ID: 1127597165

View in Genome Browser
Species Human (GRCh38)
Location 15:60497207-60497229
Sequence AAGAAGTCAAGACAGAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1559
Summary {0: 1, 1: 1, 2: 9, 3: 147, 4: 1401}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127597162_1127597165 6 Left 1127597162 15:60497178-60497200 CCTCCTGTTGTAAACAGAGGTCA 0: 1
1: 0
2: 1
3: 12
4: 110
Right 1127597165 15:60497207-60497229 AAGAAGTCAAGACAGAAAAAGGG 0: 1
1: 1
2: 9
3: 147
4: 1401
1127597158_1127597165 22 Left 1127597158 15:60497162-60497184 CCGACTTTAGTACCCTCCTCCTG 0: 1
1: 0
2: 1
3: 5
4: 128
Right 1127597165 15:60497207-60497229 AAGAAGTCAAGACAGAAAAAGGG 0: 1
1: 1
2: 9
3: 147
4: 1401
1127597159_1127597165 10 Left 1127597159 15:60497174-60497196 CCCTCCTCCTGTTGTAAACAGAG 0: 1
1: 0
2: 2
3: 10
4: 193
Right 1127597165 15:60497207-60497229 AAGAAGTCAAGACAGAAAAAGGG 0: 1
1: 1
2: 9
3: 147
4: 1401
1127597157_1127597165 25 Left 1127597157 15:60497159-60497181 CCTCCGACTTTAGTACCCTCCTC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1127597165 15:60497207-60497229 AAGAAGTCAAGACAGAAAAAGGG 0: 1
1: 1
2: 9
3: 147
4: 1401
1127597160_1127597165 9 Left 1127597160 15:60497175-60497197 CCTCCTCCTGTTGTAAACAGAGG 0: 1
1: 0
2: 0
3: 12
4: 141
Right 1127597165 15:60497207-60497229 AAGAAGTCAAGACAGAAAAAGGG 0: 1
1: 1
2: 9
3: 147
4: 1401
1127597163_1127597165 3 Left 1127597163 15:60497181-60497203 CCTGTTGTAAACAGAGGTCAATG 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1127597165 15:60497207-60497229 AAGAAGTCAAGACAGAAAAAGGG 0: 1
1: 1
2: 9
3: 147
4: 1401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127597165 Original CRISPR AAGAAGTCAAGACAGAAAAA GGG Intronic
900074364 1:801091-801113 AAGAGGTAAAGACAAGAAAATGG - Intergenic
900531945 1:3158741-3158763 AAGAAAGAAAGAAAGAAAAAAGG - Intronic
900892338 1:5458482-5458504 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
900960699 1:5917373-5917395 AAGAAGCCAACACTGAAGAAAGG + Intronic
901176482 1:7303167-7303189 AAGAAGTCAAGTAATAATAACGG - Intronic
901278209 1:8009632-8009654 GAGAAGTCAAGACAGGAACCTGG + Intronic
901806779 1:11743552-11743574 AAAAAGGAAAGAAAGAAAAAGGG - Intronic
901961438 1:12829339-12829361 AAGAAGACAAGAAAGAAAGAAGG - Intronic
901968026 1:12883946-12883968 AAGAAGACAAGAAAGAAAAAAGG - Intronic
901975838 1:12943104-12943126 AAGAAGACAAGAAAGAAAGAAGG - Intronic
901983427 1:13054211-13054233 AAGAAGACAAGAAAGAAAGAAGG - Intronic
901985579 1:13073124-13073146 AAGAAGACAAGAAAGAAAGAAGG + Intronic
901996230 1:13153643-13153665 AAGAAGACAAGAAAGAAAGAAGG - Intergenic
901998662 1:13174707-13174729 AAGAAGACAAGAAAGAAAGAAGG + Intergenic
902009336 1:13258661-13258683 AAGAAGACAAGAAAGAAAGAAGG + Intronic
902017150 1:13317834-13317856 AAGAAGACAAGAAAGAAAGAAGG + Intronic
902043044 1:13506218-13506240 AAGAAGTCAAGGCAGGGAATGGG + Intronic
902101014 1:13989076-13989098 AAGAGGGCAAGAGAGAGAAAAGG + Intergenic
902758993 1:18568629-18568651 AAGAAGTAAAGAAAGAAGGATGG + Intergenic
902767444 1:18626812-18626834 AAGAAGACCAGGAAGAAAAAAGG + Intergenic
902857683 1:19220935-19220957 AAGAATTTAAAACAAAAAAATGG + Intronic
902978439 1:20106315-20106337 AAGAATTCTGGACAGAAATATGG + Intergenic
903048034 1:20579073-20579095 AAGAAGTCATGATGGAAAGAAGG + Intergenic
903612889 1:24629623-24629645 AAGAGATAAAGAAAGAAAAAAGG - Intergenic
904620845 1:31774234-31774256 GAGGAGTCAAGATTGAAAAAGGG + Intergenic
904781011 1:32947982-32948004 ATGGAGGCAAGACAGCAAAAGGG + Intronic
904901632 1:33862227-33862249 AAGAAGAAAAGGCAGTAAAAGGG - Intronic
905008375 1:34729585-34729607 AAGCAGACAAGAAAGAAAGAGGG + Intronic
905188431 1:36213883-36213905 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
905258395 1:36700399-36700421 AAGAAGGAAAGAAGGAAAAAAGG - Intergenic
905258421 1:36700492-36700514 AAGAAGGAAAGAAGGAAAAAAGG - Intergenic
905521850 1:38606426-38606448 AATTAGTCAAGAGAGTAAAAAGG - Intergenic
905834142 1:41102506-41102528 AATGAGTCAGGAGAGAAAAAAGG - Intronic
905928530 1:41769592-41769614 AAGAAGTTAAGAAGGAAGAAAGG + Intronic
906041582 1:42792047-42792069 AAGAAATTAATAGAGAAAAATGG + Intronic
907060901 1:51423762-51423784 AAGTAGCCAAGGCAGAAAGATGG + Intronic
907227657 1:52964025-52964047 AATAGGTCAAAAAAGAAAAAAGG - Intronic
907259863 1:53209847-53209869 AATAATTCAAGACATACAAATGG - Intronic
907562080 1:55400167-55400189 AGGAAGTGAAGAAAGAAAGAAGG - Intergenic
907824359 1:58000995-58001017 AAGAAGTTAAGAGAGAAGAAAGG - Intronic
907926256 1:58957735-58957757 AAGAGCTCAAGGCGGAAAAACGG + Intergenic
907986106 1:59532775-59532797 AACAAGTCAAGAAAAATAAATGG + Intronic
908139043 1:61164183-61164205 AGCATGTCAGGACAGAAAAATGG - Intronic
908199259 1:61777683-61777705 AAGAAAGAAAGAAAGAAAAAAGG - Intronic
908603103 1:65762740-65762762 GAAAACTCAAGACAGAAAACGGG + Intergenic
908606281 1:65800335-65800357 AAAAACTCAATGCAGAAAAATGG + Intronic
908613301 1:65887182-65887204 AAGAAAGAAAGAAAGAAAAAGGG - Intronic
908889363 1:68826084-68826106 AAGCAGACAAGAGAGAAAATGGG + Intergenic
909437450 1:75659399-75659421 AAGAAGGAAAGAAAGAAAGAGGG + Intergenic
909456542 1:75856273-75856295 AAGAAAGAAAGAAAGAAAAAAGG - Intronic
909491166 1:76228078-76228100 TAGGAGTCAAGACAGAAAGATGG + Intronic
909824748 1:80113687-80113709 ATGGATTTAAGACAGAAAAATGG + Intergenic
910240891 1:85085143-85085165 CAGAAGTCAGGACAGAAACAGGG + Intronic
910277156 1:85462145-85462167 GAGAACTTAAGACAGATAAAAGG + Intronic
910311973 1:85834134-85834156 AAAAAGTAAATACAAAAAAATGG + Intronic
910852386 1:91661578-91661600 AGAAAATAAAGACAGAAAAATGG + Intergenic
911161918 1:94689743-94689765 AAGAAAGAAAGAAAGAAAAATGG + Intergenic
911436774 1:97869837-97869859 AAGAAATGAAGACAGAAAGAAGG - Intronic
911457645 1:98147144-98147166 AATAAGTCAATAAATAAAAAGGG + Intergenic
911552828 1:99305384-99305406 AAGCAGACAAGAGAGAAATAAGG - Intronic
911756972 1:101569834-101569856 AAGAATTCAAGATCTAAAAAGGG + Intergenic
912200390 1:107451088-107451110 AAGAAAGAAAGAAAGAAAAAAGG - Intronic
912598779 1:110906087-110906109 AGGAAGACAAGAAAGAAAGAAGG + Intergenic
912615375 1:111094956-111094978 CAGAAGCCAAAATAGAAAAATGG + Intergenic
912686749 1:111774083-111774105 AAGAGATAAAGACAGAAAGAAGG + Intronic
