic
1106226561 13:27790875-27790897 GTTGCTTGGCATGGAGTGGGGGG - Intergenic
1106339779 13:28817735-28817757 CTTTCTTTGCATGAAGTGGGTGG - Intergenic
1106989239 13:35397051-35397073 CTTACTTTGGCTTCAGTGTGAGG - Intronic
1108580817 13:51826782-51826804 CTTGGCTTGCATCCACTGTGTGG - Intergenic
1108805800 13:54154786-54154808 ATAGCTTTATATGCAGTGTGAGG - Intergenic
1109991464 13:70063294-70063316 CTTGTTATTCATGCAGTCTGTGG - Intronic
1110348242 13:74474536-74474558 TTTGTTTTGGATGCAGTGTTTGG + Intergenic
1112977916 13:105343827-105343849 CTGGCTTTTCAGGCAGTGGGGGG - Intergenic
1113005994 13:105702757-105702779 CCAGCTTTGCATACAGTGTCTGG - Intergenic
1114724139 14:24916567-24916589 TTTGCTTTGCAGGGTGTGTGGGG + Intronic
1114741539 14:25103372-25103394 GTTAGTTTGCATGGAGTGTGGGG + Intergenic
1117157164 14:52951776-52951798 ATTGCTTTGCAAGCAATGTCCGG + Intronic
1120125769 14:80741087-80741109 CTTGCTTTCCAGGCACTGGGTGG - Intronic
1121661600 14:95639370-95639392 CTTGCTTTTCATGAAGTTTCAGG + Intergenic
1121956219 14:98215994-98216016 CTTGTTTTAATTGCAGTGTGGGG + Intergenic
1122950657 14:105042686-105042708 CTTTCTTAGCTTGCAGTCTGTGG - Intergenic
1123959203 15:25377335-25377357 CTCTGTTTGCATGCAGTGAGTGG - Intronic
1124035741 15:26052355-26052377 CTTCCTTTGCAGGCAGTGGAAGG + Intergenic
1124186658 15:27535959-27535981 CTTGCTTTGCATGCAGAATTGGG + Exonic
1127376176 15:58387118-58387140 CTTGCTTTGCATGGAGAGGATGG + Intronic
1127592447 15:60439078-60439100 CTTGCTTTGCATGCAGTGTGAGG + Intronic
1128443068 15:67731483-67731505 CTTCCTTGGCATGCAGTTTAGGG + Intronic
1132332633 15:101023369-101023391 CTTGCTTTCCATTCAGTGCCAGG + Intronic
1132806329 16:1776773-1776795 CTTGCTCTGCATGCTGTCAGCGG - Exonic
1134239964 16:12498414-12498436 CTTGCTTGGGAAGCAGTGTAGGG + Intronic
1134346032 16:13392825-13392847 CGTGCTTTGCAGGCAGTCTTTGG - Intergenic
1135846509 16:25923697-25923719 CTTTCTGTGCAGGCAGTGAGAGG - Intronic
1136221717 16:28833608-28833630 CTTGCCTGGCAGGCAGTGTGAGG + Intronic
1136743173 16:32558137-32558159 CTTTCTTTGGATTCAGTGGGTGG + Intergenic
1138045203 16:53715332-53715354 CTTGTTTTACATTCAGTCTGCGG + Intronic
1140982726 16:80126208-80126230 TTTGCTTTGCACCCAGTGTGTGG - Intergenic
1203026426 16_KI270728v1_random:517092-517114 CTTTCTTTGGATTCAGTGGGTGG - Intergenic
1203045295 16_KI270728v1_random:817339-817361 CTTTCTTTGGATTCAGTGGGTGG + Intergenic
1143072980 17:4313098-4313120 CTGGATTTGGATGTAGTGTGAGG - Intronic
1143733726 17:8895978-8896000 CCTGCTTAGCATGGGGTGTGGGG + Intronic
1144642373 17:16944699-16944721 CTTGCTGTGCATGGGGAGTGGGG - Intronic
1151989837 17:77567264-77567286 TTTGCTTTGCATGCAGGAGGAGG - Intergenic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1154143219 18:11844086-11844108 CTTACTTTACATGAAGTGTGTGG + Intronic
1155202154 18:23526785-23526807 CTTGCTCTGATTCCAGTGTGAGG + Intronic
1155656849 18:28202719-28202741 TGTGCTTTGAATGAAGTGTGAGG - Intergenic
1156474225 18:37395441-37395463 CCTGCTATGCATGAAGTGTGCGG - Intronic
1156503629 18:37575483-37575505 CTTGCTCTGCATACCTTGTGGGG + Intergenic
