ID: 1127597164

View in Genome Browser
Species Human (GRCh38)
Location 15:60497206-60497228
Sequence CAAGAAGTCAAGACAGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 698
Summary {0: 1, 1: 0, 2: 3, 3: 68, 4: 626}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127597158_1127597164 21 Left 1127597158 15:60497162-60497184 CCGACTTTAGTACCCTCCTCCTG 0: 1
1: 0
2: 1
3: 5
4: 128
Right 1127597164 15:60497206-60497228 CAAGAAGTCAAGACAGAAAAAGG 0: 1
1: 0
2: 3
3: 68
4: 626
1127597160_1127597164 8 Left 1127597160 15:60497175-60497197 CCTCCTCCTGTTGTAAACAGAGG 0: 1
1: 0
2: 0
3: 12
4: 141
Right 1127597164 15:60497206-60497228 CAAGAAGTCAAGACAGAAAAAGG 0: 1
1: 0
2: 3
3: 68
4: 626
1127597157_1127597164 24 Left 1127597157 15:60497159-60497181 CCTCCGACTTTAGTACCCTCCTC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1127597164 15:60497206-60497228 CAAGAAGTCAAGACAGAAAAAGG 0: 1
1: 0
2: 3
3: 68
4: 626
1127597159_1127597164 9 Left 1127597159 15:60497174-60497196 CCCTCCTCCTGTTGTAAACAGAG 0: 1
1: 0
2: 2
3: 10
4: 193
Right 1127597164 15:60497206-60497228 CAAGAAGTCAAGACAGAAAAAGG 0: 1
1: 0
2: 3
3: 68
4: 626
1127597163_1127597164 2 Left 1127597163 15:60497181-60497203 CCTGTTGTAAACAGAGGTCAATG 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1127597164 15:60497206-60497228 CAAGAAGTCAAGACAGAAAAAGG 0: 1
1: 0
2: 3
3: 68
4: 626
1127597162_1127597164 5 Left 1127597162 15:60497178-60497200 CCTCCTGTTGTAAACAGAGGTCA 0: 1
1: 0
2: 1
3: 12
4: 110
Right 1127597164 15:60497206-60497228 CAAGAAGTCAAGACAGAAAAAGG 0: 1
1: 0
2: 3
3: 68
4: 626

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127597164 Original CRISPR CAAGAAGTCAAGACAGAAAA AGG Intronic
901785242 1:11620305-11620327 CTGGAAGTCAAGACAGAAGAAGG + Intergenic
902043043 1:13506217-13506239 AAAGAAGTCAAGGCAGGGAATGG + Intronic
903873034 1:26450762-26450784 CAGGAAGATGAGACAGAAAAGGG + Intronic
904230282 1:29064504-29064526 CAACAAGACAAGACAGCCAATGG + Intronic
904717155 1:32477087-32477109 CAGGACTTCAAGACAGAGAAAGG - Intronic
905008374 1:34729584-34729606 CAAGCAGACAAGAAAGAAAGAGG + Intronic
905077493 1:35286040-35286062 CCAGAAGTTAAGCAAGAAAAAGG + Intronic
905159908 1:36023135-36023157 TCAGAAGTCATGACAGAAACTGG - Intronic
905665054 1:39758658-39758680 CAAAAAGTGCAGATAGAAAATGG + Exonic
905831541 1:41073021-41073043 CAAGAAGGCTGGAAAGAAAAAGG + Intronic
905949139 1:41931935-41931957 CAATAAGGCAAGAAAAAAAAAGG - Intronic
906100456 1:43257108-43257130 CAAGCACTGAAGACAGAACATGG - Intronic
906451440 1:45951762-45951784 CAAGAGTGCAAGACAGAAATGGG + Intronic
906832912 1:49052389-49052411 CAAGAAGAGAAGACTGAACAAGG + Intronic
907157108 1:52344647-52344669 CAAGAAGACATGACAGGAACAGG - Intronic
907233424 1:53022341-53022363 CAAGAAGTAATGACAGAATGTGG - Intronic
907771481 1:57469384-57469406 CAACAAGATCAGACAGAAAAAGG + Intronic
907904688 1:58773562-58773584 CAGGAAGTGAAGTCAGAAAGAGG - Intergenic
908603102 1:65762739-65762761 GGAAAACTCAAGACAGAAAACGG + Intergenic
908610228 1:65849787-65849809 CAAAAAGACAATAGAGAAAAGGG - Intronic
908889362 1:68826083-68826105 GAAGCAGACAAGAGAGAAAATGG + Intergenic
909096693 1:71296637-71296659 CAAGAGGCCAAGAGAGAAAGAGG - Intergenic
909509907 1:76440742-76440764 AAAGAAGGCAAGATAAAAAACGG + Intronic
909582150 1:77248657-77248679 AAAGGAGGCAAGAGAGAAAAAGG + Intergenic
909582204 1:77249617-77249639 CAAGAAGTCAAGTAACAAAATGG + Intergenic
909684706 1:78334651-78334673 AAAGAAATGAAGAAAGAAAAAGG - Intronic
909769554 1:79403520-79403542 TAAAAACTCAAGACAGAAATTGG - Intergenic
910240890 1:85085142-85085164 CCAGAAGTCAGGACAGAAACAGG + Intronic
910371541 1:86521785-86521807 CAAAAAGGAAATACAGAAAATGG - Intergenic
910437493 1:87220069-87220091 CTAGAAGTGAAGACAGGAAGTGG + Intergenic
912239957 1:107895997-107896019 CAAGAAGTCCAAGCTGAAAATGG - Intronic
913537128 1:119783819-119783841 AAAGAAGGAAAGAAAGAAAAAGG - Intergenic
914932263 1:151945725-151945747 CAAGAAGTAAAGAGAAAAAGGGG - Intergenic
915255318 1:154624049-154624071 AATGAAGTCAATAAAGAAAACGG + Intronic
916244379 1:162672369-162672391 CAAAAAGTCAAGGCACAAGAGGG - Intronic
916484516 1:165246721-165246743 AAAGAAGTCAAGACTGAATGAGG - Intronic
916690392 1:167184836-167184858 CAAGAAGTTGAAAAAGAAAAGGG - Intergenic
916860093 1:168794344-168794366 GAAGAAGTGAAGAGAGAAAGTGG + Intergenic
916994043 1:170276543-170276565 CACTAAGGCAAGAGAGAAAAAGG - Intergenic
917144674 1:171876327-171876349 TAAAAAGTCAAAACAAAAAAAGG + Intronic
919438093 1:197589012-197589034 CAGCAACTTAAGACAGAAAAAGG + Intronic
920042908 1:203115043-203115065 AAAAAAGTGAAGAGAGAAAAAGG - Intronic
920112708 1:203598468-203598490 CAAGGAGCCCAGGCAGAAAAGGG - Intergenic
920273741 1:204788014-204788036 GAAGATGTCCAGACAGTAAAAGG - Intergenic
920517930 1:206600262-206600284 AAAGAAGTCAAGCTACAAAAAGG - Exonic
920610317 1:207429705-207429727 CAATAAGAGAAGAGAGAAAATGG + Intergenic
920930662 1:210384719-210384741 CATGGAGGCAAGAAAGAAAATGG + Intronic
921023934 1:211260047-211260069 AAAGAAGAAAAGAAAGAAAAAGG - Intronic
921352482 1:214250290-214250312 CCAGAAGTGAAAACAGAAAGAGG + Intergenic
921671362 1:217927379-217927401 CCAGAACTCTAGACAGAAATTGG - Intergenic
921682194 1:218047285-218047307 CTAGAAGCCAAGGCAAAAAAGGG - Intergenic
922008820 1:221560009-221560031 AAAGAACTCAAGGGAGAAAAAGG + Intergenic
922105306 1:222508436-222508458 CAAGAAGGCAAGAGGGCAAAAGG + Intergenic
922265639 1:223981014-223981036 CAAGAAGGCAAGAGGGCAAAAGG + Intergenic
923242177 1:232096863-232096885 CAAGAAGTCAAGACCACAAGAGG - Intergenic
923986177 1:239385601-239385623 AAAGAAGAAAAGAAAGAAAAAGG - Intergenic
924181524 1:241443664-241443686 CATGAAGTAAAGAGAGAAAGTGG + Intergenic
1062976247 10:1685665-1685687 CACAAAGTCAACAGAGAAAAGGG + Intronic
1063213452 10:3902569-3902591 CAAGAGGTGTAAACAGAAAAGGG - Intergenic
1064466645 10:15589500-15589522 ATAGAAGTCAAGAGAGAAATGGG - Intronic
1064857720 10:19789648-19789670 CAAGAAGTGAAGACACCAGAAGG + Intronic
1064986341 10:21214398-21214420 CAAGAAGAGAAGAAAGGAAAAGG + Intergenic
1065282836 10:24157430-24157452 CAAGAAGACAAGCCAGAGACTGG - Intronic
1065842675 10:29716919-29716941 CAAGAAATGAAGACAAAAATAGG + Intronic
1066414991 10:35213620-35213642 AAAGAAGTCAAGGAAGAAAAAGG + Intergenic
1066604865 10:37154464-37154486 TAGAAGGTCAAGACAGAAAAGGG + Intronic
1069006416 10:63322469-63322491 CAAGAAATTAAGATAGAATAGGG + Intronic