914213238 1:145601154-145601176 AAGAAGAAAAAACAGAAAAAAGG + Intergenic
914264493 1:146026869-146026891 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
914465176 1:147921596-147921618 AAGAAGAAAAAACAGAAAAAAGG + Intergenic
914898346 1:151696949-151696971 AAGAAGGAAAGAAAGAAAAGTGG - Exonic
915574312 1:156765401-156765423 AAGAAAGAAAGAAAGAAAAATGG - Intronic
915713579 1:157924034-157924056 AAGAATGGAATACAGAAAAAGGG - Intergenic
915973991 1:160372969-160372991 AACAAATGAAGACAGAGAAAAGG + Intergenic
916066842 1:161142870-161142892 AAGAAAGAAAGAAAGAAAAAAGG + Intergenic
916306082 1:163334783-163334805 GAGAAGGAAAGAAAGAAAAATGG + Intronic
916442800 1:164844091-164844113 AAGAAAGAAAGAAAGAAAAAAGG - Intronic
916973118 1:170045745-170045767 CAGAGTTCAAGTCAGAAAAATGG - Intronic
917035184 1:170740987-170741009 AGTAAGTGAAGACATAAAAATGG + Intergenic
917560669 1:176151317-176151339 AAGAAGGAAAGAAAGAAAGAAGG + Intronic
917574328 1:176305045-176305067 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
917691199 1:177471134-177471156 AATAAGCCAAGACAAAAAAGAGG + Intergenic
917698893 1:177560027-177560049 AGGAAGGAAAGAAAGAAAAAGGG + Intergenic
917840971 1:178977493-178977515 AGGGAGTAGAGACAGAAAAAGGG + Intergenic
918045846 1:180940712-180940734 AAAAAGAAAAGAAAGAAAAAAGG - Intronic
918117644 1:181510614-181510636 AAGAAACCAAGAAAGACAAAAGG - Intronic
918273361 1:182925096-182925118 AAGAAGTGAAGAAAGAAAGAAGG + Intronic
918286317 1:183058594-183058616 AAGAAGACATTACAGAAAAATGG - Intronic
918573425 1:186026052-186026074 TAGAAATCTAGACAGAAAACTGG + Intronic
918618289 1:186573305-186573327 AAAAAATAAAGATAGAAAAAAGG - Intergenic
918625504 1:186652263-186652285 AAGAAAGAAAGAAAGAAAAAGGG - Intergenic
918697522 1:187562197-187562219 AAGCAGTGAAGACCGAAAAAAGG - Intergenic
918776715 1:188641709-188641731 AAGAGGTCAAGACAAAGAAATGG + Intergenic
918777752 1:188657075-188657097 ATGAAGACCAAACAGAAAAAAGG + Intergenic
918794659 1:188877516-188877538 AAGAACAAAAGACAGAAGAAAGG + Intergenic
918876116 1:190046193-190046215 AAGAAATGAAGAAAGGAAAAAGG + Intergenic
918966560 1:191357441-191357463 ATGAAGTCCAGAAAGAATAAAGG + Intergenic
918981198 1:191561362-191561384 AAGCAGTTAAGACTGAATAAAGG + Intergenic
919053360 1:192538752-192538774 AAGAAACCAAAAAAGAAAAATGG + Intergenic
919201680 1:194363050-194363072 CAGCAGTCAACTCAGAAAAATGG + Intergenic
919288789 1:195601449-195601471 AAAAAGGAAAGAAAGAAAAAGGG - Intergenic
919675251 1:200375829-200375851 AAGGAGTAAAGAGAGAAAGATGG - Intergenic
919697412 1:200592166-200592188 TAGAAGTCCAGAAAGGAAAAAGG - Exonic
919832118 1:201549196-201549218 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
920023719 1:202976240-202976262 AAGAAAGAAAGAAAGAAAAAAGG - Intergenic
920289580 1:204909764-204909786 AAGAAAGAAAGAAAGAAAAAAGG - Intronic
920549885 1:206849949-206849971 AGGAAGGAAAGACAGAAGAAAGG + Intergenic
920585113 1:207151644-207151666 AAGGAGACAAGAGACAAAAAAGG - Intergenic
920981882 1:210844489-210844511 ATGAAATGAAGACAGAAATAAGG + Intronic
921073425 1:211681089-211681111 AAGATTTCTAGAAAGAAAAAAGG + Intergenic
921182155 1:212639778-212639800 AAGAAGAAAAGAAAGAAAGAAGG + Intergenic
921186515 1:212674798-212674820 AAGGAGCCAGGACACAAAAAGGG - Intergenic
921221173 1:212975088-212975110 AAGAAACCAGGACACAAAAAGGG + Intronic
921388114 1:214591180-214591202 ATGAAATACAGACAGAAAAAAGG + Intergenic
921494459 1:215821623-215821645 GAGAAGCAAAAACAGAAAAATGG - Intronic
921603640 1:217133601-217133623 AAGAAAGAAAGAAAGAAAAAAGG - Intronic
921681834 1:218042762-218042784 AAGGAATCAAGAAAGAGAAAAGG + Intergenic
921900734 1:220447915-220447937 AAAAAGAGAAGACAGAACAAAGG + Intergenic
921966819 1:221099171-221099193 AAGATTTATAGACAGAAAAAGGG + Intergenic
922105307 1:222508437-222508459 AAGAAGGCAAGAGGGCAAAAGGG + Intergenic
922143177 1:222910731-222910753 AAGCAGTCTAAACAGAGAAAAGG + Intronic
922265640 1:223981015-223981037 AAGAAGGCAAGAGGGCAAAAGGG + Intergenic
922270213 1:224025995-224026017 AAGAGGTAAAGACAAGAAAATGG - Intergenic
922276026 1:224079347-224079369 AAGAAAAAAAGAAAGAAAAAGGG - Intergenic
923013300 1:230106016-230106038 AAGAAGTCAAGTCCGAAGACCGG - Intronic
923096542 1:230779494-230779516 AAGAAGTCAACACATAAAAGAGG - Intronic
923446850 1:234079563-234079585 AAAAAGTCATGAATGAAAAATGG + Intronic
923514150 1:234680626-234680648 AAAAAGGAAAGACAGAAAGAAGG + Intergenic
923621429 1:235582546-235582568 CAGAAGTGCAGACAGGAAAAAGG - Intronic
923673093 1:236057697-236057719 AAGAAGGAAAGAAAGAAAGACGG + Intronic
923930876 1:238695141-238695163 CATAAGCCAAGACAGACAAATGG + Intergenic
924002973 1:239574332-239574354 GATAAGTGAAGACAGAAAGAAGG - Intronic
924049366 1:240064711-240064733 AAGAGGTCAAAAGAGAAATAAGG - Intronic
924156933 1:241187178-241187200 AAGGAGTGAAAAGAGAAAAAGGG + Intronic
924267765 1:242300482-242300504 AAGAAATCAAGGCAGAAATGAGG + Intronic
924894634 1:248322918-248322940 AAGAAGTCATTATACAAAAAAGG + Intergenic
1062816115 10:501658-501680 AAGCAGTCCAGACAGGCAAAAGG + Intronic
1062840735 10:669296-669318 AAGAAGACAAGACAGAAGCAAGG + Intronic
1063003598 10:1947153-1947175 AGGAAGTCAGGGAAGAAAAATGG + Intergenic
1063156877 10:3387851-3387873 AAGAAAGAAAGAAAGAAAAAAGG + Intergenic
1063245572 10:4214401-4214423 AAGAAACAAAGAGAGAAAAAGGG - Intergenic
1063802391 10:9595190-9595212 AAGTAGTAAAGAGAGTAAAAGGG - Intergenic
1063822858 10:9857126-9857148 AAGAAATGAAGAGATAAAAATGG + Intergenic
1064252324 10:13716261-13716283 TAGAAGTCATAACAGGAAAATGG - Intronic
1064374913 10:14786647-14786669 AATAAGTAAAGATAGAAATAAGG + Intergenic
1064413898 10:15132274-15132296 AAGTAGTAAAGAAAAAAAAACGG - Intronic
1064836097 10:19532613-19532635 AAGAAGTCAGAAGAGAAACATGG + Intronic
1064857721 10:19789649-19789671 AAGAAGTGAAGACACCAGAAGGG + Intronic
1064953631 10:20882174-20882196 AAGAAGGAAAGACAGAAAGAAGG + Intronic
1065142779 10:22735558-22735580 CAGAAGCCAAGGCAGAAAGATGG - Intergenic
1065246024 10:23758666-23758688 AAGAAAGAAAGAAAGAAAAAGGG - Intronic
1065259181 10:23907195-23907217 AAGAGGTAAAGACAAAAGAAAGG - Intronic
1065268160 10:23998909-23998931 AATATTTCAAGACAGAAAGAAGG + Intronic
1065296656 10:24282328-24282350 AAGAAGACAACATAGAAAAGAGG - Intronic