1158184130 18:54752115-54752137 CTTGCTTTGCATGTAAATTGAGG + Intronic
1159028151 18:63205776-63205798 TTTGCTTTGCAAGCAGGGGGTGG - Intronic
1161455364 19:4367156-4367178 CCTGCTCTGCAGGCAGCGTGTGG - Intronic
1163850894 19:19663075-19663097 CTTGCTGTGCATGCCTGGTGCGG - Intronic
1164411823 19:28012563-28012585 TGTGCATTGTATGCAGTGTGTGG + Intergenic
1164864897 19:31596648-31596670 CTTTCATTGCATGCAATGTAGGG + Intergenic
926503005 2:13678172-13678194 CTTGCTTTGCCTGCCCTGGGAGG - Intergenic
932760996 2:74439388-74439410 CTTGTGTTGGGTGCAGTGTGTGG - Intronic
935104928 2:100032551-100032573 GTTGGTTTGTATACAGTGTGAGG - Intronic
935933003 2:108150029-108150051 CTTGCTTTGCCTGTAGTTTGGGG - Intergenic
936958716 2:118050193-118050215 CATGCTTTGCTTCCAGTTTGGGG - Intergenic
938248148 2:129794696-129794718 TCTGCTTTGCATGCAGACTGAGG + Intergenic
947244313 2:228030185-228030207 CCTGATGTGCATGCAATGTGGGG + Intronic
948317747 2:237042130-237042152 CATGCTTTGCATGTATTTTGTGG + Intergenic
1168813930 20:723862-723884 CTTCCTGTGCGTGCAGTGAGAGG - Intergenic
1173835357 20:46121832-46121854 TTTTCTCTGCATGCAGTGGGTGG - Exonic
1174610481 20:51794156-51794178 CCTGCTTTGCACGCAGTAGGAGG - Intronic
1174731567 20:52923157-52923179 CCTGCTTTCCATGCAAGGTGGGG + Intergenic
1175806800 20:61834099-61834121 CTTGCTCTGCATGGACTGTGTGG - Intronic
1178243109 21:30925343-30925365 CTTCCTTTAAATGCAGTGTGGGG + Intergenic
1179575205 21:42304046-42304068 GTTGCTTTGCACGCTGTGAGAGG + Intergenic
1181920435 22:26316371-26316393 CCTGCTAGGCATGCAGGGTGAGG - Intronic
950825074 3:15810130-15810152 CTTACTGTGCATACAGTGTCAGG + Intronic
952378643 3:32787418-32787440 ATTGTTTTGGAAGCAGTGTGGGG - Intergenic
956021185 3:64934848-64934870 CTTGCATTGGAAGCAGTGTTGGG + Intergenic
963037803 3:141047696-141047718 CGTGCTGTGCCTGCAGTGTTGGG + Intergenic
964259479 3:154819215-154819237 CTGGCTTTGCATGGTGAGTGAGG + Intergenic
967218534 3:187229891-187229913 CCTCCCTTGGATGCAGTGTGTGG - Intronic
967919755 3:194605788-194605810 CCTGCTTTGCCTCCAGTGAGGGG + Intronic
967998892 3:195187656-195187678 ATTGCTTTGCATGCACATTGAGG + Intronic
968317300 3:197735972-197735994 CTTGCTTAGTTTGCATTGTGAGG + Intronic
968753548 4:2402813-2402835 CCTGGTTTTCATGCAGTGAGAGG - Intronic
969240789 4:5895888-5895910 CCTGTTTTGCATGCAGTCTTGGG + Intergenic
969340155 4:6535438-6535460 CTCGCGTTGCATGTGGTGTGTGG - Intronic
971363026 4:25954164-25954186 CTCCCTGTGCATTCAGTGTGTGG - Intergenic
976391539 4:84509850-84509872 CTTGATTTGCATCCAATATGTGG - Intergenic
976895804 4:90109368-90109390 CTTGATTTGCATGTTGTGTTAGG - Intergenic
980883092 4:138733095-138733117 CTTGCTTTGCATCCACTGATGGG + Intergenic
980959507 4:139461030-139461052 CTTGCTTTGGAGACTGTGTGAGG + Intronic
983999852 4:174226624-174226646 CTTGTTTTGCATGCAGAGAAGGG + Intergenic
989683581 5:44058741-44058763 CCTGCTTTGCATGTGTTGTGTGG + Intergenic
991184457 5:63791028-63791050 CTAGCTTTCCTTGCAGTGAGGGG - Intergenic
992163949 5:74030382-74030404 ATTGCTTTGCATCAAGGGTGAGG - Intergenic