1069536933 10:69260699-69260721 CAAGAGAGCAAGAGAGAAAAGGG - Intronic
1070223508 10:74475796-74475818 AAAGAAGAGAAGAGAGAAAAAGG + Intronic
1070253801 10:74796815-74796837 AAAAAAGACAAGACAGAGAAGGG - Intergenic
1070514887 10:77195566-77195588 CAAGAAGGAAAGAAAAAAAAAGG - Intronic
1071495024 10:86162276-86162298 CCAGAAGCAAAGACAGGAAAAGG + Intronic
1071967660 10:90868638-90868660 GAAAAAGACAAGACAGAATAGGG - Intergenic
1072176083 10:92923246-92923268 CAAGAAGTGAAGAAAGTGAAAGG - Intronic
1072444086 10:95482912-95482934 CAAGAAGCCAAAAATGAAAAAGG + Intronic
1072604132 10:96964767-96964789 AACTAAGTCAAGACAGAAGACGG - Intronic
1072746929 10:97946816-97946838 AAAGAAGTAAACACAGAAATTGG + Intronic
1072907654 10:99469357-99469379 TAAGTACTAAAGACAGAAAAGGG + Intergenic
1073368471 10:102965233-102965255 AAACAAGTCAAGACAGAGCAGGG - Intronic
1074327162 10:112462379-112462401 AAAGTAGGTAAGACAGAAAAAGG - Intronic
1074403228 10:113159378-113159400 AAAGAAATAAAGAAAGAAAAGGG - Intronic
1076303894 10:129449754-129449776 CATGAAGACAAGTAAGAAAATGG + Intergenic
1076440497 10:130478024-130478046 CTAGAAATCAAGACAGACATTGG - Intergenic
1076446989 10:130522444-130522466 CAAGAATTCAGGACTGCAAAGGG + Intergenic
1077138590 11:1013638-1013660 CGAGAAGTCAAGACAGAGCAGGG + Intronic
1078295508 11:10065180-10065202 GAAGAAGTCAAAAGAAAAAATGG + Intronic
1078822538 11:14896145-14896167 CAAGATATCATGACAGAAGATGG - Intergenic
1078867750 11:15313527-15313549 AGAGAAGTCAAAACAGAGAAGGG - Intergenic
1078949943 11:16119034-16119056 CAAGAAGTGCAGTCAGAAACAGG + Intronic
1079048694 11:17133182-17133204 GTAGAAGACAATACAGAAAACGG - Intronic
1079210424 11:18456055-18456077 CAAGAGGTGAAGAAAGAGAATGG - Exonic
1079528663 11:21421690-21421712 CAAGCAGACGAGAGAGAAAAAGG + Intronic
1079697441 11:23499482-23499504 CAGGAAATCAAGACATGAAATGG - Intergenic
1079968204 11:27004430-27004452 CAAGTAGTCAAGATAGGATATGG + Intergenic
1080298846 11:30761180-30761202 AAAGAAGTTAAGAAAGAGAAGGG - Intergenic
1080787236 11:35486771-35486793 CAAGAAGTCAATACAGCAAATGG - Intronic
1081885962 11:46496667-46496689 CAAGAAGACAACAGAGAAAAAGG + Intronic
1083348141 11:62008371-62008393 AAAGAAGTGAAAACAGAAACTGG + Intergenic
1083447940 11:62722659-62722681 CGAGGACTCAAGGCAGAAAATGG - Exonic
1083514124 11:63240743-63240765 CAAGATGTGAAGATGGAAAATGG - Intronic
1084110445 11:67010800-67010822 CTAGGAGTCAAGACAAAAAAAGG - Intronic
1084337478 11:68468450-68468472 CAAGAAGTCCACAGTGAAAAGGG - Intronic
1084538115 11:69769792-69769814 CAAGAAATAAGGACAGAAAAGGG + Intergenic
1084854705 11:71975426-71975448 CAATAGGTCCAGATAGAAAAAGG - Intronic
1085165646 11:74397680-74397702 AAGGAAGTCAAGGGAGAAAAAGG + Intronic
1085211473 11:74783675-74783697 CAAGATGTCAAGTCAGAACCAGG - Intronic
1085450283 11:76627813-76627835 CAACAGGAAAAGACAGAAAAGGG + Intergenic
1085542399 11:77284553-77284575 GAAGACATCAAGCCAGAAAAGGG + Intronic
1085738721 11:79061629-79061651 CATAAAGTCATGACAGAAAGAGG - Intronic
1086133979 11:83428602-83428624 CAAGAAGTAAGCAGAGAAAAAGG - Intergenic
1086374013 11:86182368-86182390 TAAGAAGTATAGACAGAACACGG - Intergenic
1086491924 11:87364239-87364261 CAAGAAGTCAGGAGAGAGGAAGG + Intergenic
1086543742 11:87943909-87943931 CAGGAAATCAAAACAGAAAATGG - Intergenic
1086553038 11:88074978-88075000 AAAGGAGTCAATTCAGAAAAAGG + Intergenic
1087883592 11:103449188-103449210 GAAGGAAACAAGACAGAAAAAGG + Intronic
1088381660 11:109200008-109200030 CAAGAAGACCACACAGACAAGGG - Intergenic
1088513944 11:110607664-110607686 CCAGAGATTAAGACAGAAAAAGG + Intronic
1088620396 11:111675927-111675949 AAAGAAGGCAAGAAAGACAATGG - Intronic
1088700393 11:112406481-112406503 CAAGAAGTGAAGGGAGAAAATGG + Intergenic
1088766374 11:112983607-112983629 CAAGATTTCCAGACTGAAAATGG + Intronic
1088823611 11:113475768-113475790 CAAGACCTGAAGTCAGAAAACGG - Intergenic
1089025379 11:115264264-115264286 AAACAAGTCAAGACTGACAAAGG - Intronic
1089047972 11:115520198-115520220 CAGGAACTCAAGACACAGAAAGG - Intergenic
1089392721 11:118113079-118113101 CAAGAAGTCAAATTCGAAAAAGG - Intronic
1089865161 11:121625295-121625317 CTAGAACTGAAGACAGAAACGGG - Intronic
1089891163 11:121882888-121882910 CAAGAGATCAAGTCAGACAAAGG - Intergenic
1090141507 11:124269318-124269340 CAAGAAGACAAGATATAACATGG - Intergenic
1092093465 12:5822905-5822927 CAAGAGGGCAAGAGAGAAAGAGG + Intronic
1092448539 12:8581047-8581069 AAAGAAGGAAAGAAAGAAAAGGG + Intergenic
1092940681 12:13404468-13404490 CAGGAAGGCAGGACAGAAAAGGG - Intergenic
1093471299 12:19504785-19504807 AAAAAAGGCAAGATAGAAAATGG + Intronic
1093520183 12:20041116-20041138 CAGGAAGTCAGGACGGAAAGGGG - Intergenic
1093553175 12:20439365-20439387 CATGTAGTCAACATAGAAAAGGG + Intronic
1093948587 12:25137980-25138002 CAGGTCATCAAGACAGAAAATGG + Intronic
1095144480 12:38709259-38709281 CAAAAGGATAAGACAGAAAAGGG - Intronic
1095913137 12:47448851-47448873 CAAAAAACCAAGAAAGAAAATGG - Intergenic
1096201660 12:49687929-49687951 CAAGTATTAAAGACAGAAAATGG + Intronic
1096803832 12:54128203-54128225 CAAGATGTGAGGAAAGAAAAGGG - Intergenic
1097229029 12:57497872-57497894 CAAGCAGTCATGACAGTAAAAGG + Intronic
1097529832 12:60784569-60784591 CAAAAATTTAAGACAAAAAAAGG + Intergenic
1097561792 12:61216253-61216275 CAAAAACTCAGCACAGAAAAAGG - Intergenic
1097651004 12:62297130-62297152 CAATAAGGCATGACAGAAACTGG - Intronic
1098074504 12:66714777-66714799 CAGGTAGTCAAGCCAGAAAATGG + Intronic
1098117800 12:67198963-67198985 CAAGAGGTCAAGCAAGATAAAGG - Intergenic
1098219167 12:68250472-68250494 TAAAAAGTCAAGAGGGAAAAAGG + Intronic
1098384689 12:69906551-69906573 AAAAAATTCAAGCCAGAAAAGGG + Intronic
1098474483 12:70884379-70884401 AAAGAAGGAAAGAAAGAAAAGGG + Intronic
1098840931 12:75477161-75477183 CTTGAAGTCAAGGCAGAAAACGG + Intergenic
1099016555 12:77350171-77350193 CAGCAAGCCAAGACAGAATAAGG - Intergenic
1099313124 12:81052791-81052813 AAAGAAGTAAAGAAAGAAAGTGG + Intronic
1099320141 12:81136618-81136640 CAAGCAGTAGAGACAGGAAATGG + Intronic
1099427663 12:82544611-82544633 AAAGAAGGAAATACAGAAAAAGG - Intergenic
1099455510 12:82858111-82858133 AGAAAAGTCAAAACAGAAAATGG + Intronic
1100366474 12:93925746-93925768 CAAAAAGGGAAAACAGAAAAGGG - Intergenic
1100741702 12:97600931-97600953 CAAGCACTAAAGACAGGAAATGG + Intergenic
1100780101 12:98015405-98015427 CAAGAGGGGAAGAAAGAAAAAGG + Intergenic