1065353861 10:24820199-24820221 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
1065438326 10:25724330-25724352 AAGAAACAAAGAAAGAAAAATGG + Intergenic
1065518886 10:26552624-26552646 AAGAAGGAAAGAAAAAAAAAAGG + Intronic
1065551898 10:26876448-26876470 AAGAAAGAAAGATAGAAAAAGGG - Intergenic
1065631589 10:27686338-27686360 AAGAAGGAAAGAAAGAAAGAAGG + Intronic
1065639844 10:27770475-27770497 AAGAAGGAAAGAAAGAAGAAGGG - Intergenic
1065885935 10:30076971-30076993 CAGAAGGGAAGGCAGAAAAATGG + Intronic
1065990728 10:31007018-31007040 AAGAATTAAAACCAGAAAAATGG + Intronic
1066319364 10:34285816-34285838 AAAATGTTAAAACAGAAAAAAGG + Intronic
1066431148 10:35352917-35352939 AAGAAAGAAAGAAAGAAAAAAGG - Intronic
1066473433 10:35721755-35721777 AAGAAATAAAGAAAGAAAGAAGG - Intergenic
1066717126 10:38298264-38298286 AAGAAATCAAGGCAGAAATGAGG - Intergenic
1067076470 10:43188800-43188822 AAGAACTAAAGACCTAAAAATGG - Intergenic
1067514656 10:46927883-46927905 AAGAAGTGTAAACAGACAAATGG + Intronic
1067647604 10:48123930-48123952 AAGAAGTGTAAACAGACAAATGG - Intergenic
1067853462 10:49769819-49769841 AAGAAAGAAAGAGAGAAAAAGGG + Intergenic
1067854441 10:49780200-49780222 AAGAAGGAGAGACAGAGAAAGGG - Intergenic
1067931448 10:50566192-50566214 AAGAAGTGAAGCCAGAGAAGTGG + Intronic
1067993605 10:51243580-51243602 AACAAATCAACACAGAAAAATGG - Intronic
1068102275 10:52570212-52570234 AAGAAGAAGAGAAAGAAAAAAGG - Intergenic
1068609080 10:59038857-59038879 CAGAAGCCAAAATAGAAAAATGG - Intergenic
1068830666 10:61491250-61491272 AAGAAATAAAGAAAGAAAGAGGG + Intergenic
1069004939 10:63307034-63307056 AAGAAGTAATATCAGAAAAATGG - Intronic
1069007054 10:63329294-63329316 AAGAAAGAAAGAAAGAAAAAAGG + Intronic
1069098542 10:64289695-64289717 AAGAAGTCAGGAGACACAAAAGG + Intergenic
1069250588 10:66261570-66261592 AAGAATTCTGGACAGAAATATGG + Intronic
1069519162 10:69104256-69104278 AAGAATTCATGAGAAAAAAAAGG - Exonic
1069968611 10:72144587-72144609 AACAAGTAGAGACAGAAAAAAGG - Intronic
1070253800 10:74796814-74796836 AAAAAGACAAGACAGAGAAGGGG - Intergenic
1070485256 10:76924258-76924280 AACATTTCACGACAGAAAAATGG + Intronic
1070558702 10:77549673-77549695 AAAATGTGGAGACAGAAAAAAGG - Intronic
1070619926 10:78001445-78001467 AGGAAGCAAAGACAGAGAAATGG + Intronic
1070677818 10:78424602-78424624 ATGAAGTCAACAGAGAAGAACGG + Intergenic
1071021540 10:81062977-81062999 AAGAAGACAACACAGAGAATAGG - Intergenic
1071038789 10:81281224-81281246 AAGAAGACAAAAAACAAAAAAGG + Intergenic
1071043802 10:81348503-81348525 ATGAAATCAAGAAAAAAAAAGGG - Intergenic
1071125844 10:82333880-82333902 GAGAAGGAAAGAGAGAAAAAGGG + Intronic
1071143472 10:82540329-82540351 AAGAAGAGAAAACAGAAGAAGGG - Intronic
1071393152 10:85195598-85195620 GAGAAATCTAGACTGAAAAATGG + Intergenic
1071495025 10:86162277-86162299 CAGAAGCAAAGACAGGAAAAGGG + Intronic
1071729125 10:88230483-88230505 AAGAAGGCACGACAGAAAGACGG - Intergenic
1071939863 10:90577242-90577264 AAGAAGTAACTTCAGAAAAATGG - Intergenic
1071967659 10:90868637-90868659 AAAAAGACAAGACAGAATAGGGG - Intergenic
1072104538 10:92261429-92261451 AACAAAACAAAACAGAAAAAGGG - Intronic
1072353051 10:94577275-94577297 CAGAAGGCATGAAAGAAAAAAGG - Intronic
1072371006 10:94766430-94766452 AAGGAAGGAAGACAGAAAAAAGG + Intronic
1072991521 10:100199705-100199727 AAGAATGGAAGACAGAAAAAAGG - Intronic
1073360162 10:102891977-102891999 AAGAAGGCTAGAGAGAGAAATGG + Intronic
1073385385 10:103123121-103123143 AAAAAGTCAAAAAATAAAAAAGG - Intronic
1073400063 10:103250134-103250156 AAGAAATCATGACAGAACATAGG + Intergenic
1073638786 10:105228462-105228484 AAGAAATCAAGAAAGCAAGAGGG - Intronic
1073847277 10:107571418-107571440 AAGAAGTCATTACATGAAAAAGG + Intergenic
1074119421 10:110482437-110482459 AAGAAACAAAGACAGGAAAAAGG - Intergenic
1074538372 10:114345107-114345129 AAAAAGGAAAGAAAGAAAAAGGG + Intronic
1074643329 10:115414353-115414375 AAGAAGAGAAGAGGGAAAAAAGG - Intronic
1075488159 10:122844501-122844523 AAGAAGAGAAGAAAGAGAAAAGG + Intronic
1076252406 10:128994864-128994886 AAGAAAAGAAGAAAGAAAAAGGG + Intergenic
1076405718 10:130211465-130211487 AAGGAGTAAAGAAAAAAAAAGGG - Intergenic
1076573201 10:131445952-131445974 AAGAGGCTAGGACAGAAAAATGG + Intergenic
1077470515 11:2757112-2757134 AATAAGACAAGACAAAGAAATGG + Intronic
1077821160 11:5742146-5742168 AAGAAAGAAAAACAGAAAAAAGG + Intronic
1077880017 11:6341590-6341612 AAGAAATAAAGTGAGAAAAAAGG + Intergenic
1077890880 11:6417635-6417657 AAGTAGTCAAGGAAAAAAAATGG + Intronic
1078204009 11:9212061-9212083 CAGAAATACAGACAGAAAAAAGG + Intronic
1078365534 11:10703390-10703412 AAGCAGAACAGACAGAAAAAGGG + Intergenic
1078720877 11:13881991-13882013 AGGAAATCAAGGCACAAAAAAGG - Intergenic
1078766189 11:14300783-14300805 AAGAAGGAAGGAGAGAAAAAGGG + Intronic
1078835576 11:15026219-15026241 AAAAATACAAGACAGACAAAAGG + Intronic
1078949944 11:16119035-16119057 AAGAAGTGCAGTCAGAAACAGGG + Intronic
1078966789 11:16354284-16354306 AAGAAAACTTGACAGAAAAATGG + Intronic
1079192952 11:18296996-18297018 AAGAATTCAAAAAAAAAAAAAGG + Intronic
1079231756 11:18655223-18655245 AAAAAGAAAAGAAAGAAAAAAGG - Intergenic
1079642137 11:22819228-22819250 AAGAAATATAGACAGAGAAAAGG + Exonic
1079822470 11:25148216-25148238 AGGAAGGAAAGAAAGAAAAAGGG + Intergenic
1079936605 11:26624505-26624527 AAGGAGTGAAGTAAGAAAAATGG - Intronic
1080298845 11:30761179-30761201 AAGAAGTTAAGAAAGAGAAGGGG - Intergenic
1080302305 11:30798186-30798208 AAGAGGGAAAGAGAGAAAAAAGG - Intergenic
1080339398 11:31242437-31242459 CAGAAATCAAGAAATAAAAATGG + Intronic
1080449933 11:32370340-32370362 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
1080449934 11:32370356-32370378 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
1080870353 11:36231305-36231327 AAGAAAGAAAGAAAGAAAAACGG + Exonic
1081061155 11:38479535-38479557 AACAAAAAAAGACAGAAAAAAGG - Intergenic
1081350762 11:42049706-42049728 AAGAAGTGAATTCTGAAAAATGG + Intergenic
1081842631 11:46214204-46214226 AGGAAGAGAAGACAGAGAAATGG - Intergenic
1081885963 11:46496668-46496690 AAGAAGACAACAGAGAAAAAGGG + Intronic
1082639334 11:55637624-55637646 AAGAAGTCAAGAATGAAATTAGG + Intergenic
1082731515 11:56803683-56803705 AAGAATTTAAGAAAGAAAGAGGG + Intergenic
