ID: 1127597162

View in Genome Browser
Species Human (GRCh38)
Location 15:60497178-60497200
Sequence TGACCTCTGTTTACAACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 110}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127597162_1127597166 20 Left 1127597162 15:60497178-60497200 CCTCCTGTTGTAAACAGAGGTCA 0: 1
1: 0
2: 1
3: 12
4: 110
Right 1127597166 15:60497221-60497243 GAAAAAGGGTCCATATCTGTAGG 0: 1
1: 0
2: 0
3: 10
4: 119
1127597162_1127597164 5 Left 1127597162 15:60497178-60497200 CCTCCTGTTGTAAACAGAGGTCA 0: 1
1: 0
2: 1
3: 12
4: 110
Right 1127597164 15:60497206-60497228 CAAGAAGTCAAGACAGAAAAAGG 0: 1
1: 0
2: 3
3: 68
4: 626
1127597162_1127597167 28 Left 1127597162 15:60497178-60497200 CCTCCTGTTGTAAACAGAGGTCA 0: 1
1: 0
2: 1
3: 12
4: 110
Right 1127597167 15:60497229-60497251 GTCCATATCTGTAGGCATAATGG 0: 1
1: 0
2: 0
3: 4
4: 118
1127597162_1127597165 6 Left 1127597162 15:60497178-60497200 CCTCCTGTTGTAAACAGAGGTCA 0: 1
1: 0
2: 1
3: 12
4: 110
Right 1127597165 15:60497207-60497229 AAGAAGTCAAGACAGAAAAAGGG 0: 1
1: 1
2: 9
3: 147
4: 1401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127597162 Original CRISPR TGACCTCTGTTTACAACAGG AGG (reversed) Intronic
900581956 1:3413823-3413845 CGGCCTCTGTTTACCACAGGAGG + Intronic
902112945 1:14098443-14098465 GGAGCTCTGTTTGCAACAGAAGG + Intergenic
903456500 1:23490918-23490940 TGACCTCTGGGTTCAGCAGGTGG - Intergenic
912489446 1:110053849-110053871 TGACCTCTGGTTAGAAAGGGAGG + Exonic
917710390 1:177678704-177678726 TTTCCTGTGTTTACAAGAGGAGG + Intergenic
918192368 1:182188112-182188134 TGACCAGTTTTTACCACAGGAGG - Intergenic
920869078 1:209778302-209778324 TGACCTCACTTTACAAGAAGAGG - Intronic
923518476 1:234717663-234717685 TGTCCTCTCTTTGCAACACGAGG + Intergenic
1063983885 10:11480403-11480425 TGACCTCTTTTTATAGAAGGAGG + Intronic
1066055377 10:31675931-31675953 TGACCTCTGTTTATACCATGAGG - Intergenic
1066333612 10:34452765-34452787 TGATCTCAGTTTCCAACAAGAGG + Intronic
1071491385 10:86138953-86138975 TGACGTCTCTTTACAAAAGGTGG - Exonic
1073640335 10:105246067-105246089 TGATCTCTATTCACAACAGATGG + Intronic
1075597435 10:123742323-123742345 TGTCCTCTGTATACACCAGAAGG + Intronic
1080471829 11:32553237-32553259 TGACCTCTGTTGACACCACATGG - Intergenic
1084797993 11:71521118-71521140 TGAACTCTGTTGAAAACAGCGGG - Intronic
1087264618 11:96046610-96046632 TGAACTCTGCTTACATCAGAAGG + Intronic
1089980024 11:122764599-122764621 TGACCTCTGTTGATGAAAGGTGG + Intronic
1090435029 11:126679470-126679492 TGACCTCTGTTTTATAAAGGAGG + Intronic
1093518393 12:20018614-20018636 TGACGTCTGTTTATAATAGGAGG + Intergenic
1093910132 12:24737812-24737834 AGATCTCTGTTTTCAACTGGGGG + Intergenic
1094736092 12:33235555-33235577 TGAGCTGTGTTTACTCCAGGGGG + Intergenic
1095647600 12:44566603-44566625 TGACCTATATTTACAGCTGGGGG + Intronic
1096536087 12:52275733-52275755 TGACCACTGGTGACAGCAGGTGG + Intronic
1098343410 12:69474450-69474472 TGGCATCTGTTTAAAACAGAAGG + Intronic
1098817543 12:75186506-75186528 TAACCTTTTTTTACAACAGAAGG - Intronic
1100832619 12:98530954-98530976 TGCACTCTTTTTACAACAGGTGG - Intronic
1103103671 12:118203763-118203785 CTACTTCTTTTTACAACAGGTGG - Intronic
1109861276 13:68201837-68201859 TGTTCTCTGTTTACAAAATGAGG + Intergenic
1116073226 14:40075326-40075348 TGTCCTTTGTTTAGAACAAGAGG + Intergenic