992974752 5:82103422-82103444 CTTGCTGTGCTTGCAGTTTTGGG + Intronic
996624553 5:125554505-125554527 CTTACTGTGAATGCAGGGTGAGG - Intergenic
997093576 5:130885057-130885079 CTTGTTTTGCATGTATTGTTTGG - Intergenic
1001118956 5:168962934-168962956 CTTGCTTTGGATGGAGTGATGGG - Intronic
1001713125 5:173793921-173793943 CTTCCTGGGCATGCAGTCTGGGG - Intergenic
1001852412 5:174981037-174981059 TTTTCTTTTCATGGAGTGTGAGG - Intergenic
1002068305 5:176663612-176663634 TTATCTTTCCATGCAGTGTGTGG - Intergenic
1002128702 5:177065835-177065857 TTTGCTTTGCATATTGTGTGTGG + Exonic
1003788579 6:9516277-9516299 CTTGCTTTGCTGCCAATGTGAGG + Intergenic
1003802013 6:9680810-9680832 CCTGCTGTGCATGCACTGTCAGG + Intronic
1004855240 6:19743107-19743129 CTTGCTTTGCACTCACTTTGAGG + Intergenic
1006015823 6:31079742-31079764 CAGGCCTTGCATGCAGTGAGTGG - Intergenic
1006969003 6:38020866-38020888 CTTGCTCTGCATTAAGTGTAGGG + Intronic
1007789081 6:44298595-44298617 GCTGCTTTGCAAGCAGTGAGGGG + Intronic
1009734253 6:67656041-67656063 GTTGCTTTTTATTCAGTGTGAGG + Intergenic
1012315255 6:97777211-97777233 ATTGCATTGCAAGCAGAGTGTGG - Intergenic
1013027444 6:106290967-106290989 CTTGTTTTCCCTGCAGTGAGAGG + Intronic
1013609714 6:111783016-111783038 CGTGCTTAGCATGAAGTATGTGG - Intronic
1015037558 6:128675233-128675255 TTTGCTTTGCAGGAAGTGTCAGG - Intergenic
1016802783 6:148183441-148183463 CTTGCTTTGCAGTCAGTGTGAGG - Intergenic
1020732428 7:11898428-11898450 CTTACTTTGCATTCTGTCTGTGG + Intergenic
1021020072 7:15587002-15587024 CTTGCTGTGCACGCATTGTCAGG + Intergenic
1022826614 7:34020803-34020825 CCTGCTTTGCAGGCAGCATGGGG + Intronic
1023561700 7:41480620-41480642 CTTCTGTTGCATGCAGTGGGTGG + Intergenic
1023641262 7:42261476-42261498 CTGGCTTTGCATACAGTGAACGG - Intergenic
1023815730 7:43948495-43948517 CTGGCTTAGCCTGCACTGTGGGG + Intronic
1024024974 7:45402223-45402245 CTTTCTTTGAATGCAGTGCTTGG - Intergenic
1034429305 7:151033239-151033261 CTTCCTGTCCAGGCAGTGTGTGG + Intronic
1035851792 8:2927148-2927170 CTTGCATTGCTTCCAGTTTGAGG + Intergenic
1038902782 8:31862851-31862873 CTTAATTTGCAGGCACTGTGGGG + Intronic
1040011631 8:42666005-42666027 CCTGCTGTGGGTGCAGTGTGAGG - Intergenic
1041881317 8:62753061-62753083 GTTGCTTTGCTTCCAGTGGGGGG + Intronic
1045142907 8:99306942-99306964 TATGCTTTGAATGCTGTGTGAGG + Intronic
1049662422 8:143825491-143825513 CTGGCTGTGCATGCAGTGGGAGG - Intronic
1051735834 9:20198351-20198373 TTTGCATTGCATGCAGTCTCTGG + Intergenic
1056878680 9:90366454-90366476 CTTGCTTTGATAACAGTGTGTGG - Intergenic
1062249016 9:135584796-135584818 CTGGGTTTTCATGCAGGGTGTGG - Intergenic
1188841639 X:35024598-35024620 CTTGCTGTGTCTGCAGGGTGGGG - Intergenic
1192048189 X:67698753-67698775 CTTGCTTTCCCTGCTGTGTCTGG + Intronic
1193179056 X:78431835-78431857 ATCACATTGCATGCAGTGTGTGG + Intergenic
1196805033 X:119575524-119575546 CTTGAGTGGAATGCAGTGTGTGG + Intronic
1197788480 X:130224800-130224822 CCTGCTTTTCTTGCAGTGGGAGG - Intronic
1199507401 X:148579688-148579710 CTATCACTGCATGCAGTGTGTGG + Intronic