1082800624 11:57411737-57411759 AATAAGGAAGGACAGAAAAAAGG + Intronic
1082940198 11:58696950-58696972 AAAAAGTCAGGAAAAAAAAAAGG - Intronic
1083001786 11:59298904-59298926 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
1083126381 11:60571185-60571207 AGGAAGGAAAGAAAGAAAAAAGG + Intergenic
1083180174 11:60980211-60980233 AAGAAGTTAAGGGGGAAAAAAGG + Intronic
1083937817 11:65879646-65879668 AAGAAAGAAAGAAAGAAAAAGGG + Intergenic
1083999999 11:66290975-66290997 AAGAAATAAAGAAAGAAAGAAGG - Intergenic
1084158730 11:67332358-67332380 ATGAAATCAATTCAGAAAAAGGG - Intronic
1085165647 11:74397681-74397703 AGGAAGTCAAGGGAGAAAAAGGG + Intronic
1085228201 11:74941817-74941839 AAGAAGGATGGACAGAAAAAAGG + Intronic
1085511961 11:77092976-77092998 AAGAAAAAAAGAAAGAAAAAAGG + Intronic
1085626069 11:78074030-78074052 AAGAAAGAAAGAAAGAAAAAAGG - Intronic
1085681268 11:78577392-78577414 CAGAAGGCAAGACAGAAAAATGG - Intergenic
1085916764 11:80899134-80899156 AAGAAGGAATGACTGAAAAAGGG - Intergenic
1086233694 11:84600138-84600160 AAGAAGGAAAGAAAGAAAGAAGG + Intronic
1086284373 11:85229119-85229141 AAGCAGAAAAGACAGAAAGAGGG - Intronic
1086543741 11:87943908-87943930 AGGAAATCAAAACAGAAAATGGG - Intergenic
1086596157 11:88573791-88573813 AAGAAGGAAAGGCAGAAAGATGG - Intronic
1086614064 11:88793739-88793761 AAGAAGTTAAGTAAGAAAGAAGG + Intronic
1086807477 11:91262895-91262917 AAGAAGACCAGATAGGAAAAAGG + Intergenic
1087278935 11:96188469-96188491 AACCAGTCAACAGAGAAAAATGG + Intronic
1087382616 11:97425907-97425929 ATGAAGTACAGACATAAAAATGG - Intergenic
1087742508 11:101905004-101905026 AAGAAATCAATCTAGAAAAATGG - Intronic
1087929395 11:103959354-103959376 AAGAAGTCAGGTCAAGAAAAAGG - Intronic
1087964306 11:104393396-104393418 AAAAAATTAAGAAAGAAAAATGG + Intergenic
1088046678 11:105460981-105461003 AAGAAGACAGGAAAGAAAGAGGG + Intergenic
1088047637 11:105472884-105472906 AAGAAAGAAAGAAAGAAAAAAGG + Intergenic
1088226563 11:107626609-107626631 AAGAAGGAAAGAAAGAAAGAAGG - Intronic
1088355546 11:108940309-108940331 AACAAGTCATAACAGAAAGAAGG + Exonic
1088375742 11:109140134-109140156 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
1088392648 11:109331974-109331996 AATATGACAAGACAGTAAAAAGG - Intergenic
1088457084 11:110044051-110044073 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
1088508442 11:110549798-110549820 CAGAAGTCAAAATAGACAAATGG - Intergenic
1088620395 11:111675926-111675948 AAGAAGGCAAGAAAGACAATGGG - Intronic
1088700394 11:112406482-112406504 AAGAAGTGAAGGGAGAAAATGGG + Intergenic
1089085901 11:115816453-115816475 AAAAAGACAAAAGAGAAAAAAGG + Intergenic
1089268813 11:117287084-117287106 AAGGAGTAAAGAAAGAAAAAAGG + Exonic
1089392720 11:118113078-118113100 AAGAAGTCAAATTCGAAAAAGGG - Intronic
1089589365 11:119530641-119530663 AAGAATTCTGGACAGAAATATGG + Intergenic
1089707553 11:120290947-120290969 AAGAGGTAAAGAGAGGAAAAAGG - Intronic
1090432948 11:126662006-126662028 AAGAAGGGAAGGGAGAAAAAAGG + Intronic
1091069180 11:132547250-132547272 CATAAGTCAAGGCAGAAAAGTGG + Intronic
1091185990 11:133648440-133648462 ATGGAGTCAACACAGAAAGATGG + Intergenic
1091422834 12:357972-357994 AAGAAAGCAAGGCAGAAAGATGG + Intronic
1091558206 12:1592043-1592065 AAGAAGCCAACACAAAAAGACGG + Intronic
1091987083 12:4919367-4919389 AAGAAGTCAAGTCAGTTTAAAGG + Intronic
1092038225 12:5359837-5359859 AAGAAGGGAAGAAAGAAAGAAGG + Intergenic
1092256794 12:6930399-6930421 AAGAAATTAAGAGAGAAATATGG - Intronic
1092462684 12:8699749-8699771 GAGAAGACAAGAGAGAAAAAAGG - Intronic
1092889582 12:12956151-12956173 AAGAAAGAAAGAAAGAAAAAAGG - Intergenic
1092935437 12:13358561-13358583 AAGAGGAAAAGACAGAAGAAAGG - Intergenic
1093176824 12:15922009-15922031 AAGAAGTCAAAAGTTAAAAAAGG - Intronic
1093601816 12:21035762-21035784 TTGAAATCAAGACACAAAAATGG - Intronic
1093643151 12:21551428-21551450 AAGAAGATAAGACATAAAGAGGG + Intronic
1094232448 12:28122536-28122558 AAGAAGGAAAGACAGAAAGATGG + Intergenic
1094575979 12:31685809-31685831 AAGAAAGAAAGAAAGAAAAAAGG + Intronic
1094599855 12:31898849-31898871 AAGAAGTAAGGAAAGAACAAAGG + Intergenic
1094729563 12:33158912-33158934 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
1095112582 12:38314286-38314308 AATAAGTTACGGCAGAAAAATGG - Intergenic
1095204346 12:39422498-39422520 AATAAGACAAGACAATAAAACGG + Intronic
1095445392 12:42277317-42277339 AAGAAGTAAAAATAGAGAAAGGG - Intronic
1095520915 12:43064710-43064732 AAGCAGTCAATACTGAAAACAGG - Intergenic
1095619581 12:44234993-44235015 AAGAAGTAGACACATAAAAATGG - Intronic
1095683639 12:45007356-45007378 AATAAGTAAAGATAGTAAAAAGG + Intergenic
1096054637 12:48641285-48641307 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
1096055336 12:48646017-48646039 AAATAGTCAATAAAGAAAAAGGG + Intergenic
1096757498 12:53812395-53812417 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
1096898876 12:54853646-54853668 AAGAAGGCAGGAAAGAAGAAAGG - Intronic
1097094451 12:56535166-56535188 GAGAAGTATAGACAGAAAAGAGG - Intronic
1097229030 12:57497873-57497895 AAGCAGTCATGACAGTAAAAGGG + Intronic
1097452094 12:59749321-59749343 ATGAAACCAATACAGAAAAAGGG - Intronic
1097600345 12:61684429-61684451 AATAAGTCATGAAAAAAAAAAGG + Intergenic
1097660209 12:62422073-62422095 AATAAGTCATGACACAAAAAAGG + Intergenic
1097945381 12:65362270-65362292 AAGAGGGAAAGATAGAAAAAGGG + Intronic
1097969383 12:65616149-65616171 AAGAAAGAAAGAAAGAAAAAAGG - Intergenic
1098020549 12:66150812-66150834 AAAAATTAAAGATAGAAAAAGGG + Intronic
1098074505 12:66714778-66714800 AGGTAGTCAAGCCAGAAAATGGG + Intronic
1098116949 12:67189251-67189273 AAGAAGGAAAGAAAGAAAGAGGG + Intergenic
1098219168 12:68250473-68250495 AAAAAGTCAAGAGGGAAAAAGGG + Intronic
1098420292 12:70289066-70289088 AAGAAGGGAAGAAAGAAAAAAGG - Intronic
1098474484 12:70884380-70884402 AAGAAGGAAAGAAAGAAAAGGGG + Intronic
1098794262 12:74868153-74868175 AAGAAAGAAAGAAAGAAAAAAGG - Intergenic
1098820319 12:75219636-75219658 CAGAAGCCAAAACAGACAAATGG - Intergenic
1098840932 12:75477162-75477184 TTGAAGTCAAGGCAGAAAACGGG + Intergenic
1099016554 12:77350170-77350192 AGCAAGCCAAGACAGAATAAGGG - Intergenic
1099117469 12:78645636-78645658 GAGAAGACCTGACAGAAAAATGG + Intergenic