1101615365 12:106331141-106331163 CCAGAAGTCAAGATGGGAAAGGG - Intronic
1101745198 12:107535750-107535772 AAAGAATTGAACACAGAAAATGG + Intronic
1101842404 12:108337635-108337657 GAACAAGTCAAGCCAGAGAAAGG + Intronic
1102676482 12:114662967-114662989 AAAGAGGTCAAAACAGAAAGAGG - Intergenic
1103052535 12:117792679-117792701 CCAGCAGTCAAGACAGGGAAAGG - Intronic
1103218440 12:119222633-119222655 CAAAAAGTTAAGATAAAAAAAGG + Intergenic
1105051223 12:133052883-133052905 CAATATGTGAAGTCAGAAAATGG + Intronic
1105757132 13:23477197-23477219 CAAGTAGACAAGAAAAAAAAAGG - Intergenic
1106125145 13:26895251-26895273 CAAGGAGTCAAGACATAGACAGG + Intergenic
1106235586 13:27857755-27857777 CAAGTAATCAGGCCAGAAAATGG + Intergenic
1106376442 13:29193191-29193213 CAAGAAGTATAGTCAGAAAGTGG - Intronic
1106591090 13:31099205-31099227 CAAAAGGAAAAGACAGAAAAAGG - Intergenic
1106748525 13:32731086-32731108 AAAACAGGCAAGACAGAAAAAGG - Intronic
1106885009 13:34175648-34175670 CAAGAAGCCAAAACAGAAGCTGG - Intergenic
1107488565 13:40857226-40857248 AAAGAAGTTAAAACAGCAAATGG + Intergenic
1108279623 13:48848504-48848526 CATGATGTCAAGTCGGAAAATGG + Intergenic
1109598481 13:64591029-64591051 CAGGAAGTCAAGAGACAAAATGG + Intergenic
1109628151 13:65005857-65005879 CAAGAATTCAGAACAGGAAATGG - Intergenic
1109637129 13:65135709-65135731 TAATGAGGCAAGACAGAAAATGG - Intergenic
1109786036 13:67176174-67176196 CAAGAAAGAAAGACAGAAGATGG + Intronic
1110639777 13:77809387-77809409 ACAGAAGACAAGACAGGAAAGGG - Intergenic
1110710898 13:78649711-78649733 TAAGAAGTCAAGAGGGGAAAGGG + Intronic
1110769608 13:79325402-79325424 CAAGACGTAAAGGTAGAAAACGG + Intronic
1111155121 13:84311118-84311140 CAAGAAAACAAAACAAAAAATGG - Intergenic
1111323218 13:86657717-86657739 CAACCAGTAAAGACAGAAAAGGG - Intergenic
1111904707 13:94241637-94241659 CCAGAAGCTAAAACAGAAAAAGG + Intronic
1111937956 13:94576613-94576635 CAAGAAGACAAGACACAGAGAGG - Intronic
1112048302 13:95619889-95619911 CAAGAACACAAGAAAGAGAAGGG - Exonic
1112797625 13:103073395-103073417 AAACAAGGCAAGAAAGAAAAAGG - Intergenic
1112938693 13:104833259-104833281 CAAGAAGAGAAGTGAGAAAATGG + Intergenic
1113133825 13:107067290-107067312 CAGGAAGGCAAGACAGAGAAGGG + Intergenic
1113165578 13:107437544-107437566 AAAGATGTCTAGACATAAAAAGG + Intronic
1114504356 14:23197760-23197782 AAAGAAGACAAGACATAGAAGGG - Intronic
1114706739 14:24735140-24735162 CAAGGACTCAAGAAAAAAAAAGG + Intergenic
1114885786 14:26849296-26849318 AAAGAAGTTAAGAAAGCAAAAGG + Intergenic
1115781561 14:36775233-36775255 CAGGAAATCAATATAGAAAAGGG + Intronic
1115854610 14:37617221-37617243 CAAGAAGTGAAGATAGAAAGTGG + Intronic
1116694362 14:48153227-48153249 CAAGAAATCAAGACATAATAAGG - Intergenic
1116739912 14:48741316-48741338 ATAGAAGCCAAGAAAGAAAATGG + Intergenic
1117028259 14:51643590-51643612 AAAGAAGTCAAGCCAAAAAACGG + Intronic
1117496363 14:56309408-56309430 CAAGAGGTTAAGAGAGCAAAAGG - Intergenic
1118304570 14:64645059-64645081 CAAGAAATAAACACAAAAAATGG + Intergenic
1118859678 14:69652900-69652922 CCAGAAGCCAAGACAGCAGAGGG - Intronic
1119466974 14:74865951-74865973 CAAGATGTCAAGAAAGCAATTGG + Intronic
1119506569 14:75177967-75177989 AAAGAAGGAAAGAAAGAAAATGG + Intergenic
1119575707 14:75719839-75719861 AGAGAAGTCAAGAAGGAAAAAGG - Intronic
1119902148 14:78270320-78270342 CAGGAAATCAAAACAGAAACTGG - Intronic
1120495083 14:85224906-85224928 CAATAAGTCAGGAAACAAAAAGG + Intergenic
1121283222 14:92714483-92714505 ATAGAAGTAAAAACAGAAAAAGG - Intronic
1122470236 14:101961381-101961403 CAAGGAATCAAGACAGAAAGGGG + Intergenic
1122898253 14:104771168-104771190 TAAGAAAACAAGAAAGAAAAAGG - Intronic
1123183834 14:106495239-106495261 AAACAAGTTAACACAGAAAAAGG + Intergenic
1202840354 14_GL000009v2_random:115401-115423 TTAGAAGTTATGACAGAAAAGGG + Intergenic
1202909737 14_GL000194v1_random:105599-105621 TTAGAAGTTATGACAGAAAAGGG + Intergenic
1123816022 15:23980030-23980052 CAAGTAGACAACACAGAAGATGG + Intergenic
1123986463 15:25650607-25650629 CAAGCAGTGAAGCCAGAAAAAGG - Intergenic
1124080814 15:26493529-26493551 CAAGAAGACAAGACAACTAAAGG + Intergenic
1124882163 15:33652695-33652717 CTAGGAGCCAAGACAGGAAAAGG - Intronic
1125142090 15:36420182-36420204 CATTCAGTCAAGACAGAAGAAGG - Intergenic
1125248969 15:37677586-37677608 CCACAAGCCAAGACACAAAATGG + Intergenic
1125848274 15:42879326-42879348 GAAAAAGGCAAGACAGTAAAGGG + Intronic
1126062574 15:44797459-44797481 TTAAAAGACAAGACAGAAAAAGG - Intergenic
1126378765 15:48024061-48024083 CAGGATGCCAAGACATAAAATGG + Intergenic
1126428447 15:48555158-48555180 CAAGAAGAAAACACAGGAAAGGG - Intronic
1127464845 15:59233987-59234009 AAAGAAGTAAAAAGAGAAAAAGG - Intronic
1127597164 15:60497206-60497228 CAAGAAGTCAAGACAGAAAAAGG + Intronic
1127791461 15:62402349-62402371 CAATAAGACAAAAGAGAAAAGGG - Intronic
1127823515 15:62682612-62682634 AAATAAGTTAATACAGAAAAAGG + Intronic
1129047293 15:72746968-72746990 CAATAAGGCAAGAAATAAAAAGG + Intergenic
1130003800 15:80073703-80073725 CAAGAATATAAGACAGAGAAGGG - Intronic
1131232124 15:90666951-90666973 CAAGATGGAAAGACAGAAACAGG - Intergenic
1131242332 15:90757635-90757657 CAGGAAGTGAGGACAGAACAGGG - Intronic
1131746589 15:95455328-95455350 CAACAAATCAAAAGAGAAAATGG - Intergenic
1132124583 15:99211634-99211656 CAAGAAAGCAAGAAAGAAAAGGG - Intronic
1132923139 16:2410507-2410529 CAAGAGGCAAAGACAGAAACAGG - Intergenic
1133270646 16:4609534-4609556 CAAGGGGTGCAGACAGAAAAGGG + Exonic
1133949372 16:10377628-10377650 CAAGATGTTAAGAGAAAAAACGG - Intronic
1134654074 16:15933829-15933851 CAAGAAGTAAAAAAAGAAAAGGG - Intergenic
1135278185 16:21131341-21131363 CAAGAAAGCAAGAAAGAAACAGG + Intronic
1135657662 16:24265329-24265351 AAAGAAGGAAAGAAAGAAAAAGG + Intronic
1136531140 16:30870204-30870226 CTAGAAGCCTAGGCAGAAAATGG + Intronic
1137971817 16:52993281-52993303 CAGGAAGTGGTGACAGAAAAAGG + Intergenic
1138499884 16:57434213-57434235 CTAGAATTCAAGACATCAAAAGG + Intronic
1138596843 16:58033601-58033623 CTGGAAGTCAAGAAAGAAATTGG + Intronic
1138808811 16:60124367-60124389 TAAGAAGACAAGAAAGATAACGG + Intergenic
1139907664 16:70377880-70377902 CAGGAAATCAAGGAAGAAAAAGG + Exonic
1140554608 16:75907507-75907529 CAACAAAACAAGACAGAAAGGGG + Intergenic
1140774870 16:78240330-78240352 CCAAAAGACAAAACAGAAAAAGG + Intronic
1142782685 17:2193440-2193462 CACCAAGACAAGACAGAAGAAGG + Intronic
