ID: 1127596928

View in Genome Browser
Species Human (GRCh38)
Location 15:60494249-60494271
Sequence TTTGCATTGTGACCAAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127596926_1127596928 5 Left 1127596926 15:60494221-60494243 CCAAAAAGCACTTTCATCTGTAC 0: 1
1: 0
2: 0
3: 19
4: 187
Right 1127596928 15:60494249-60494271 TTTGCATTGTGACCAAGGCCAGG 0: 1
1: 0
2: 0
3: 16
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127596928 Original CRISPR TTTGCATTGTGACCAAGGCC AGG Intronic
901425989 1:9182660-9182682 TTCGCGGTGGGACCAAGGCCCGG + Intergenic
903009197 1:20318442-20318464 CCTGCAGTGTGACCATGGCCAGG - Intronic
903174844 1:21574770-21574792 TTTCCTTTGTGAGCAAGGCCAGG + Intronic
903705421 1:25281972-25281994 TTCTCATTGTTATCAAGGCCAGG + Intronic
905286545 1:36884093-36884115 GATTCATTGTGGCCAAGGCCAGG + Intronic
912691818 1:111810371-111810393 GTTGCACTGTGACCCAGGACAGG + Intronic
917567158 1:176224788-176224810 AGTGCACTGGGACCAAGGCCTGG - Intergenic
917970361 1:180202061-180202083 CTTCCACTGTGACCCAGGCCTGG - Exonic
919486389 1:198153205-198153227 TTTGTATAGTGACCACAGCCAGG + Intergenic
921602443 1:217120954-217120976 TGTTCATTGTGTCCAAGGCATGG + Intronic
921796460 1:219350432-219350454 TTGGAATTGAGACCAAGGGCAGG + Intergenic
1063733783 10:8729503-8729525 ATAGGAATGTGACCAAGGCCAGG + Intergenic
1065406934 10:25378820-25378842 TTTGCTTTGTCACCCAGGCTGGG + Intronic
1068545811 10:58344373-58344395 TTGGCTTTGTGACCTTGGCCAGG + Intronic
1069522721 10:69137539-69137561 TTTGCGTTGTCTTCAAGGCCAGG + Intronic
1070828774 10:79406200-79406222 TTTGCTTTGTGACCTTGGACAGG - Intronic
1071857507 10:89640847-89640869 TTGGCATGGTGACCAAAGACAGG - Intronic
1072351058 10:94557633-94557655 AGTGCATGGTAACCAAGGCCAGG - Intronic
1075535045 10:123264014-123264036 TATGAATTAAGACCAAGGCCTGG - Intergenic
1076137431 10:128054794-128054816 TCTGCATTGTGAGCAAGCCCAGG + Intronic
1076156208 10:128207567-128207589 ATTGCATTGTGATCAAGCCAGGG - Intergenic
1077907475 11:6545535-6545557 TATGCATGGAGACCATGGCCAGG - Exonic
1079423634 11:20318382-20318404 CTTGCCTTGTCACCAAGGCAGGG - Intergenic
1079604382 11:22346349-22346371 TCTGCATTGTGACCAAGAGTGGG - Intronic
1079711897 11:23694366-23694388 TTAGTATTGTGACTAAGACCAGG - Intergenic
1080051102 11:27860009-27860031 TTTCCTTTTTGACCACGGCCTGG - Intergenic
1083540688 11:63509902-63509924 GTTTCCTTGGGACCAAGGCCTGG + Intronic
1086356422 11:86005672-86005694 TTTGCTTTGTCACCCAGGCTGGG - Intronic
1086980421 11:93191299-93191321 TCAGCCTTGTGACCAATGCCAGG - Intronic
1088558870 11:111091900-111091922 TTTGCATTTTGACAAATGCTAGG - Intergenic
1089100614 11:115959252-115959274 TTTGCATTGTGCCTGAGTCCTGG + Intergenic
1089292080 11:117443552-117443574 TGAGCATTGGGACAAAGGCCCGG + Intronic
1090319764 11:125832117-125832139 GCTGCATTGTGTCCACGGCCTGG - Intergenic
1091660350 12:2378621-2378643 TTTGTATTGTCATCATGGCCTGG + Intronic
1093740023 12:22675096-22675118 TTTGCTTTGTCATCCAGGCCTGG + Intronic
1099157880 12:79202230-79202252 TTTTCATTTTGGCCAATGCCTGG - Intronic
1101500834 12:105302205-105302227 TTTGGACTGAGACCAAGCCCAGG - Intronic