1099224565 12:79954178-79954200 AACAAGAGAAGACAGGAAAAAGG - Intergenic
1099313125 12:81052792-81052814 AAGAAGTAAAGAAAGAAAGTGGG + Intronic
1099418115 12:82419427-82419449 ATGAAATCAATCCAGAAAAAGGG - Intronic
1099427662 12:82544610-82544632 AAGAAGGAAATACAGAAAAAGGG - Intergenic
1099438138 12:82668184-82668206 AAGAAAGAAAGAAAGAAAAAAGG - Intergenic
1099503375 12:83442681-83442703 AATAAGTCAAGAAAGAAATCAGG - Intergenic
1099620256 12:84995143-84995165 AAGAAGGAAGGAAAGAAAAAGGG + Intergenic
1099971054 12:89501468-89501490 AAGAAATTCAGACAGAAATATGG + Intronic
1100018732 12:90044381-90044403 AAGTACTCAAGACCTAAAAATGG + Intergenic
1100636252 12:96437500-96437522 AAGAAAGAAAGAAAGAAAAATGG - Intergenic
1100650532 12:96583895-96583917 AAGAGGTAAAGACAGTGAAAGGG - Intronic
1100694625 12:97078492-97078514 ATGAATGCAAGACAGATAAATGG + Intergenic
1100727099 12:97420216-97420238 AAGAAGACATGACCTAAAAAAGG - Intergenic
1100737422 12:97552391-97552413 AAGAAATCAAGGCTTAAAAATGG + Intergenic
1100749750 12:97685522-97685544 AAGAAGGAAAGAGAGAGAAAGGG + Intergenic
1100758462 12:97778225-97778247 AAGATGTATGGACAGAAAAAGGG + Intergenic
1100774891 12:97963044-97963066 AAGGACTCAGGAGAGAAAAAGGG - Intergenic
1100780102 12:98015406-98015428 AAGAGGGGAAGAAAGAAAAAGGG + Intergenic
1100893555 12:99154237-99154259 AAGAAGCAAAGACAGACAAAAGG + Intronic
1101111801 12:101493692-101493714 AAGAACTGAAGGGAGAAAAAAGG - Intergenic
1101224262 12:102671964-102671986 AAGAAAGAAAGAAAGAAAAAAGG - Intergenic
1101282041 12:103268166-103268188 AAGAAGAGGAGACAGAGAAAAGG - Intronic
1101354168 12:103961188-103961210 AAAAATTAAAAACAGAAAAAAGG + Intronic
1101369896 12:104117290-104117312 ATGAAGTCAATACATAAAAAAGG + Exonic
1101516004 12:105435854-105435876 AACAAATTAAGACAGAAAATTGG - Intergenic
1102414158 12:112746124-112746146 AAGAAGGTAAGAAGGAAAAAGGG - Intronic
1102676481 12:114662966-114662988 AAGAGGTCAAAACAGAAAGAGGG - Intergenic
1102697637 12:114812583-114812605 AAGAAAGAAAGAAAGAAAAAAGG + Intergenic
1102752180 12:115304874-115304896 AAGAAGTCATTACATAAAGAGGG - Intergenic
1103031213 12:117614884-117614906 AAGATGTCAGGACAAAAAACAGG - Intronic
1103052534 12:117792678-117792700 CAGCAGTCAAGACAGGGAAAGGG - Intronic
1103413528 12:120729220-120729242 AAGCAGTCAAGGGAAAAAAATGG - Intronic
1103601373 12:122056807-122056829 AAAAAATAAATACAGAAAAAAGG + Intronic
1103858739 12:123994245-123994267 AGGAAGGCCAGACACAAAAAGGG - Intronic
1103982135 12:124743386-124743408 GAGAAGTCAGGAAAGAGAAAAGG + Intergenic
1104455519 12:128908511-128908533 AAGAAGGAAAGAAAGAAAGAAGG - Intronic
1104518681 12:129452695-129452717 AAGAAGAAAAGAAAGAAGAAAGG + Intronic
1105294822 13:19078602-19078624 TAGAAGGCAAGTCAAAAAAAGGG + Intergenic
1105891688 13:24686744-24686766 AAGAAGGAAAGAAAGAAAGAAGG + Intronic
1105893832 13:24701537-24701559 AAGAAAAAAAGAAAGAAAAAAGG + Intronic
1106175821 13:27330385-27330407 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
1106909773 13:34451207-34451229 CAGAAGTCAAGACATGAGAAGGG - Intergenic
1107353222 13:39537968-39537990 AAGAAAGAAAGAAAGAAAAATGG - Intronic
1107443150 13:40446275-40446297 AAGAAAGAAAGAAAGAAAAAAGG + Intergenic
1107455171 13:40548290-40548312 AATTATTGAAGACAGAAAAATGG + Intergenic
1107619789 13:42214845-42214867 AAGAAGTGAAGACAGATGGAAGG - Intronic
1107877032 13:44799966-44799988 AAGAAAACCAGTCAGAAAAAAGG + Intergenic
1108135074 13:47347656-47347678 ATGAAGTCAAAATAAAAAAATGG + Intergenic
1108528509 13:51306263-51306285 GAAAATTCAAGACAGGAAAAAGG + Intergenic
1108908396 13:55509110-55509132 AAGAAAGAAAGAAAGAAAAAAGG + Intergenic
1108928906 13:55789891-55789913 AAGAAAGAAAGAAAGAAAAAGGG - Intergenic
1108958035 13:56185680-56185702 AAGAAGTAAAGGAAAAAAAATGG + Intergenic
1109573893 13:64227826-64227848 AAGAAAGAAAGAAAGAAAAAAGG - Intergenic
1109598482 13:64591030-64591052 AGGAAGTCAAGAGACAAAATGGG + Intergenic
1109617455 13:64854121-64854143 AATAAGTGATGACAGAAAAATGG - Intergenic
1109952972 13:69525814-69525836 AGGAATACAAGAAAGAAAAAAGG + Intergenic
1110122477 13:71900210-71900232 GAGAAATCAAGACATTAAAATGG + Intergenic
1110428535 13:75397138-75397160 GAGAAGGCAAGAAAAAAAAATGG + Intronic
1110505058 13:76276099-76276121 AAGAAGTCATTATACAAAAAAGG + Intergenic
1110588616 13:77226209-77226231 AAGGAGTGAAAGCAGAAAAAAGG - Intronic
1110622826 13:77618177-77618199 AGGAAGGAAAGAAAGAAAAAAGG - Intronic
1110655997 13:78000243-78000265 AAGAAGTCACAAAAGAAAAAAGG - Intergenic
1110711136 13:78652495-78652517 AAAAATGCAAGACAAAAAAATGG + Intronic
1110971776 13:81772047-81772069 AAGCAGTGAAGACAGAGAAATGG - Intergenic
1111032414 13:82620809-82620831 AAGAATTGGAGACAGAAAACTGG - Intergenic
1111286588 13:86102023-86102045 AAGAAATAAAGAAAAAAAAAAGG - Intergenic
1111503246 13:89153358-89153380 ATGCAGTAGAGACAGAAAAAAGG - Intergenic
1111551080 13:89813739-89813761 AAGTTGACAAGAGAGAAAAATGG - Intergenic
1111937955 13:94576612-94576634 AAGAAGACAAGACACAGAGAGGG - Intronic
1111950851 13:94707953-94707975 GAGAAGGAAAGAAAGAAAAATGG + Intergenic
1111982088 13:95026905-95026927 AAGAAAGAAAGAAAGAAAAAAGG + Intronic
1112109479 13:96279682-96279704 AAGAAGGTAAGAAAGAAGAAAGG - Intronic
1112161313 13:96871159-96871181 GAGAACTCAAGATAAAAAAATGG - Intergenic
1112195336 13:97220395-97220417 CAGAAGACAAGACAGAATAAAGG + Intergenic
1112441930 13:99430825-99430847 ATGTAGTAAAGTCAGAAAAACGG - Intergenic
1112542189 13:100325767-100325789 ATGGAGTCAATCCAGAAAAAGGG - Intronic
1112797386 13:103071272-103071294 AAGAAGTCAGGAGAGAATAAAGG + Intergenic
1112797624 13:103073394-103073416 AACAAGGCAAGAAAGAAAAAGGG - Intergenic
1112831222 13:103454438-103454460 AAAAAGTCAGGATATAAAAAGGG - Intergenic
1113081975 13:106529685-106529707 AAGATGTAAAGGCAGATAAAGGG - Intronic
1113110190 13:106814404-106814426 AAGAAAGAAAGAAAGAAAAAGGG + Intergenic
1113199427 13:107849778-107849800 AAGAAGAAAAGAAAGAAAAAAGG - Intronic
1113318691 13:109211162-109211184 AAGATGTAAAGGAAGAAAAATGG - Intergenic
1113327933 13:109300852-109300874 AGGGAATCAAGAAAGAAAAAAGG - Intergenic
1113466516 13:110517276-110517298 AAGCAGCCACTACAGAAAAATGG - Intergenic
1114052182 14:18929913-18929935 AAGATATCAAGAGAGAAAAAAGG - Intergenic
1114054186 14:18952502-18952524 AAGATGGAAAGAAAGAAAAAAGG - Intergenic