1143092706 17:4458469-4458491 AAAGAAGAAAAGAAAGAAAATGG - Intronic
1143590095 17:7880024-7880046 GAAGAAGGGAAGACAGATAAAGG + Intronic
1143692056 17:8576868-8576890 GAAGAAGTGATGACAGAAAAAGG - Intronic
1144210520 17:13011116-13011138 CAAGACCTCAGGACAGAAAGAGG + Intronic
1144847385 17:18226977-18226999 CAAGAACTCAAGAAAGATATTGG - Intronic
1146083850 17:29808928-29808950 CAAGAGATCAAAGCAGAAAAAGG - Intronic
1147020030 17:37523864-37523886 AAAGAAGTGAAGACAGAAGAGGG + Intronic
1147770237 17:42862898-42862920 CTTGAAGTCAAGACAGACAATGG - Intergenic
1148025320 17:44583561-44583583 CAACAAGGCAAGACAGTACAGGG - Intergenic
1148226857 17:45905029-45905051 GGAAAAGACAAGACAGAAAACGG - Intronic
1148389085 17:47257346-47257368 GAAGAAGCCAAGAAGGAAAAAGG + Intronic
1148551855 17:48555198-48555220 CAAGAAAGGAAGACAGAGAAAGG + Intronic
1149004603 17:51792213-51792235 CAAGCAATGAAGACAGCAAATGG + Intronic
1151900196 17:77007372-77007394 CTAGATGTCAGGACAGAAAGAGG - Intergenic
1152130115 17:78471522-78471544 AAAAAAGTAAAGTCAGAAAAAGG - Intronic
1154062066 18:11071581-11071603 CAAGAAGTCCAGCCAGAGAAGGG + Intronic
1154957938 18:21277346-21277368 CAAGAAGACAAGGATGAAAAGGG - Intronic
1155565538 18:27129978-27130000 CAAGAAGGCAGGAAAGAAGAAGG + Intronic
1155645408 18:28071387-28071409 CAGGAAGTCAAGCAGGAAAAGGG + Intronic
1156948225 18:42861440-42861462 CTAAAAGGCAAGAAAGAAAAGGG - Intronic
1157185303 18:45535357-45535379 CATAAACTCCAGACAGAAAAAGG - Intronic
1157855488 18:51100980-51101002 CAAGAAGATAAAACAGAAGAAGG + Intergenic
1158085545 18:53647040-53647062 AAAGAAATGAAGAAAGAAAAAGG + Intergenic
1158160964 18:54483078-54483100 CAAGTAGCCAAGAAAGATAAAGG - Intergenic
1158692379 18:59672175-59672197 CCAGAAGCCAAGACAGAAAGAGG + Intronic
1160016987 18:75152023-75152045 CAAGAAGCTAAGAAAGTAAATGG - Intergenic
1160083081 18:75748767-75748789 AAATAAGTCAAGATAGAAGATGG - Intergenic
1160144716 18:76354154-76354176 CAAGAAGTTAATACTTAAAAGGG - Intergenic
1160206220 18:76835825-76835847 AAAGAAGGCAAGAAAGAAAGGGG - Intronic
1161289789 19:3487266-3487288 CAAGGAGGCAGGAGAGAAAAGGG + Intergenic
1162190937 19:8946267-8946289 CCAGAAGTCAAATGAGAAAATGG + Exonic
1164187713 19:22885803-22885825 TAAGAAGACAGGACAGAAACTGG - Intergenic
1164914038 19:32035723-32035745 CAAGAAGCCAAGGGAGAAAGAGG + Intergenic
1165572523 19:36787423-36787445 CAAAAAGAAAAGAAAGAAAATGG - Intergenic
1166500584 19:43338082-43338104 CAGGAAGGGCAGACAGAAAAGGG - Intergenic
1166625901 19:44355960-44355982 CAAGAAGTCAAGGCTAAAGAAGG + Intronic
1166700811 19:44880459-44880481 AAAAAAGGCAAGACAGGAAAAGG - Intronic
1166722977 19:45008269-45008291 GAAGAAGCCAAGGCACAAAAAGG + Intronic
1168227288 19:55004878-55004900 CAGGAAGTCAAGTCAGAAGACGG + Intergenic
1168227454 19:55006213-55006235 CAAGAAGTGAAATCAGAAGACGG + Intergenic
926006491 2:9377111-9377133 CATGAATTAAAGACAGAAAAAGG + Intronic
926341928 2:11910735-11910757 AAAGAAGTGGAGAGAGAAAATGG + Intergenic
926586851 2:14695932-14695954 CTAGGAGGCAAGTCAGAAAAAGG + Intergenic
928744367 2:34394366-34394388 AAAGAAATTAGGACAGAAAATGG + Intergenic
928773074 2:34725257-34725279 CATGAATTAAAGACAGAAATAGG + Intergenic
928836841 2:35557884-35557906 CAAGATGTAAAAACAAAAAAAGG - Intergenic
928940168 2:36719152-36719174 CAAGAAATCAAAGTAGAAAAAGG + Intronic
929020151 2:37545426-37545448 CAAGAAGTAAAGGCAGTACAAGG + Intergenic
929241491 2:39658211-39658233 CAAGAAGGGCAGAGAGAAAACGG - Intergenic
929318472 2:40510242-40510264 TAAGAAGTCATGAAATAAAAGGG + Intronic
930578451 2:53181170-53181192 CAAGAATTCAGTAGAGAAAAAGG + Intergenic
930697344 2:54425478-54425500 TAAAAAGTCAAGGCAAAAAAAGG + Intergenic
930863594 2:56100949-56100971 ACAGAAGCCAAGACAGCAAAAGG + Intergenic
930968004 2:57355542-57355564 GAAGAAGGCAAGACAGTCAAAGG + Intergenic
931318897 2:61157364-61157386 CAAGAAGTCAGATCAGGAAATGG + Intronic
931838909 2:66128412-66128434 CATGAAGGAAAGAAAGAAAAAGG - Intergenic
932363359 2:71129165-71129187 CAAGAACTCAATACAGATAAAGG - Intronic
932591054 2:73067957-73067979 CAGTAAGTCAATACACAAAAAGG + Intronic
932954077 2:76331135-76331157 CCAGAAGACAAGAGAAAAAATGG + Intergenic
934996939 2:98972018-98972040 AAAGAGGTCAATACAGAAAAAGG - Intergenic
935298344 2:101670407-101670429 AAAGAAGGAAAGAAAGAAAATGG - Intergenic
935362126 2:102254530-102254552 CATGAAGTCAAGAATGAAGAGGG + Intergenic
935558598 2:104537962-104537984 CACCAAGGCAAGACTGAAAAGGG + Intergenic
935665906 2:105512041-105512063 AAAGAAGACAAGAAAGAAAAGGG - Intergenic
935706400 2:105861085-105861107 CAAGAACTCAATTTAGAAAATGG - Intronic
937062744 2:118992446-118992468 CAAGGAGTAAAGGGAGAAAAAGG + Exonic
937433533 2:121861113-121861135 CAGGAATTCAAGAGAGAAATAGG - Intergenic
937584704 2:123532101-123532123 CAAGAAGGCAAAAAAAAAAAAGG - Intergenic
937994925 2:127686073-127686095 CAAGCAGGCAAGAAGGAAAAAGG - Intergenic
938547544 2:132348188-132348210 CAAGAAGTCAAGGCTAAAGAAGG - Intergenic
938906641 2:135842986-135843008 CAAGAAGCCAATACAAAAAAAGG + Intronic
938990977 2:136629714-136629736 GGAGAAGTCAAGACACAAATAGG + Intergenic
939871893 2:147535061-147535083 GATGAAGTCAAGGCAGAAAGAGG - Intergenic
939980859 2:148779110-148779132 CAAGAAGACAGGACAGTAAATGG + Intronic
940075214 2:149733964-149733986 TGAGAAATGAAGACAGAAAAAGG + Intergenic
940207422 2:151218910-151218932 CTAGAAATCAAGAAACAAAATGG - Intergenic
940945901 2:159616794-159616816 AAAGAAGACAGGACAGAAAACGG + Intergenic
941588750 2:167391993-167392015 CAAGAAGTCAAGTCCGGTAAGGG - Intergenic
941929654 2:170927291-170927313 CAAGAAGGTAAGAAAGTAAATGG + Intergenic
941958880 2:171233813-171233835 GAAGAAATGAAGAAAGAAAAAGG - Intergenic
942118853 2:172756532-172756554 CAAGGAGTCTAGACACAAAAGGG - Intronic
942516593 2:176760376-176760398 CAAGAAGAGAAGCCAGAAACAGG + Intergenic
942604618 2:177677430-177677452 CAAGAAGTCCATGCAGAGAAGGG + Intronic
943024605 2:182612268-182612290 CAGGTATTCAAGACAAAAAAAGG + Intergenic
943373152 2:187041547-187041569 TCAGAAGTCATGACAGAAACTGG - Intergenic
943477044 2:188369657-188369679 TAAGAAACCGAGACAGAAAATGG - Intronic
944504218 2:200393021-200393043 GAAGAAGCCATGACATAAAAGGG - Intronic
944719124 2:202405297-202405319 GTAGAAGTCCAGACAGGAAAAGG + Intronic
945180027 2:207082366-207082388 AATGAAGTCAACAGAGAAAAAGG + Intronic
945190651 2:207184295-207184317 AAAAAACACAAGACAGAAAATGG + Intergenic
945502142 2:210589451-210589473 CTAAAAGGCAAGACTGAAAAAGG + Intronic