1102740155 12:115199827-115199849 ATTGGACTTTGACCAAGGCCTGG + Intergenic
1105518452 13:21111147-21111169 TTTGCACTGTCACCCAGGCTGGG + Intergenic
1107832635 13:44387932-44387954 TTTTAATGGTGACCAAAGCCTGG + Intronic
1110673118 13:78205857-78205879 TGTACATTTTGACCAAGGCCAGG + Intergenic
1112216693 13:97438164-97438186 TTTTCATTGTTACCCATGCCAGG + Intronic
1116623546 14:47237348-47237370 TTTGCATTAAGGGCAAGGCCTGG - Intronic
1117118833 14:52547160-52547182 TTTGCTTTGTGACCATGCACGGG - Intronic
1118905292 14:70019064-70019086 TGTGCATTGCAGCCAAGGCCTGG + Intronic
1119830997 14:77702492-77702514 TTTTCATTGTGCCAATGGCCAGG - Intronic
1122741164 14:103872243-103872265 TTGCCATTGTCACCAAGTCCAGG - Intergenic
1124635971 15:31365501-31365523 TTTGCAATGTTTCCAATGCCCGG - Intronic
1124843629 15:33268382-33268404 TTTGCTCTGTCACCCAGGCCTGG + Intergenic
1127365527 15:58285604-58285626 TTTTCATTTTGTCCAAGCCCAGG - Intronic
1127596928 15:60494249-60494271 TTTGCATTGTGACCAAGGCCAGG + Intronic
1128218008 15:65947556-65947578 TTTGCAGTGGGCCCTAGGCCAGG - Intronic
1132938162 16:2492617-2492639 TGTGCAGTGTGACCCAGGCGTGG + Intronic
1133054308 16:3137962-3137984 TTTGCATTTTGCTCTAGGCCTGG + Intronic
1134853096 16:17498060-17498082 TTTGCATTGTGAACAAATCGAGG + Intergenic
1138952675 16:61932175-61932197 TTTGCTCTGTGGCCCAGGCCTGG - Intronic
1140737800 16:77913728-77913750 TGTGTATTGTAACAAAGGCCAGG + Intronic
1144006658 17:11106380-11106402 TTTATATTATGACCATGGCCAGG - Intergenic
1147691532 17:42318419-42318441 TGGGCATTGTGGCCAAGGCTGGG - Intronic
1149979491 17:61298495-61298517 TTTGCATGGTCACAAAGACCAGG - Intronic
1151195302 17:72427017-72427039 TTTGCTTTGTGACCTGGGGCTGG - Intergenic
1153152237 18:2108643-2108665 TTTGGATTTTAACCAAGGCCAGG - Intergenic
1155818054 18:30340809-30340831 TTTGCATTGTTATCTAGGGCTGG + Intergenic
1159336338 18:67071988-67072010 TTTGCATTGTTTCAAAGTCCAGG + Intergenic
1159664505 18:71141799-71141821 GTTGGATTGTGACAAAGTCCAGG + Intergenic
1162200489 19:9016447-9016469 TTTGCAATGTGTTCAAGGACAGG + Intergenic
1163550836 19:17965825-17965847 TGGGCATTGTCACCACGGCCGGG + Intronic
1164107044 19:22116899-22116921 TTTGCTTTGTGATGAAGGCTAGG - Intergenic
1164139871 19:22449834-22449856 CTTGCTCTATGACCAAGGCCAGG + Intronic
1164330007 19:24245202-24245224 TTTGCACTGAGACCGAGTCCAGG - Intergenic
1164336212 19:24323700-24323722 TTTGGACTGAGACCAAGTCCAGG - Intergenic
926608677 2:14923473-14923495 TTTGCTTTGTGACAAATGCCAGG + Intergenic
928879979 2:36087122-36087144 TTTCCAATGTGACCAAGTCATGG + Intergenic
930380201 2:50618134-50618156 TTTTCACTGTGAGCCAGGCCAGG - Intronic
930866512 2:56127166-56127188 TCTGCATTGTGATCCATGCCAGG + Intergenic
931302544 2:60994791-60994813 TTTGAAATCTGACCAAGGCCGGG + Intronic
932021257 2:68089552-68089574 TATGCATTTTGACCAAGGACAGG - Intronic
932083937 2:68740559-68740581 TTTACATTGTGACCAAAGCATGG - Intronic
940346680 2:152636145-152636167 CTAGCAGTGTGACCAAGGGCAGG + Intronic
941869919 2:170373248-170373270 ATTGCATTGTGAACCAGGCCAGG - Intronic
942314829 2:174688618-174688640 TTTCCAGTGTGACCTAGGGCAGG + Intergenic