1114108370 14:19449430-19449452 AAGATGGAAAGAAAGAAAAAAGG + Intergenic
1114110377 14:19472011-19472033 AAGATATCAAGAGAGAAAAAAGG + Intergenic
1114208400 14:20595120-20595142 AAGAAACGAAGAAAGAAAAAGGG + Intronic
1114468812 14:22944440-22944462 AAGCAGCGAAGACAGAGAAAAGG - Intergenic
1114504355 14:23197759-23197781 AAGAAGACAAGACATAGAAGGGG - Intronic
1114672659 14:24419912-24419934 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
1114935016 14:27524487-27524509 AAGCAGTCAACAGAGTAAAAAGG - Intergenic
1115160670 14:30390100-30390122 AGGAATTCAAGGCAGACAAAAGG + Intergenic
1115247176 14:31307674-31307696 AAGAAGCAGAGACAGAAAAGCGG + Intronic
1115472887 14:33786488-33786510 CAGAAGTGAAAACAGACAAAAGG - Intronic
1115481397 14:33864819-33864841 AATAGGTCAAAAAAGAAAAATGG + Intergenic
1115510969 14:34137559-34137581 AAGAAGGCAAGCCAGAGCAAGGG + Intronic
1115751330 14:36493970-36493992 GAGTAGTCAAGAAGGAAAAAAGG - Intronic
1115854611 14:37617222-37617244 AAGAAGTGAAGATAGAAAGTGGG + Intronic
1116044859 14:39732225-39732247 AAGAAGACAAAACAAGAAAATGG + Intergenic
1116325530 14:43529047-43529069 AAGAAGTCCAGATGGAAAAGAGG - Intergenic
1116494099 14:45539760-45539782 AAGAAAGAAAGAGAGAAAAAAGG - Intergenic
1116776365 14:49186103-49186125 AAGACAGCAAGAGAGAAAAAAGG - Intergenic
1117266447 14:54092853-54092875 TAGTAGGCAAGTCAGAAAAAAGG - Intergenic
1117833994 14:59783077-59783099 AAGAAAGCAAGACAGAAAAAAGG + Intronic
1118343138 14:64913147-64913169 AAGAAAGAAAGAAAGAAAAATGG - Intergenic
1118357857 14:65030083-65030105 AAGAAGTGATGACAGAAGACAGG - Intronic
1118495002 14:66299584-66299606 AAAAACTCAAAACAGACAAATGG + Intergenic
1118540443 14:66817805-66817827 AAAGAGTGAAGACAGAAGAATGG + Intronic
1118674046 14:68163496-68163518 AAGAAGTGAGGCCAAAAAAATGG - Intronic
1118854403 14:69610274-69610296 AAGAAGGCAAGGAAGAAAGAAGG + Intergenic
1119136841 14:72229049-72229071 AGGAAGGGAAGACAGAAACAAGG - Intronic
1119444987 14:74655610-74655632 CAGAACTCAAGAAAAAAAAAGGG + Intronic
1119792246 14:77362193-77362215 AAGCAGACAAGAAAAAAAAAAGG - Intronic
1120111338 14:80560949-80560971 AAGAAGTAAAGAGAGAAAAATGG + Intronic
1120393333 14:83936189-83936211 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
1120393336 14:83936230-83936252 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
1120913500 14:89689354-89689376 AAAAAAACAAGAAAGAAAAAAGG - Intergenic
1120917766 14:89724657-89724679 AAGAAGCCAACACAGGAAATAGG - Intergenic
1121051943 14:90825001-90825023 AAGAAAGAAAGAAAGAAAAAGGG - Intergenic
1121073251 14:91044371-91044393 AAGAAGGAAAGAAAGAAAGAAGG + Intronic
1121990608 14:98553314-98553336 AGGAAGGAAAGGCAGAAAAAAGG - Intergenic
1122184158 14:99977319-99977341 AGGAAATCAAGACAGGAGAAAGG - Intronic
1122293075 14:100689842-100689864 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
1122470237 14:101961382-101961404 AAGGAATCAAGACAGAAAGGGGG + Intergenic
1122670138 14:103365506-103365528 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
1202847145 14_GL000009v2_random:188750-188772 AAGAAATCAAAACAGACAAGTGG - Intergenic
1202916608 14_GL000194v1_random:179312-179334 AAGAAATCAAAACAGACAAGTGG - Intergenic
1202876169 14_KI270722v1_random:3749-3771 AAGAAATCAAAACAGACAAGTGG + Intergenic
1123509633 15:20984058-20984080 CAGAAGTCAAAATAGACAAATGG - Intergenic
1123566853 15:21557797-21557819 CAGAAGTCAAAATAGACAAATGG - Intergenic
1123603115 15:21995090-21995112 CAGAAGTCAAAATAGACAAATGG - Intergenic
1123874537 15:24610419-24610441 AAGAAAAGAAGATAGAAAAAGGG - Intergenic
1124068324 15:26367010-26367032 AAGAAGACAAGGCAAAAACAGGG - Intergenic
1124150312 15:27171987-27172009 AAGCACGAAAGACAGAAAAACGG + Intronic
1124321900 15:28719660-28719682 ATTAAGTCAAGACAGGAAGAAGG + Intronic
1124394843 15:29292363-29292385 AAGAAGGAAAGAAAGAAAGAAGG - Intronic
1124523000 15:30421498-30421520 ATTAAGTCAAGACAGGAAGAAGG + Intergenic
1124535664 15:30544718-30544740 ATTAAGTCAAGACAGGAAGAAGG - Intergenic
1124762988 15:32462878-32462900 ATTAAGTCAAGACAGGAAGAAGG + Intergenic
1124775639 15:32586176-32586198 ATTAAGTCAAGACAGGAAGAAGG - Intergenic
1125046819 15:35251168-35251190 AAGAAAGAAAGAAAGAAAAATGG - Intronic
1125052541 15:35317295-35317317 AAGAAGGAAAGAGAGAAAGAAGG + Intronic
1125150124 15:36521679-36521701 AAGAAAGAAAGAAAGAAAAAAGG + Intergenic
1125237006 15:37526467-37526489 AAGAAGGGAGGAAAGAAAAAAGG + Intergenic
1125368574 15:38945780-38945802 AGGAAGTTATGACAGAAAGAAGG - Intergenic
1126062573 15:44797458-44797480 TAAAAGACAAGACAGAAAAAGGG - Intergenic
1126130329 15:45334827-45334849 AAAAAGAAAAGAAAGAAAAAAGG + Intergenic
1126509119 15:49446919-49446941 AAGAAATCAGGAGAGATAAAAGG + Intronic
1126697194 15:51336347-51336369 AAGAATAAAAGAAAGAAAAAAGG + Intronic
1127003566 15:54539386-54539408 AAGAAGTAAAGAAAGAGAGAAGG + Intronic
1127597165 15:60497207-60497229 AAGAAGTCAAGACAGAAAAAGGG + Intronic
1127677182 15:61251605-61251627 ACACAGTCAAGAAAGAAAAAAGG + Intergenic
1127823516 15:62682613-62682635 AATAAGTTAATACAGAAAAAGGG + Intronic
1127867873 15:63046729-63046751 AAGAAGTAAAGACCTACAAAGGG - Intronic
1128371254 15:67041121-67041143 AAGAAAGAAAGAAAGAAAAAGGG + Intergenic
1128617089 15:69118652-69118674 GAGATGTCAAGACACAGAAAGGG + Intergenic
1129916480 15:79277991-79278013 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
1130042712 15:80418463-80418485 CAGAAGTCAGGACAGAAGAATGG - Intronic
1130634384 15:85603381-85603403 CAGATGTCAACACAGTAAAAAGG + Intronic
1130635466 15:85615323-85615345 AAGATTACAAGACAGTAAAAGGG - Intronic
1130712809 15:86300530-86300552 GAGAAGTCAAGAAACAACAAAGG + Intronic
1130759213 15:86800405-86800427 TAGAAGACAAGTGAGAAAAAAGG + Intronic
1130823750 15:87522191-87522213 AAGCAGGCAGGCCAGAAAAAAGG + Intergenic
1131096644 15:89659407-89659429 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
1131170086 15:90171762-90171784 AAGAAGAAAAGAAAGAAAAAAGG + Intronic
1131232123 15:90666950-90666972 AAGATGGAAAGACAGAAACAGGG - Intergenic
1131449331 15:92526031-92526053 AAGAAGGAAAGAAAGAAGAAAGG - Intergenic
1131563550 15:93464873-93464895 AAGAAGTGAGGCAAGAAAAAAGG + Intergenic
1131754914 15:95549334-95549356 CAGAAGTCATGACAGAGAAAAGG - Intergenic