945514184 2:210742133-210742155 CAAAAAGTCAGAAAAGAAAATGG - Intergenic
946167729 2:217875706-217875728 TAAGAAGTCATCACAGAACAGGG + Intronic
946183609 2:217964313-217964335 CAAGAACTCAAGTCACAAAGAGG + Intronic
946256943 2:218449304-218449326 CAAAACCTCAAGAAAGAAAAAGG + Exonic
946981674 2:225223918-225223940 CAAGGCCTCAAGCCAGAAAATGG - Intergenic
947029900 2:225782458-225782480 CAGGAAGGGAAGACAGAGAAAGG - Intergenic
947174852 2:227355177-227355199 CAAGAAGTAAAGAATAAAAATGG + Intronic
947689815 2:232124635-232124657 GAAGAAGATGAGACAGAAAATGG + Intronic
948297461 2:236872981-236873003 CAGGAAGTCAAGTCATTAAAAGG + Intergenic
948401091 2:237686032-237686054 GAACAAGTCAAGACAGAGAAGGG - Intronic
948636293 2:239339987-239340009 CAAGACATCATGACAGAAAGAGG + Intronic
1171876410 20:30580943-30580965 CAAGAAGTCAAGGCTAAAGAAGG - Intergenic
1172211745 20:33204220-33204242 GAAGAAGACAGGATAGAAAATGG - Intergenic
1173206235 20:40996380-40996402 TAAGAAAGCAAGAAAGAAAAGGG + Intergenic
1173658817 20:44719091-44719113 CAACAAGTCAAGGATGAAAATGG - Intronic
1174082724 20:47982625-47982647 CTAAAAGTCAAAAAAGAAAATGG + Intergenic
1174520111 20:51122787-51122809 CAAGAAGACAATACAGGGAAGGG + Intergenic
1175120970 20:56716106-56716128 AAAGAAGGAAAGAAAGAAAAAGG + Intergenic
1175805397 20:61825646-61825668 CAAGATTACAAGGCAGAAAATGG + Intronic
1176629083 21:9120306-9120328 TTAGAAGTTATGACAGAAAACGG + Intergenic
1177047207 21:16185270-16185292 AAAGAAGAGAAGCCAGAAAAAGG + Intergenic
1177144871 21:17396685-17396707 CAAGAAGACTAGAAAGTAAAAGG + Intergenic
1177153765 21:17481269-17481291 CATGAAAACAAGACAGAAAATGG + Intergenic
1177454767 21:21322467-21322489 AAAGAAGTAAAGAGAAAAAAAGG + Intronic
1177555064 21:22678698-22678720 CAGAAATTCTAGACAGAAAAGGG + Intergenic
1177731430 21:25031769-25031791 CAAGAGGTCATGAAAGATAAAGG - Intergenic
1177863837 21:26488703-26488725 AAGGAAGGTAAGACAGAAAATGG - Intronic
1177936054 21:27347883-27347905 GAAGAAGAAAAGAAAGAAAAAGG + Intergenic
1178174337 21:30078844-30078866 AGAGAAGTAAAAACAGAAAAAGG - Intergenic
1178338477 21:31765293-31765315 CAAGAAGTCCAGAATGAAGAGGG - Intergenic
1178458532 21:32779155-32779177 CAAGAGAGCAAGACAGAAAGGGG - Intergenic
1179589430 21:42396597-42396619 CAAGAATGAAAGCCAGAAAATGG - Exonic
1180678566 22:17606460-17606482 CAAGAAGTTAAGACTGTAAGCGG + Intronic
1181781310 22:25195580-25195602 CAAGAAGCCAAAAGAGAAATAGG + Exonic
1182656486 22:31894554-31894576 CAATATCTGAAGACAGAAAAGGG + Intronic
1183025573 22:35063740-35063762 CAATAAGACAATTCAGAAAAGGG + Intergenic
1183121422 22:35732909-35732931 GAAGAAGTGAGGTCAGAAAAGGG + Intergenic
1183553701 22:38508430-38508452 CAAGGAGGAAAGACAGAAGAGGG - Intergenic
1183915086 22:41111529-41111551 AAAGAAGGAAAGAAAGAAAAAGG - Intronic
1184727722 22:46356329-46356351 CCAGAAGCGAGGACAGAAAATGG + Intronic
1184954419 22:47874802-47874824 AAAGAGATAAAGACAGAAAAAGG - Intergenic
949412659 3:3782758-3782780 CAAGAAGGCAAGAAAGATGAAGG + Intronic
949745499 3:7287264-7287286 ACAGAAGTCAAGTCACAAAAGGG - Intronic
950236174 3:11322257-11322279 CAAAAAGATAAAACAGAAAAAGG - Intronic
950501896 3:13369843-13369865 CAAGAGGGCAAGGCAGAAATGGG + Intronic
951071918 3:18338990-18339012 CAAAAAGTTAAGAGAGATAAGGG + Intronic
951640970 3:24834966-24834988 CAGAAAGTGAAGAAAGAAAAAGG - Intergenic
951731886 3:25818850-25818872 GAAGAAGTCAAGAGAGATATTGG + Intergenic
952525390 3:34205080-34205102 TTAGAAGACAAGACAGAAAAAGG + Intergenic
953326708 3:42017523-42017545 TAAGAAGACAAGTCAGAATAGGG - Intronic
953429734 3:42829406-42829428 AAAGAAGTGAAGGGAGAAAATGG + Intronic
954674496 3:52308323-52308345 CCAGAAGCCATGACAGAAAGTGG - Intergenic
955608185 3:60729357-60729379 CAAAAAATAAAGACAAAAAATGG + Intronic
956328935 3:68083716-68083738 GAAGAAGTCAAGACCAAGAAAGG - Intronic
956601132 3:71023587-71023609 TAAAAAGTGAAGAGAGAAAAGGG - Intronic
956748272 3:72326760-72326782 CAAGGAGCCATGTCAGAAAAGGG + Intergenic
956808647 3:72842718-72842740 ATACAAGTCAAGATAGAAAAAGG + Intronic
957123235 3:76123896-76123918 CAAAAAAGCAAGAAAGAAAAAGG - Intronic
957124983 3:76147683-76147705 AAAGCAGCCAAGACAGGAAATGG + Intronic
957192282 3:77024931-77024953 GGAGAAGACAAAACAGAAAAAGG - Intronic
958745421 3:98128273-98128295 AAATAGGTCAAGACAGAAATAGG - Intergenic
958825528 3:99025874-99025896 CAAAAAGACAAGGAAGAAAAAGG - Intergenic
959431599 3:106260809-106260831 CAAGAACAGAAGACAGAAAGAGG + Intergenic
959456202 3:106565486-106565508 CAAGTAGTCAAGACACTGAATGG + Intergenic
959579272 3:107967492-107967514 CTAGAAGGCAAGAAACAAAATGG - Intergenic
959580064 3:107974241-107974263 CTAGAAGTAAGGACAGTAAAGGG - Intergenic
959823948 3:110770468-110770490 AAGGAATTCAAGACAGAAAATGG - Intergenic
960201607 3:114843444-114843466 CAAGATTTCAAGCCAGTAAATGG + Intronic
960313629 3:116148906-116148928 ACAGAAGTCAATAGAGAAAATGG + Intronic
960898183 3:122528181-122528203 CAAGACATAAAGACAGATAAAGG + Exonic
960915648 3:122691800-122691822 CAAAAAGGCCAGGCAGAAAAGGG + Intronic
961241128 3:125412577-125412599 CAAGAGGTTAAGAAAGACAAGGG + Intergenic
961925162 3:130471698-130471720 TATGAAATAAAGACAGAAAATGG + Exonic
962291063 3:134136746-134136768 CAAGAAATAAAAGCAGAAAAAGG + Intronic
962693000 3:137919748-137919770 CAAAAAGATAAGACCGAAAATGG + Intergenic
963281115 3:143385526-143385548 CAAGAAAGCAAGTCAGAATATGG + Intronic
965329047 3:167346934-167346956 CAAGAAATGATGACAGAGAATGG + Intronic
965341533 3:167497721-167497743 GAGGAAACCAAGACAGAAAATGG - Intronic
965898113 3:173603622-173603644 CAAGAATTTAAAAGAGAAAATGG - Intronic
966225791 3:177596641-177596663 CAAGGAGTCATGCCAGGAAAAGG + Intergenic
966636755 3:182143315-182143337 GAAGAAGAAAAGAAAGAAAAAGG - Intergenic
966827355 3:183976210-183976232 CAAAAAGAGAAGAAAGAAAAAGG - Intronic
966954667 3:184863164-184863186 AAACACCTCAAGACAGAAAAAGG - Intronic
967999330 3:195192888-195192910 CAAGGAATCCACACAGAAAAAGG + Intronic
968839772 4:2994546-2994568 GAAGAGGTGAAGAAAGAAAAGGG - Intronic
970078682 4:12254670-12254692 CCAGAAGTCCAGACACCAAAGGG + Intergenic
970692689 4:18637981-18638003 TAAGAAGTCAAGGGGGAAAATGG - Intergenic
970899022 4:21137071-21137093 CAAGACGACAGGACAGAAAAGGG - Intronic
971663962 4:29457971-29457993 GAACAAGACAAGACAGAAAGGGG - Intergenic
971803577 4:31325149-31325171 AAAGATGTAAAGACACAAAATGG - Intergenic
971931128 4:33084672-33084694 CCAGAAGACATGACAGGAAAAGG + Intergenic