942505254 2:176635275-176635297 TTTTCAGTGTGACTAAGGCTAGG - Intergenic
948533539 2:238629628-238629650 TTGGCATTGTAACCACAGCCTGG + Intergenic
1170639562 20:18139448-18139470 TTTACAATGTGACTAAGGCTTGG + Intronic
1172101363 20:32485319-32485341 TTTGCATTGTGAACAATCCATGG + Intronic
1172226135 20:33306392-33306414 TGTGCAGCTTGACCAAGGCCAGG - Intronic
1172768239 20:37362551-37362573 CTTGCTGTGTGACCAAGGCCCGG + Intronic
1173562352 20:44014999-44015021 TTGGCATCGTGACCAAGGGAAGG + Intronic
1174181257 20:48676428-48676450 CTTGCAGTGTGACCGAGGGCAGG + Intronic
1174996775 20:55578302-55578324 TTTGAATGGAGACCTAGGCCTGG - Intergenic
1175310926 20:58011148-58011170 TCTGCATTCTGACCATGGACTGG - Intergenic
1177189948 21:17839703-17839725 TTTCAAATATGACCAAGGCCAGG + Intergenic
1183029848 22:35095387-35095409 GTGGCTTTGTGACCAAGTCCTGG - Intergenic
1184339520 22:43878696-43878718 TTTGCTTTGTGACTTAGACCGGG - Intergenic
954444703 3:50540444-50540466 TCAGCATGGTGAACAAGGCCAGG - Intergenic
958871990 3:99570507-99570529 TTGGCATTGTTTCCAAGGGCAGG - Intergenic
961944238 3:130669997-130670019 TCTGCATGGTGATCAAGGCCAGG + Intronic
962101029 3:132342968-132342990 TTTTCATTAAGACCAAGGACAGG - Intronic
965023165 3:163261532-163261554 TTTGCATTTTGACAAATCCCAGG + Intergenic
965268424 3:166580117-166580139 TTGGCATTGTGAAAAGGGCCAGG - Intergenic
966087796 3:176090920-176090942 TGGGCCTTGTGACCAAGCCCTGG + Intergenic
966730324 3:183145448-183145470 TTCGCTTTGTGACCATGGACAGG - Intronic
966949651 3:184804616-184804638 TTTGCTCTGTCACCCAGGCCGGG + Intergenic
968798581 4:2726633-2726655 TTAAATTTGTGACCAAGGCCAGG + Intronic
969240738 4:5895447-5895469 TTTCCATTGTGAGAAAGGGCTGG + Intergenic
969948072 4:10805320-10805342 TTTGGATTTGGACCAAGACCAGG + Intergenic
969999387 4:11349434-11349456 TTTGAAGTGTGACCTAGGCCAGG + Intergenic
975402243 4:73951707-73951729 TTTGGACTGAGACCAAGCCCAGG + Intergenic
975576584 4:75868980-75869002 CTTGCTCTGTCACCAAGGCCAGG - Intronic
976749492 4:88439718-88439740 GTTGTATTGTGACCAAAACCTGG - Intronic
976751154 4:88452403-88452425 TTTGCAAAGTGACCACTGCCAGG - Intergenic
977484908 4:97632728-97632750 TTTTCAATGTGACCAAGACCAGG + Intronic
978764603 4:112391254-112391276 TTTGCCTTGTGAACAAGGTAGGG + Intronic
982184566 4:152782279-152782301 TTTGCTTTGGGACCAAGGAAAGG + Intronic
982277649 4:153652667-153652689 ATTGCAAAGTGACCAAGGCAAGG - Intergenic
982433298 4:155349243-155349265 TATCCATTGTGACTAAGGCTTGG + Intronic
982471991 4:155803704-155803726 TTTCCATCATGTCCAAGGCCAGG - Exonic
983741579 4:171140727-171140749 TTTGCTTTGTCAGCCAGGCCTGG + Intergenic
984494746 4:180482258-180482280 TCTGCATTGTGATCAATGCAAGG - Intergenic
985664043 5:1172504-1172526 TCTGCAGAGTGACCAAGACCCGG + Intergenic
985829892 5:2220571-2220593 CTTGTATGGTGACCAAGCCCTGG + Intergenic
988705887 5:33725615-33725637 TTTGAGTTGTGCCCAAGTCCCGG - Intronic
989261505 5:39424370-39424392 TTTGCTGTGTGACAAAGGCTGGG - Intronic
991591758 5:68258784-68258806 CCTGCATTGTGACAAACGCCAGG + Intronic
992137084 5:73757638-73757660 GTTGCATTGTGACTAATGACGGG - Intronic