1132169878 15:99639726-99639748 AGGCAGACAAGACAGAAAGAAGG - Intronic
1132596193 16:751420-751442 ATGAGGTCAAAACAGAAAAGAGG - Intronic
1132954482 16:2584282-2584304 CAGAAGTCAAACCAGAAAAATGG - Intronic
1132959863 16:2615881-2615903 CAGAAGTCAAACCAGAAAAATGG + Intergenic
1133244105 16:4435589-4435611 AAGAAGCCAAGACACACAAAAGG - Intronic
1133480903 16:6169566-6169588 AAGATGTATAGACAAAAAAAGGG + Intronic
1133513724 16:6485433-6485455 AAACAGTAAAGACAGAAAGATGG - Intronic
1133661252 16:7919938-7919960 AGGAAGGAAAGAAAGAAAAAAGG + Intergenic
1133710821 16:8399353-8399375 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
1133850784 16:9501326-9501348 AATAAGTGAAGAAAGAAAAGTGG + Intergenic
1133883304 16:9803420-9803442 AAAAAAACAAGAAAGAAAAATGG + Intronic
1133954665 16:10431536-10431558 AACCAGTATAGACAGAAAAAAGG + Intronic
1134087410 16:11367411-11367433 CAGAAGTCAACAGAGATAAAAGG - Intronic
1134264815 16:12683912-12683934 AGGAAGGCAAAACAGAAAGATGG - Intronic
1134472854 16:14542790-14542812 AAGAAACGAACACAGAAAAAAGG + Intronic
1134868843 16:17633182-17633204 GAGAAGGCAAGAAAAAAAAAAGG + Intergenic
1135128384 16:19830642-19830664 AGGAAGTCAGGACAGCAGAAAGG + Intronic
1135210305 16:20520265-20520287 AAAAAGGAAAGAAAGAAAAAAGG + Intergenic
1135278186 16:21131342-21131364 AAGAAAGCAAGAAAGAAACAGGG + Intronic
1135533674 16:23276186-23276208 AAGAAGTAAAGAAAGAAAGAAGG - Intergenic
1135692475 16:24552924-24552946 AAGATGTTAAGTCAAAAAAAGGG - Intronic
1135724995 16:24847291-24847313 AAGAAAGAAAGAAAGAAAAAAGG - Intronic
1135738784 16:24955870-24955892 AAGAGGTAAAGACTGAAGAAAGG + Intronic
1135964864 16:27027490-27027512 CAGCAGACAAGAGAGAAAAAGGG - Intergenic
1136180269 16:28546989-28547011 AAGAAAGAAAGAAAGAAAAACGG + Intergenic
1137452678 16:48591321-48591343 AAAAATTCAAGACAGGAAATCGG - Intronic
1137459544 16:48648072-48648094 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
1137667541 16:50260474-50260496 AGGAAGCCAAGACAGAGAAATGG - Intronic
1138479172 16:57290417-57290439 ATGATGTCACCACAGAAAAAGGG + Intergenic
1138584014 16:57958815-57958837 ACCAAGTCAAGAAAGAAAGATGG - Intronic
1138754724 16:59469621-59469643 AATAAGAAAAGAAAGAAAAAAGG - Intergenic
1138818255 16:60227568-60227590 AAGAAAGAAAGACAGAAAGAAGG - Intergenic
1138824074 16:60297650-60297672 AAGAAGTCAACGGAGAAAAGTGG - Intergenic
1139069694 16:63365041-63365063 AAGAAGAAAAGAAAAAAAAAAGG + Intergenic
1139258733 16:65570715-65570737 AACATGTCAAGACAATAAAATGG + Intergenic
1140307312 16:73815543-73815565 AAAAAGGAAAGACAGAAAATAGG - Intergenic
1140465293 16:75176432-75176454 AAGAAGGAAAGAGAGACAAAAGG + Intergenic
1140513295 16:75523911-75523933 AAGAAGGAAAGAAAGAAAAAAGG - Intergenic
1140530574 16:75662318-75662340 AAAAAGAAAAGAAAGAAAAAGGG - Intronic
1140684746 16:77422599-77422621 AAGAAGAAAGGAGAGAAAAAAGG + Intronic
1141186735 16:81793049-81793071 AATAAGACCAGAAAGAAAAAAGG + Intronic
1141373542 16:83508817-83508839 TAGAAGACAAGAGAGAATAATGG - Intronic
1141530142 16:84640689-84640711 AAGAAAGAAAGAAAGAAAAATGG - Intergenic
1141868132 16:86765089-86765111 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
1141899547 16:86982097-86982119 AAGAAAGAAAGAAAGAAAAAAGG + Intergenic
1142794516 17:2297025-2297047 AAGAAAGAAAGAAAGAAAAAAGG + Intronic
1143077667 17:4358439-4358461 AAAAAGTCAATTCAAAAAAATGG - Intronic
1143338704 17:6192617-6192639 AAGAAAGCAAGAAAGAAAGAAGG + Intergenic
1143434968 17:6917136-6917158 AAGAAGTCATTATACAAAAAAGG + Intronic
1143692055 17:8576867-8576889 AAGAAGTGATGACAGAAAAAGGG - Intronic
1145226917 17:21137278-21137300 AAAAAGACAAAAAAGAAAAATGG - Intronic
1145764091 17:27446124-27446146 AGGAAGGCAAGACAGAGGAAGGG + Intergenic
1146016688 17:29239374-29239396 AAGAAAGAAAGAAAGAAAAAAGG + Intergenic
1146114252 17:30120271-30120293 AAGAAATAAAAACAGAAAAATGG - Intronic
1146455447 17:33005941-33005963 AAGAAGAAAAGAAAGAAAGAAGG - Intergenic
1146942448 17:36853147-36853169 AAGAAAGAAAGAAAGAAAAAAGG + Intergenic
1147205205 17:38832464-38832486 AGGAAGGAAAGACAGAAGAAAGG - Intergenic
1147909353 17:43846110-43846132 AAAAAGGAAAGAAAGAAAAAAGG - Intergenic
1148262696 17:46197139-46197161 AGGAAGGAAAGAAAGAAAAAAGG + Intronic
1148388690 17:47254467-47254489 AAGAAAGAAAGAAAGAAAAAAGG - Intronic
1148686637 17:49504749-49504771 AAGAAAGAAAGAAAGAAAAAGGG - Intronic
1149416746 17:56467836-56467858 AAGAAAGAAAGAAAGAAAAAGGG + Intronic
1149527748 17:57369952-57369974 AAGAATAGAAGACAGAATAAAGG + Intronic
1149572088 17:57679175-57679197 CAGAAGTTTAAACAGAAAAAAGG + Intronic
1149886532 17:60345635-60345657 AAGAAATCAGGAGAGAAAAGAGG + Intronic
1149926185 17:60704469-60704491 ATGGAGTCAATCCAGAAAAAGGG - Intronic
1149958181 17:61077006-61077028 AAGAACTCAGGACAAAAATAAGG + Intronic
1150157517 17:62866514-62866536 AAGAAAGAAAGAAAGAAAAATGG - Intergenic
1152051516 17:77982506-77982528 AAAAAGACAAAAAAGAAAAAAGG + Intergenic
1152703769 17:81832773-81832795 AAGAGGGCAAGGCCGAAAAATGG + Intronic
1153000971 18:455103-455125 AAGAAGGCCAGAGAGAAACAAGG + Intronic
1153481160 18:5547621-5547643 AAGAATTCTAGCCAGAGAAAAGG + Intronic
1154086790 18:11313490-11313512 AAGAAGTAAACACATAAGAAAGG - Intergenic
1154259370 18:12816485-12816507 AAGAAGTAAAGACAGAAGTTAGG + Intronic
1154296318 18:13152870-13152892 AAGAAATCAAGAAAGAAATCTGG - Intergenic
1155011518 18:21783665-21783687 AAGAGGGCAAGAAAAAAAAAAGG - Intronic
1155081384 18:22413450-22413472 AAGAAGGAAAGAAAGAAAGAGGG + Intergenic
1155148947 18:23107180-23107202 AATATTACAAGACAGAAAAAAGG - Intergenic
1155418344 18:25626430-25626452 AAGAAGAACAGAGAGAAAAAAGG - Intergenic
1155545829 18:26913811-26913833 AATAAGTCAGGAGAGAAAAATGG + Exonic
1155584702 18:27351594-27351616 GAGAAGTCAAGACAGCAAAAAGG - Intergenic
1155641343 18:28019316-28019338 AAGAAATGAAGAAAGAAGAAAGG + Intronic
1155789445 18:29947127-29947149 AAGAAACCAATCCAGAAAAAAGG + Intergenic
1156357953 18:36359111-36359133 AAGAAATCAAGAGAAAAAAATGG - Intronic
1156787868 18:40937616-40937638 AGGAAGTGGAGACAGAGAAAGGG - Intergenic
1156798848 18:41083357-41083379 AAGAAGATGAGACAGAAAAGAGG + Intergenic
1156806575 18:41190000-41190022 AAGAAGAAAAGACAGAGAATAGG + Intergenic