1116995501 14:51319499-51319521 TGACCTTTGTTAACAGGAGGTGG - Intergenic
1125328002 15:38556197-38556219 TGATCTCTGGTTAGAACAGAAGG + Intronic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1126686711 15:51254843-51254865 TAAACTCTGTTTACAACTTGCGG + Intronic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1130211720 15:81929799-81929821 TGACCCCTGTTAAAAACATGTGG - Intergenic
1134266864 16:12700393-12700415 AGACCTCTGTGTTCAACACGTGG - Intronic
1135962069 16:27003331-27003353 TGGCCTCTGTTGACACCTGGTGG - Intergenic
1141142569 16:81506368-81506390 TGACCTCTGTTCTTAAGAGGTGG + Intronic
1147158442 17:38557310-38557332 TCACCTCTCTTTTCAACAAGGGG - Intronic
1149849981 17:60028487-60028509 TGACCTCTGTCCACAGAAGGGGG - Intergenic
1149860186 17:60118037-60118059 TGACCTCTGTCCACAGAAGGGGG + Intergenic
1152875111 17:82781944-82781966 TGCCCTCTGCTGGCAACAGGTGG - Intronic
1155203972 18:23541459-23541481 TCACTTCTGTTTACAGCCGGGGG + Intronic
1156480648 18:37434469-37434491 TGGCCCCTGTCTAAAACAGGGGG + Intronic
1157145646 18:45159659-45159681 TGACCCCTGGTTCCCACAGGAGG + Intergenic
1160587848 18:79922722-79922744 TGACCTCTCCTTACAGCAGCAGG + Intronic
1167434256 19:49470031-49470053 TCACATCTGTTACCAACAGGAGG - Intronic
926844033 2:17113956-17113978 TGTCCATTGTTTACAACATGAGG - Intergenic
927641561 2:24848886-24848908 TGAGCTCTGCTTACTGCAGGTGG + Intronic
930200630 2:48549324-48549346 TGACCTTTACTTACAAAAGGAGG - Intronic
931696481 2:64874361-64874383 TGAGTCCTGTTTACAACAGTAGG - Intergenic
931927463 2:67088824-67088846 TGAACTCTGATTTCAACAGGAGG + Intergenic
932134896 2:69219738-69219760 TGTCCTCTGTTTTTAACAAGTGG + Intronic
932462113 2:71889188-71889210 TGGCCTCTGTTTACCACACTTGG - Intergenic
932775843 2:74527936-74527958 TGCACTCCGTGTACAACAGGTGG - Exonic
932795756 2:74694402-74694424 TGAACTCTTTTTACAAAATGAGG + Intergenic
938627175 2:133123622-133123644 TGCCCTCTGTATTCATCAGGAGG + Intronic
941082913 2:161082512-161082534 TGACCTTTTTTAAAAACAGGAGG + Intergenic
943320396 2:186436711-186436733 TGACCAATGTTTCCAACAGATGG + Intergenic
944279338 2:197877042-197877064 TGACCTCTGTTTACAAACAAGGG - Intronic
944847069 2:203679757-203679779 TGACCTGTGTTTACAAATGAAGG - Intergenic
945720942 2:213417829-213417851 TGATCTTTGTTTATAAAAGGAGG - Intronic
1170130446 20:13013400-13013422 TGACCTCTATTTCAATCAGGGGG - Intronic
1170210859 20:13845207-13845229 TGACCTCTGTTTAACACAGGAGG - Intergenic
1170773151 20:19351721-19351743 TCACCTCAGTTTCCACCAGGTGG + Intronic
1172055210 20:32150035-32150057 TGGCCTCTGACTACAAAAGGAGG - Intronic
1179579555 21:42332437-42332459 TGACATCTGCTAACAGCAGGTGG - Intergenic
1181991264 22:26838722-26838744 TTATCTCTGTTTAACACAGGAGG - Intergenic
950183217 3:10929321-10929343 TCACCTCTGTTAACATCACGAGG - Exonic
950978305 3:17274243-17274265 TGACCTCTGATTAAACAAGGAGG - Intronic
960327020 3:116309798-116309820 TGACATCTGGTTACAATAGCTGG + Intronic
964657083 3:159079222-159079244 TGAACTCTGTTTTAAACTGGGGG - Intronic
967223088 3:187265647-187265669 TGACCTCTGTTTCCTATAGAAGG - Intronic
969642216 4:8405672-8405694 AGACCTCTGTGTACAACTGGTGG - Intronic
972266327 4:37463548-37463570 TGAACTCATTTTACAGCAGGGGG - Intronic
973983191 4:56323985-56324007 TGACCTCTGCTTCCAACGGTGGG - Intronic