992322776 5:75630043-75630065 TTTGCGATTTGCCCAAGGCCTGG + Intronic
993706164 5:91173072-91173094 TTTGCATTGTGGCAAAGGCAGGG + Intergenic
995284045 5:110366624-110366646 TTTTCATTGTGAGCAAAGCTTGG + Intronic
997234499 5:132264971-132264993 TTTGCTTTGAGCCCAAAGCCAGG + Intronic
997667972 5:135647669-135647691 TTTGCATTGTGCTCATGGCAGGG + Intergenic
998460092 5:142303556-142303578 TGTGGATTGTGAAGAAGGCCGGG + Intergenic
999059645 5:148619631-148619653 TTTGCATTGTGTCGATGGCTAGG - Intronic
999783966 5:154874563-154874585 CTTGCATTGTCACCCAGGCTGGG + Intronic
1001204384 5:169748428-169748450 TATGGAGTGTGACCCAGGCCAGG + Intronic
1001671975 5:173481275-173481297 CTTGCATTGTGTCCCTGGCCTGG + Intergenic
1003290988 6:4777339-4777361 TTAGCATTGTGGCCAGAGCCAGG + Intronic
1006735715 6:36271039-36271061 TTTGCATTTTGAAAGAGGCCAGG - Intronic
1006893715 6:37452219-37452241 TTTGCTGTGTGACCTTGGCCCGG + Intronic
1013686631 6:112592348-112592370 TCTGCAATGTGAACATGGCCTGG - Intergenic
1016181871 6:141156659-141156681 CTTGCCTTGTCACCCAGGCCAGG + Intergenic
1016510703 6:144839764-144839786 TCCCCATTGTGACCAAGGACAGG - Intronic
1018173474 6:161160273-161160295 AATGCAATGTGAGCAAGGCCAGG - Intronic
1018555908 6:165050422-165050444 TTTGCTTTGGTACAAAGGCCCGG + Intergenic
1018848904 6:167573660-167573682 TTTGCACCGTGACCAACGTCAGG - Intergenic
1023901618 7:44485579-44485601 TTTGCATTGTGAACAAGACTGGG - Intronic
1023941896 7:44773943-44773965 TTTGCTCTGTCACCAAGGCTGGG + Intergenic
1023964470 7:44955759-44955781 TATGCATGTTGACCAAAGCCAGG + Intergenic
1025789908 7:64679887-64679909 ATTGCATTGGGAACAAGGGCTGG - Intronic
1027133455 7:75607800-75607822 TTTGCAGTGTGACCAAGCTCAGG + Intronic
1027238206 7:76310594-76310616 TTGGCAGTGTGACAAATGCCGGG + Intergenic
1029421920 7:100476359-100476381 TGTGGTTTGTGCCCAAGGCCAGG + Intronic
1030333386 7:108297054-108297076 TTTGGCTTGTGACTAATGCCTGG - Intronic
1034348392 7:150400986-150401008 TTTGTATTCTTTCCAAGGCCAGG + Intronic
1034502101 7:151457332-151457354 GCTGCATTGTGTCCAAGTCCTGG - Intergenic
1035815005 8:2529507-2529529 TTTCCATTTAGACAAAGGCCAGG + Intergenic
1043329353 8:79095188-79095210 TTTGCATTCTCACCAATGCTTGG - Intergenic
1043472375 8:80575602-80575624 TGTGCAGAGTCACCAAGGCCAGG - Intergenic
1043776033 8:84270208-84270230 TGTGCATTGTGATCAATGACAGG + Intronic
1044957001 8:97491471-97491493 TCTGCCATGTGACCAAGCCCAGG - Intergenic
1048748110 8:137638033-137638055 TGTGCATTGTGTCTAAGGCAGGG - Intergenic
1052160495 9:25252408-25252430 TTTGCATTGTGATGAAACCCTGG - Intergenic
1052630377 9:31030213-31030235 TTTGCATTATGACAAAAGGCAGG - Intergenic
1057297645 9:93858938-93858960 GTGGCATTGTGACAATGGCCAGG + Intergenic
1059720481 9:116955124-116955146 TTAGCTTTGTGACCTTGGCCAGG + Intronic
1060524338 9:124312081-124312103 TTTGCATGGTGGCCACGGGCTGG + Intronic
1187207926 X:17200549-17200571 TCAGCCTTGTGAACAAGGCCAGG - Intergenic
1188166668 X:26871670-26871692 TCTGCATTGTGTCCATGCCCTGG - Intergenic
1197105403 X:122707862-122707884 CTTGCTTTGTCACCAAGGCTGGG - Intergenic
1198427540 X:136535107-136535129 TTTGCATTCAGACCAGGTCCTGG - Intronic