972281497 4:37606205-37606227 AAAGAAGGAAAGAAAGAAAAAGG + Intronic
972371579 4:38429162-38429184 CATGAAGTCAAGACTTCAAATGG - Intergenic
972551278 4:40137061-40137083 CCAGAAGTCTAAAGAGAAAAAGG + Exonic
972642057 4:40933940-40933962 CCAGAAGTCCAGAAACAAAATGG + Intronic
973078037 4:45955290-45955312 AAAGAAGAAAAGAGAGAAAACGG + Intergenic
973179083 4:47245896-47245918 AAAGAAAAAAAGACAGAAAAGGG - Intronic
973186645 4:47337487-47337509 TAAGAACTGAAGACAGAATAAGG + Intronic
973307741 4:48671889-48671911 AAAGAAGGAAAGACAGAAAAAGG + Intronic
973569756 4:52226057-52226079 CAAGAAGTCTAGACAAGCAAAGG + Intergenic
973685940 4:53370073-53370095 GAAGAAGTCAAGCCAGTGAATGG + Intergenic
974075057 4:57160928-57160950 CCTGAAGTCAAGACTGATAAAGG - Intergenic
974332847 4:60502742-60502764 AAAGAAGAAAAGACAGAGAATGG - Intergenic
974454710 4:62113082-62113104 CAATAAGACAAGAAAAAAAATGG - Intergenic
975029183 4:69592758-69592780 CCAGAAGTAAAGATAAAAAATGG + Intronic
975456142 4:74593084-74593106 AAAGAAGGAAAGAAAGAAAAAGG + Intergenic
976259535 4:83132688-83132710 AAAGAAGTCAAGAAAGAAGAGGG + Intronic
976360911 4:84177061-84177083 CAAGAAGTTAAGAGAGAAGTTGG - Intergenic
977106191 4:92887784-92887806 TAAGAAAGCAAGAGAGAAAAAGG - Intronic
977192157 4:94014468-94014490 CAAGAAGTTCAGCCAGAAGATGG + Intergenic
977591132 4:98828525-98828547 AAAGAAGGAAAGAAAGAAAAAGG + Intergenic
977812273 4:101370877-101370899 CAAGAAAGCAAGAAAGAAAGGGG - Intergenic
977912402 4:102552751-102552773 CATAAAGTTAAGACATAAAAGGG + Intronic
978094292 4:104756800-104756822 CAAAATGACAAGACAGAAAAGGG + Intergenic
978490354 4:109305012-109305034 GCATCAGTCAAGACAGAAAATGG - Intergenic
978663752 4:111157533-111157555 CTAGAAGACAAGAAACAAAAAGG + Intergenic
978679255 4:111359035-111359057 CAAGAGGTGAAGAGAAAAAAAGG - Intergenic
979756491 4:124346552-124346574 AAGGAAATCAAGAAAGAAAAGGG - Intergenic
980153408 4:129076677-129076699 CAAGTATTCAAGAAAAAAAATGG + Intronic
980413549 4:132455641-132455663 TAAGAAGTTAAGAAAGAAAATGG + Intergenic
980420817 4:132558484-132558506 GAAAAAGTAAAGACAGAAACTGG - Intergenic
980868717 4:138585630-138585652 CCAGTAGAAAAGACAGAAAAAGG + Intergenic
981594429 4:146403248-146403270 CAAGAGTTCCAGAAAGAAAATGG - Intronic
982463177 4:155696723-155696745 CAAAAAGTCAGAACAGAAAGAGG - Intronic
982583126 4:157204352-157204374 GAAGAAGTGAAGACACTAAAGGG + Intronic
982590081 4:157297577-157297599 CAATAAATCCAGATAGAAAATGG + Intronic
982810037 4:159813793-159813815 AAAGAATTAAAAACAGAAAATGG + Intergenic
983610993 4:169644881-169644903 CAAGAAGTCATGTGAGAAAAAGG + Intronic
983973569 4:173903822-173903844 ATAGAAGTCAAGACCCAAAAGGG - Intergenic
984299109 4:177892316-177892338 AAAGATGGCAAGAGAGAAAAAGG - Intronic
986105943 5:4659377-4659399 CAAGAAAAAAAGAAAGAAAATGG + Intergenic
986155664 5:5173317-5173339 CAAGAAGGAAAGAAATAAAACGG - Intronic
986186602 5:5447129-5447151 GAAGAATTCAAGGCATAAAAGGG - Intronic
986359669 5:6964837-6964859 ATAGAAGTCAAGAAAGAAAGTGG + Intergenic
986629591 5:9757326-9757348 CTAGAGGTCATGACAGAGAAAGG - Intergenic
986852202 5:11827611-11827633 CAAGAACTAAAGACATTAAAAGG + Intronic
986857711 5:11890493-11890515 TGAGAAGACAAGACAGAAGACGG - Intronic
987046709 5:14115748-14115770 CAAGAATTCTGGACAGAAATAGG - Intergenic
987291549 5:16513086-16513108 TCAGAAGTCATGACAGAAATAGG + Intronic
987386995 5:17339338-17339360 AAAGAAGGAAAGAAAGAAAATGG - Intergenic
987747579 5:21995941-21995963 GAAGGATTCAAGACATAAAATGG - Intronic
988250096 5:28745909-28745931 GAAGAACTAAAGACAGAAATTGG + Intergenic
988334006 5:29881616-29881638 AAAGAAGTCAATACAGCAAGAGG + Intergenic
988361396 5:30240352-30240374 TTAGAAGTCATGATAGAAAATGG - Intergenic
988714489 5:33811598-33811620 CAAGGAGACTAGAGAGAAAATGG + Intronic
988718622 5:33853707-33853729 CAAGGATGCAAGACATAAAAGGG + Intronic
989144078 5:38231192-38231214 CTAGAAGTCAAGGGAGAAAGGGG - Intergenic
989617044 5:43347570-43347592 TAAGAAGTCAAGAGAAAAAAGGG - Intergenic
989786209 5:45333960-45333982 TAAGAAGTCAATACAGTCAATGG - Intronic
990601670 5:57365113-57365135 AAAGAAGTCAAAGGAGAAAAAGG - Intergenic
991318497 5:65339805-65339827 GAAAAAGTAAAGAAAGAAAAAGG + Intronic
991767760 5:70005741-70005763 GAAGGATTCAAGACATAAAATGG - Intergenic
991846994 5:70880817-70880839 GAAGGATTCAAGACATAAAATGG - Intergenic
993248417 5:85483191-85483213 TTCGAAGTCATGACAGAAAATGG + Intergenic
993443390 5:87981804-87981826 CTTCAATTCAAGACAGAAAATGG - Intergenic
993484624 5:88467725-88467747 CAGGAGGTCAAGAGAGAAAATGG - Intergenic
993743730 5:91570188-91570210 AAAGAAGTCAATATACAAAAAGG + Intergenic
993828134 5:92719285-92719307 CTGAAAGTCAAGACAGAAAGAGG - Intergenic
994112181 5:96019076-96019098 TAACAAATCAAGATAGAAAAAGG + Intergenic
994435300 5:99722293-99722315 CATGTAGTCAAGGAAGAAAAAGG - Intergenic
995694344 5:114863371-114863393 CAGAAAGTCAACAAAGAAAATGG - Intergenic
995701176 5:114937732-114937754 CAAGGAGTCTAAAGAGAAAATGG + Intergenic
995863731 5:116668104-116668126 AAAGAAGACAAAAAAGAAAAAGG - Intergenic
996097823 5:119417644-119417666 CAAGAAAGTAAGACAGAAAAGGG + Intergenic
996448023 5:123580725-123580747 CAACAAGAGAAGACATAAAAGGG - Intronic
996578042 5:124998435-124998457 AAAGAAAACAAGAAAGAAAATGG - Intergenic
997048394 5:130348463-130348485 CAATAAGTCAAAAAATAAAAGGG - Intergenic
997134052 5:131306356-131306378 CAAGAACACAAAACAGAGAAAGG - Intronic
997849797 5:137321281-137321303 GAAGAAGGAAAGACAGACAAAGG + Intronic
998297216 5:140982987-140983009 AAAGAAGGAAAGAAAGAAAAAGG + Intronic
998359253 5:141570859-141570881 TAGGAAGTCAAGAAAGAAGAGGG + Intronic
998520704 5:142798001-142798023 CAAGACATCAAGAAAGAGAAAGG - Intronic
999121221 5:149210870-149210892 CAAAAAGTCATCACAGAAGAAGG + Intronic
999670948 5:153958839-153958861 CCAGAAGTATAGACAGTAAAAGG + Intergenic
1000604397 5:163312721-163312743 CAGGAAGTCAAGCTAGAAATAGG - Intergenic
1001310678 5:170608051-170608073 CAAGGAGTGAGGACAGAAGAAGG + Intronic
1001906845 5:175479821-175479843 CTAGAAGTCAACGCAGAAGAGGG - Intronic
1002106684 5:176882721-176882743 CAAGAAGCACAGAAAGAAAAAGG + Intronic
1002474574 5:179456660-179456682 CATGAAGTCAGGACAAAGAAGGG + Intergenic
1003017015 6:2476210-2476232 CCTGAAGTCAAGACAGGAACTGG + Intergenic
1003230425 6:4246943-4246965 CAAGAAGACATGATAGAGAAGGG - Intergenic
1003241053 6:4346137-4346159 AATGTAGGCAAGACAGAAAATGG + Intergenic