983877822 4:172897245-172897267 AGTCCTCTGATTGCAACAGGAGG + Intronic
986835187 5:11629366-11629388 TGACAGCTGTTTTCTACAGGTGG + Intronic
990023507 5:51158150-51158172 TGAGCTCTTCTTTCAACAGGAGG + Intergenic
993151900 5:84173004-84173026 GGACCTCTGTTTACTTCAGTAGG - Intronic
995439830 5:112178068-112178090 TGTACACTGTTTACAAGAGGTGG + Intronic
995687136 5:114783262-114783284 TCATCTCTGTTGACAACATGAGG + Intergenic
995817464 5:116188038-116188060 TTACGTCAGTTTACAACAGAAGG + Intronic
996623594 5:125541184-125541206 TGACCTCTGGTTCCCACAGGAGG + Intergenic
998154591 5:139777351-139777373 TGGCATCTGTTTGCAACAAGAGG - Intergenic
1001074547 5:168615702-168615724 TGACTTCTGTTTAGATCATGAGG + Intergenic
1004426571 6:15510895-15510917 TGGCCTCTGTTAACAGAAGGAGG + Intronic
1004687178 6:17957589-17957611 TGACTGATGTTTAAAACAGGGGG + Intronic
1010673507 6:78715026-78715048 TGACCTGTGTTAAGAAGAGGTGG - Intergenic
1013753444 6:113433924-113433946 TGAATTCTGTTTATAACAGAAGG - Intergenic
1015384629 6:132607784-132607806 TGACCTCTATTAACAACTAGCGG - Intergenic
1015498499 6:133906365-133906387 TGAGCTCTGTTTACAACTAGAGG + Intergenic
1018005809 6:159620540-159620562 TACCCTCTATTTACAGCAGGAGG + Intergenic
1018250533 6:161865466-161865488 TGGCATCTTTTTACAACAGAAGG + Intronic
1018542127 6:164893440-164893462 TTGCCTGTGTTTACAGCAGGTGG - Intergenic
1018779662 6:167051234-167051256 TGACCTCTGTAGAAAATAGGTGG + Exonic
1019077674 6:169402575-169402597 TTACCATTGTTTAAAACAGGAGG + Intergenic
1024173989 7:46819475-46819497 TGACCTCTGTTGACACCAGTGGG - Intergenic
1024696157 7:51858685-51858707 TGTCCTCTGCTGATAACAGGTGG - Intergenic
1028864774 7:95695728-95695750 AAACCTCTGTTTCCAACAGATGG + Intergenic
1028960465 7:96743458-96743480 TGACCCCTGGTTCCCACAGGAGG - Intergenic
1031247189 7:119329296-119329318 TAAGCTCTGTTAACAACAGTTGG + Intergenic
1036165577 8:6429669-6429691 TGACCTCTGGTTAAATCTGGTGG - Intronic
1037483791 8:19328814-19328836 TTACCTCTGTTTACTATAGAAGG + Intronic
1037886040 8:22597007-22597029 TCACCTCTGGTCACAACTGGAGG + Intronic
1040996351 8:53406764-53406786 TGAGCTCTGTTTTCATCAGATGG + Intergenic
1044455480 8:92388004-92388026 AGACCTCAGTCTACAACAAGTGG - Intergenic
1045822899 8:106362052-106362074 TGACCTCTGTGTTTAGCAGGTGG - Intronic
1047923189 8:129656241-129656263 TCAGCTCTGTTTAATACAGGAGG - Intergenic
1048303987 8:133270870-133270892 TGACCTCAGCTTACAACTGATGG - Intronic
1048571315 8:135659433-135659455 TGGCCTCTGTTGACAAGGGGAGG + Intergenic
1048879313 8:138859713-138859735 TGACCTCAGTCTACAATGGGAGG - Intronic
1051467716 9:17399636-17399658 TATCATCTGTTTACAAAAGGTGG - Intronic
1054942851 9:70762863-70762885 TTGCCTCTGTTTACACCAAGTGG + Intronic
1058950698 9:109901297-109901319 TCTCAGCTGTTTACAACAGGTGG - Intronic
1059914514 9:119084348-119084370 TGACCTCTGTTGACATCAGATGG - Intergenic
1062650783 9:137576076-137576098 TGACCTCAGATTCCACCAGGCGG + Exonic
1186438107 X:9560826-9560848 TGTCATCTGTCGACAACAGGAGG - Intronic
1191191804 X:57675831-57675853 TGACATCTGGTAACAACAGAGGG - Intergenic
1199054343 X:143274970-143274992 AGACCTCTGTTTCCAACTGCTGG - Intergenic
1199161016 X:144611837-144611859 TGTCCTCTGTTGCCAACAGGAGG - Intergenic
1200457858 Y:3414729-3414751 TGAGCTCTGGTAACAAGAGGAGG - Intergenic
1200754469 Y:6977300-6977322 TGTCATCTGTCAACAACAGGAGG - Intronic