1003287601 6:4748127-4748149 CAAGAGGTCAACATAGCAAAAGG - Intronic
1003746425 6:9007482-9007504 AAAGAAGTAGAGGCAGAAAAAGG - Intergenic
1003863318 6:10341564-10341586 GAGGAAGACAAGACAGAAACGGG + Intergenic
1003957931 6:11182416-11182438 CCAAAAGTCAAGCCAGAAAATGG - Intergenic
1004177888 6:13356172-13356194 CAAGAAGTGAAACCGGAAAATGG + Intergenic
1005465246 6:26106726-26106748 AAAAAAGTTAAAACAGAAAAAGG - Intergenic
1006825890 6:36936233-36936255 AAAAAAGTGAAGATAGAAAATGG - Intergenic
1007066062 6:38991396-38991418 AAAGAAGTGAAGAAATAAAAAGG + Intronic
1007324860 6:41052203-41052225 CAAGGAGAAAAGACAGGAAATGG - Intronic
1008350614 6:50485127-50485149 CAATAAGACAAGAAAAAAAAAGG + Intergenic
1008912985 6:56756485-56756507 CAGGCATCCAAGACAGAAAAGGG + Intronic
1008936544 6:56998762-56998784 AAAGAAGGAAAGAAAGAAAAAGG + Intronic
1010254963 6:73747109-73747131 AAAGAAGCCAAGGCAGAAATCGG - Intronic
1010682452 6:78812471-78812493 AATGAAGTCAAGAGAGATAAGGG - Intergenic
1010890361 6:81301021-81301043 TAAGAAAGCAAGAGAGAAAAAGG + Intergenic
1011785262 6:90836589-90836611 AAACAGGTCAAGACAGAGAAGGG - Intergenic
1011844774 6:91550319-91550341 CAAGAAGTCTATATACAAAAAGG - Intergenic
1012153574 6:95787604-95787626 CAAAAAGTCAAGTCAGACTAGGG - Intergenic
1013423713 6:109990933-109990955 GAAGAAATAAAGAAAGAAAAAGG + Intergenic
1013799332 6:113923039-113923061 CAAGAACACAAGAGAGAAAGTGG + Intergenic
1014541200 6:122678378-122678400 CAAGAAGGCAATAGAGAAAATGG - Intronic
1014879199 6:126701277-126701299 GATCAAGTCAAGACAGAATAGGG - Intergenic
1015154655 6:130079239-130079261 CCAGGAATCACGACAGAAAAAGG - Intronic
1015199648 6:130565003-130565025 CAAGAATTCAAGGCAGAATTTGG + Intergenic
1016207672 6:141489711-141489733 AAAGCAGACAAGACAGAGAAGGG + Intergenic
1016455706 6:144228582-144228604 CATGAAATAAAAACAGAAAAAGG - Intergenic
1016469817 6:144363614-144363636 CAAGAAAACAAAACAAAAAAGGG + Intronic
1016583802 6:145660965-145660987 CAAGAAGACAATAAAGAAAAGGG + Intronic
1016753636 6:147659953-147659975 CATGGAGAGAAGACAGAAAATGG - Intronic
1017074130 6:150601557-150601579 CAAAAAGTCAAGTCAGGAATTGG - Intronic
1017473427 6:154763193-154763215 AAAGAACTCAAGAAAGAAAAAGG - Intronic
1017973530 6:159334107-159334129 CAAAGAGGCAAGACAGAAAAAGG + Intergenic
1020802070 7:12744165-12744187 AAAGAAGTCATAACATAAAAGGG + Intergenic
1021033216 7:15764257-15764279 CCAGAAGGCAACACACAAAAAGG + Intergenic
1021300241 7:18963892-18963914 AAAGAAGTGAAGACAGGAAAGGG - Intronic
1021355472 7:19649950-19649972 ACAGAAGACAAGACAGAGAAAGG + Intergenic
1021475613 7:21057562-21057584 CAATAAGTCTAGATAGAAACAGG + Intergenic
1021940549 7:25674707-25674729 CAAAAACTCTAGAAAGAAAATGG - Intergenic
1021992884 7:26153753-26153775 AAAGAAGTTAAGCCAGAGAAGGG - Intronic
1022461550 7:30613046-30613068 TAAGAAGAGAAGACAGGAAATGG - Intronic
1022541728 7:31143341-31143363 AAAGAAGTCAACTCAGCAAAAGG - Intergenic
1023660839 7:42469422-42469444 AAAGAAATAAAGAAAGAAAAAGG - Intergenic
1024004416 7:45215019-45215041 TACGAATTCAAGACTGAAAATGG - Intergenic
1025138871 7:56445890-56445912 CAAGATGCAAAGACAGAAGAGGG + Intergenic
1025225090 7:57151323-57151345 CAACAACTCAAAACAAAAAAAGG - Intergenic
1025855526 7:65273937-65273959 GAAGAAGTCAAAAGGGAAAAAGG - Intergenic
1026184129 7:68068564-68068586 CAAGAAGTCAAGCCAGCAGGTGG + Intergenic
1026323842 7:69291558-69291580 CAAAAAGTCAAGTCAAAAAATGG + Intergenic
1027301251 7:76838592-76838614 CAAGAAGAAAACAAAGAAAAAGG - Intergenic
1027531638 7:79341822-79341844 GAAGAAGTTAAGACAGACATTGG - Intronic
1027832074 7:83190730-83190752 CAAGAAATCAAGGCACAGAATGG + Intergenic
1027969136 7:85055489-85055511 AAAGAAGAAAAGAAAGAAAAAGG - Intronic
1028708807 7:93883416-93883438 CAAAAAGTCAAAATAGAAATGGG - Intronic
1028967421 7:96817662-96817684 CCAAAAGGCAATACAGAAAAAGG + Intergenic
1029040543 7:97568589-97568611 CAAAAAGTCAATTCAGAAAATGG + Intergenic
1029094578 7:98074861-98074883 CAATAAGGGAACACAGAAAACGG - Intergenic
1029404975 7:100369292-100369314 AAGGAAGACAACACAGAAAAGGG + Intronic
1029481396 7:100815434-100815456 GAAGATTTCAAGACAGAAAGTGG + Intronic
1029820589 7:103142661-103142683 CAGGAAGCCAAGTCAAAAAAAGG + Intronic
1030473281 7:109995596-109995618 AAAGAAGAAAAGACAGAAGAAGG + Intergenic
1031428086 7:121632029-121632051 CAAGAAGATAAGTCACAAAATGG - Intergenic
1031529281 7:122856419-122856441 CAAGAAGAGAAGAAAGAGAAGGG - Intronic
1031678716 7:124644440-124644462 CAGGCAGAAAAGACAGAAAATGG - Intergenic
1031697095 7:124871551-124871573 CAAAAACTCAAAAGAGAAAATGG + Intronic
1031745318 7:125488795-125488817 AAATAAGTAAAGACAGAGAATGG + Intergenic
1031779972 7:125948450-125948472 CAAGAAAGAAAGAAAGAAAAAGG + Intergenic
1031907976 7:127481928-127481950 CAAAAGGACAAGAGAGAAAAAGG + Intergenic
1032799660 7:135307872-135307894 CAACCAGTCAACACAGAAATGGG + Intergenic
1032890412 7:136189279-136189301 TAAGAAGACAAAAAAGAAAATGG + Intergenic
1033504661 7:141987788-141987810 AAAGCAGTAAATACAGAAAATGG - Intronic
1033900788 7:146136471-146136493 CGGGAAGTCAGGACAGAAGAGGG + Intronic
1034602976 7:152280537-152280559 CAAGAAAGAAAGAAAGAAAATGG + Intronic
1034895954 7:154876458-154876480 CAGGAAGGAAGGACAGAAAAAGG + Intronic
1035993770 8:4522471-4522493 CAAAATGGCAAGACACAAAATGG + Intronic
1036953958 8:13167172-13167194 CAAGAAGATAATTCAGAAAATGG + Intronic
1037266361 8:17065975-17065997 CATGAAATCAAGACAGTATATGG + Intronic
1037351529 8:17963455-17963477 CGAGAAGTCAGAACAGAAAGTGG - Intronic
1037378589 8:18260422-18260444 CAAAAAGTCAAGGAAGAAGATGG - Intergenic
1037698043 8:21244670-21244692 GAAGGAGGCAAGAGAGAAAAAGG - Intergenic
1037704549 8:21308211-21308233 GAAGGAGTGAAGACAGAACAAGG + Intergenic
1037874383 8:22533372-22533394 GAAAAAGGCAAGACACAAAATGG + Intronic
1038087033 8:24209802-24209824 CAAGAAGGTAAGACAAAAAGAGG + Intergenic
1038115878 8:24554637-24554659 CAAGAAGTGAAGACAGAAAGTGG - Intergenic
1038343501 8:26709893-26709915 AAAGAGGAAAAGACAGAAAAAGG + Intergenic
1038456558 8:27675441-27675463 CAAAAGGGCAAGACAGAAGAAGG - Intronic
1038897506 8:31802268-31802290 CATGAAGTAAAGTCAGAAAAAGG - Intronic
1039334224 8:36572263-36572285 CAAGAAGTCAAGAAGGAAAAAGG - Intergenic
1039672693 8:39620104-39620126 CAAGAACTCACAACAGAGAAAGG + Intronic
1039837140 8:41265450-41265472 AAAGAAGTGAAAAAAGAAAATGG - Exonic
1039963483 8:42267472-42267494 CATGAAGTAAGGACAGACAAAGG - Intergenic
1040802100 8:51353042-51353064 CAAGACTCCAAGAAAGAAAATGG + Intronic
1040910787 8:52516541-52516563 CAAGAGGTCAAGAAAGCCAAAGG + Intergenic
1040995763 8:53400601-53400623 CAAGAAGACAAAATACAAAATGG - Intergenic
1042006016 8:64181045-64181067 AAAGAGGTCAAATCAGAAAAAGG + Intergenic
1042027840 8:64443093-64443115 CAGGAAAGCAAGACAGAATAAGG + Intergenic
1042179268 8:66069135-66069157 CAAGAAGGCAAGAAAGGAAAGGG + Intronic
1042358636 8:67856975-67856997 CAAGAAGAAAAGTCAGAGAAAGG - Intergenic
1043802550 8:84628592-84628614 GAAGAAATCATCACAGAAAATGG + Intronic
1043956115 8:86361393-86361415 AAAGTAGTCTAGGCAGAAAATGG - Intronic
1044081725 8:87893479-87893501 CATGAAAGCAAGATAGAAAATGG + Intergenic
1044141677 8:88661881-88661903 CAACAAGTGAATACAGAAAATGG + Intergenic
1044367828 8:91370277-91370299 GAAGAAGAAAAGAAAGAAAATGG - Intronic
1044381458 8:91538975-91538997 CAAGAACACAAGATGGAAAAAGG - Intergenic
1044800955 8:95955307-95955329 CAAACATTGAAGACAGAAAAAGG - Intergenic
1045090247 8:98734442-98734464 CAAGTAGTCAAATCAAAAAATGG + Intronic
1045907318 8:107362630-107362652 TAAGAAGTCAAGAATGCAAAAGG - Intronic
1046555234 8:115766608-115766630 AAAGAAGAGAAGAAAGAAAAAGG + Intronic
1046594887 8:116249591-116249613 AAAGGACTCAAGGCAGAAAAGGG - Intergenic
1047388320 8:124429999-124430021 CAGCAAGTCAAGGAAGAAAATGG - Intergenic
1047417292 8:124675070-124675092 CAAGAAGTCAGGAAACAACAAGG + Intronic
1047558619 8:125962239-125962261 CAAGAAATCAAAAGTGAAAAGGG - Intergenic
1047603255 8:126448648-126448670 TAAGAATCCAAGACAGAAAGAGG + Intergenic
1047719090 8:127622154-127622176 CAAAAACTCAAGAGAAAAAAAGG + Intergenic
1047814016 8:128442860-128442882 GCAGAAGTGAAGAAAGAAAAGGG - Intergenic
1047836847 8:128703224-128703246 CAAGCATGCAAGACAGAGAAAGG + Intergenic
1048054660 8:130852052-130852074 GAAGAAGAGAAGACAGCAAAGGG + Intronic
1048405978 8:134121656-134121678 CATGAAATCAAAACAGAAAATGG + Intergenic
1048625582 8:136181605-136181627 TGAGAAGACAAGAAAGAAAAGGG - Intergenic
1049872820 8:144994340-144994362 AAAGAGGACAAGATAGAAAAAGG + Intergenic
1050716967 9:8540742-8540764 CAAGAACACATTACAGAAAATGG + Intronic
1052305663 9:27006592-27006614 CAAGAAAGAAAGACAGAAAGAGG + Intronic
1052704568 9:31980006-31980028 CAAGAAGAAAAGACAGAGGAAGG - Intergenic
1052751116 9:32492019-32492041 CAAGAAATCAACTCTGAAAAGGG + Intronic
1053068449 9:35085682-35085704 AAGGAAGATAAGACAGAAAAAGG + Intergenic
1053206990 9:36194700-36194722 CAGGAACTCCAGACAGAAAAAGG - Intronic
1055153987 9:73038588-73038610 GAAGAAAGCAAGACAGAAGAAGG - Intronic
1055655271 9:78444724-78444746 AAAAAAGAAAAGACAGAAAATGG - Intergenic
1056073761 9:83016671-83016693 CTAGCAGAGAAGACAGAAAAAGG + Intronic
1056259186 9:84830758-84830780 GAAGAAGTAAACACAGAATATGG - Intronic
1056492711 9:87123235-87123257 GAGGAAGTCAAGACAGAACAAGG + Intergenic
1057120386 9:92566772-92566794 GAAGAAGACGAGAAAGAAAAAGG + Intronic
1057953267 9:99386602-99386624 GAAGGAGTCAAGAGAGAAGAAGG + Intergenic
1058130220 9:101243528-101243550 CAGTTACTCAAGACAGAAAATGG - Intronic
1058630311 9:106979536-106979558 CAAGATGTCAAAAGAAAAAAAGG - Intronic
1058698425 9:107580300-107580322 AAAGAAGTAAAGAAATAAAAAGG - Intergenic
1058716505 9:107727064-107727086 GAAGAAAACAAGAAAGAAAAGGG - Intergenic
1059589117 9:115638696-115638718 GAAGAGGTTTAGACAGAAAAGGG - Intergenic
1060356993 9:122918401-122918423 AAATAACTCAAAACAGAAAATGG + Exonic
1061377844 9:130236637-130236659 TAAGATGCCAAGACAGAAGATGG - Exonic
1061917836 9:133764804-133764826 CAAGGAGAAAAGAGAGAAAATGG + Intronic
1186228317 X:7425309-7425331 CAAGGAATTATGACAGAAAATGG - Intergenic
1186700928 X:12089061-12089083 CAAGGAAGCCAGACAGAAAAGGG - Intergenic
1187723985 X:22183187-22183209 CTAGAAGCCAGGACAGAACAGGG - Intronic
1188233595 X:27698291-27698313 AGACAAATCAAGACAGAAAAGGG - Intronic
1189001852 X:36956644-36956666 CAAAAAGTCAAGAGATAACAAGG + Intergenic
1189225350 X:39408534-39408556 CAAAATGTCAGCACAGAAAATGG + Intergenic
1189850681 X:45173480-45173502 AAAGAAGGAAAGAAAGAAAAAGG - Intronic
1190101607 X:47526426-47526448 CAACAAATGAAGACAGAAGAAGG - Intergenic
1190125042 X:47697303-47697325 CCTGAAGTCAAGTCAGCAAAAGG + Intergenic
1190247439 X:48699958-48699980 CATGAAGTCATTCCAGAAAAGGG + Intronic
1190846211 X:54193467-54193489 CAAGAAGGGAAGAGAGAAACTGG - Exonic
1191582528 X:62780293-62780315 CAACAAGAGAAAACAGAAAATGG + Intergenic
1191974364 X:66854257-66854279 CAAGAAACTAAGACAAAAAAAGG - Intergenic
1192434504 X:71134656-71134678 AAAGAGGTGAAGATAGAAAAAGG - Intronic
1192543780 X:71996244-71996266 AAAGAAGTCAAAAAAGAAATGGG - Intergenic
1193483949 X:82062414-82062436 CAAAAAGTCTACAAAGAAAATGG + Intergenic
1193528140 X:82618977-82618999 CAGGCAGTCTAGACAGAAAAAGG + Intergenic
1193558032 X:82981019-82981041 CAAAAAATCAAGACATGAAATGG + Intergenic
1193623482 X:83787083-83787105 CAAGAAGTTGAGCCAGAACAAGG + Intergenic
1193736812 X:85166891-85166913 CAATAAGTGAATAAAGAAAATGG + Intergenic
1193752922 X:85369334-85369356 CAAGAAGACAAGAAAAAAGAGGG + Intronic
1195109916 X:101637751-101637773 CTAGAAGACATGGCAGAAAAAGG - Intergenic
1195541778 X:106070198-106070220 AAAGATGTCAAGACAGCACATGG + Intergenic
1195692860 X:107642672-107642694 TCGGAAGACAAGACAGAAAAGGG + Intronic
1196215373 X:113045118-113045140 AAAGAAGTCAAATCAGCAAAAGG - Intergenic
1198010251 X:132545259-132545281 CAAGAAAGAAAGAAAGAAAAAGG + Intergenic
1198044521 X:132887983-132888005 CCAGAGGTCAAGAGTGAAAATGG + Intronic
1198316950 X:135477551-135477573 AAAGAATTAAAGACAGATAAGGG - Intergenic
1198333004 X:135639273-135639295 CATGAAGAGAAGACAAAAAATGG - Intergenic
1198535959 X:137586687-137586709 CCAGAAGCCAAGACAAAAATAGG - Intergenic
1198683365 X:139204381-139204403 CAAGAAGTGAAGAGACAAAGCGG + Intronic
1199185045 X:144906961-144906983 GCAGAAGTCATGACAGAAACTGG + Intergenic
1199511311 X:148626129-148626151 TAAGAATTGAAGACAGAATAGGG - Intronic
1200808607 Y:7459196-7459218 TAAGAAGTCAAAGGAGAAAAAGG - Intergenic
1201624126 Y:15995191-15995213 AATGAATTCAAGACAGAAGAAGG + Intergenic
1201926046 Y:19289079-19289101 CAAAAAGTCAAGCTAGAAACTGG - Intergenic
1201973869 Y:19826599-19826621 CAAGAAGACACAATAGAAAAAGG + Intergenic
1202012321 Y:20356876-20356898 AAAAAAGTAAAGACAGAAAAAGG + Intergenic
1202345001 Y:23912692-23912714 TAAGAAGAAAAGAAAGAAAAAGG + Intergenic
1202525769 Y:25757392-25757414 TAAGAAGAAAAGAAAGAAAAAGG - Intergenic