1157115977 18:44863206-44863228 CAGGGGTCAAGACAGAGAAAAGG - Intronic
1157407583 18:47436061-47436083 AGGATGACAAGGCAGAAAAATGG - Intergenic
1157652905 18:49354144-49354166 AAGAAGCAAAGACAGTATAATGG + Intronic
1158085546 18:53647041-53647063 AAGAAATGAAGAAAGAAAAAGGG + Intergenic
1158379297 18:56911360-56911382 AAGATGTCCAGACTGAGAAACGG + Intronic
1158568209 18:58573912-58573934 AGGAATTCCAGACAGAAAGATGG + Intronic
1158715202 18:59872871-59872893 AAAAAGAAAAGAAAGAAAAAAGG - Intergenic
1158982007 18:62772322-62772344 AAGAAAACAGAACAGAAAAATGG - Intronic
1159015843 18:63101235-63101257 AAGAAGGCAGGAGAGAAAAGAGG + Intergenic
1159412397 18:68096399-68096421 AAGAAAGAAAGAAAGAAAAAAGG - Intergenic
1159412401 18:68096489-68096511 AAGAAAGAAAGAAAGAAAAAAGG - Intergenic
1159527914 18:69617709-69617731 AAGAAAGAAAGAAAGAAAAAAGG + Intronic
1159579910 18:70223796-70223818 CAGAAGGCAAGAGAGAAAAATGG - Intergenic
1159698466 18:71591657-71591679 AAAAAAGCAAGTCAGAAAAAAGG + Intergenic
1159918988 18:74210558-74210580 AGTAAGTCAAGAAACAAAAAGGG - Intergenic
1160268391 18:77361071-77361093 AATCAGTAAAGACAGAATAAAGG - Intergenic
1160354114 18:78212324-78212346 AATAAGGCAAGACAAAGAAAAGG - Intergenic
1160371902 18:78379427-78379449 AAAAAATGAGGACAGAAAAATGG - Intergenic
1160425415 18:78775576-78775598 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
1161604268 19:5205987-5206009 AAAAAGCCAAGAAAGAAAAAAGG + Exonic
1161904982 19:7149903-7149925 AAGAAGGAAAGAAAGAAAGAAGG + Intronic
1162024379 19:7885324-7885346 AAGAAGGAAAGAAAGAAGAAAGG + Intergenic
1162078096 19:8202338-8202360 AAGAAGGAAAGAAAGAAAACAGG + Intronic
1162144009 19:8602200-8602222 CAGCAGTACAGACAGAAAAAAGG - Intronic
1163053343 19:14701227-14701249 AAAAAGAAAAGAAAGAAAAAAGG - Intronic
1163178285 19:15581043-15581065 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
1163953535 19:20613080-20613102 AGGAAGTCAAGACAGTCAAGTGG + Intronic
1164567991 19:29342618-29342640 AAGGAGAGAAGAAAGAAAAAGGG + Intergenic
1164574858 19:29399949-29399971 AAGGAGGAAAGAAAGAAAAAGGG + Intergenic
1164895753 19:31876187-31876209 GGAAAGTCAAGACATAAAAAAGG + Intergenic
1165198447 19:34125818-34125840 AAAAAGGAAAGAAAGAAAAATGG + Intergenic
1165873000 19:38986410-38986432 AAGAAGGAAAGAGAGAAAGAAGG - Intergenic
1166377306 19:42334705-42334727 AAGGAGAAAAGACAGAAAGACGG - Intronic
1166572962 19:43810623-43810645 AAGAAAGAAAGAAAGAAAAACGG - Intronic
1166620252 19:44291181-44291203 AAGGAGTCAAGTCATACAAAGGG + Intronic
1166633219 19:44426080-44426102 AAGAAGGCAGGACTGAAAAATGG + Intronic
1166700810 19:44880458-44880480 AAAAAGGCAAGACAGGAAAAGGG - Intronic
1167032970 19:46975665-46975687 AAGCAGAGAAGACAGGAAAAGGG - Intronic
1167324682 19:48816775-48816797 AAGAAAGAAAGAAAGAAAAAGGG - Intronic
1167343263 19:48928974-48928996 AAGAAAGAAAGAAAGAAAAATGG - Intergenic
1167739186 19:51313601-51313623 AAGAAGGAAAGAAAGAAAGAAGG - Intronic
1168323183 19:55522481-55522503 AAAAAGTTAAGAAAAAAAAAAGG - Intergenic
1168495143 19:56841226-56841248 ACCAAACCAAGACAGAAAAATGG + Intergenic
1168504751 19:56923898-56923920 AGGAAGTGAAGAAAAAAAAAAGG - Intergenic
1168661493 19:58170914-58170936 AAGAAGGAAAGAGAGAAAGAAGG + Intergenic
1168709656 19:58491724-58491746 AGGAAGTCAAGACTGAAGAGAGG - Intronic
1202674493 1_KI270710v1_random:29065-29087 AAGAAATCAAAACAGACAAGTGG - Intergenic
925407974 2:3619258-3619280 AATTAGGCAAGAAAGAAAAAAGG - Intronic
925498418 2:4478559-4478581 AATAATTCAATAAAGAAAAAAGG + Intergenic
925693503 2:6549530-6549552 GAGAAGTAAAGGAAGAAAAAAGG - Intergenic
926173915 2:10572087-10572109 CTGAAGTCAAGACACAAAAGAGG - Exonic
926272043 2:11374029-11374051 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
926359201 2:12069326-12069348 AAAAAGGCAAGTCAGCAAAATGG - Intergenic
926606132 2:14900290-14900312 AATATTTGAAGACAGAAAAAAGG + Intergenic
926655487 2:15400067-15400089 AAAAAGTGAAGAAAGAAGAAAGG + Intronic
926668425 2:15550574-15550596 AAAAAGAAAAGACAGAAAGAAGG - Intronic
926865340 2:17350988-17351010 ACTATGTGAAGACAGAAAAATGG - Intergenic
927038832 2:19207426-19207448 AAGAAATCAAGACTTAGAAATGG + Intergenic
927157521 2:20229815-20229837 AAGAAAAAAAGAAAGAAAAAAGG + Intergenic
927395468 2:22645820-22645842 AAGAAATAAAGAAGGAAAAAGGG + Intergenic
927431257 2:23027991-23028013 ACAAAATCAAAACAGAAAAAGGG + Intergenic
927626234 2:24721969-24721991 AATAACTCAAGAAAGAAAAAAGG - Intronic
927734274 2:25504298-25504320 AAGAAGGAAAGAAAGAAAGAAGG + Intronic
927734276 2:25504314-25504336 AAGAAGGGAAGAAAGAAAGAAGG + Intronic
927879220 2:26678966-26678988 AAGAAGTCAGGAGGGAAAAGAGG + Intergenic
928339780 2:30432890-30432912 AAGAAAGAAAGAAAGAAAAAAGG - Intergenic
928395497 2:30940655-30940677 AGGTTGTCAAGACATAAAAATGG + Intronic
928551816 2:32379876-32379898 ACCAAATCAAGATAGAAAAATGG - Intronic
928554763 2:32412192-32412214 AAGAAGGCACAATAGAAAAAAGG + Intronic
928781545 2:34828031-34828053 AAGTAGTCAAGACATAGAAGTGG - Intergenic
928830388 2:35475777-35475799 AATAAGTAAACAGAGAAAAATGG + Intergenic
928836840 2:35557883-35557905 AAGATGTAAAAACAAAAAAAGGG - Intergenic
929020152 2:37545427-37545449 AAGAAGTAAAGGCAGTACAAGGG + Intergenic
929170699 2:38930337-38930359 AAAAAGAAAAGAAAGAAAAAAGG - Intronic
929212415 2:39372281-39372303 AAGAAGTCACCAAAAAAAAATGG + Intronic
929352825 2:40981047-40981069 AAGAAAGAAAGAAAGAAAAAGGG - Intergenic
929401579 2:41588474-41588496 AAGAAGTGAAGACAGTCAAATGG + Intergenic
929735917 2:44549095-44549117 AAGATTTGAAAACAGAAAAAGGG - Intronic
930310009 2:49728567-49728589 AAGAGGTCAAGACTACAAAATGG - Intergenic
930393263 2:50788055-50788077 AAGCAGGCAAGATAGAAAACTGG - Intronic
930697345 2:54425479-54425501 AAAAAGTCAAGGCAAAAAAAGGG + Intergenic
930863595 2:56100950-56100972 CAGAAGCCAAGACAGCAAAAGGG + Intergenic
930968005 2:57355543-57355565 AAGAAGGCAAGACAGTCAAAGGG + Intergenic
930998695 2:57755073-57755095 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
931097611 2:58959065-58959087 AGGAAGAAATGACAGAAAAAAGG - Intergenic
931268900 2:60684555-60684577 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
931731946 2:65161015-65161037 AAGGGGACAAGACAGAAACAAGG + Intergenic
931938211 2:67222093-67222115 AAGAAGTCAACATAGAAAAGAGG - Intergenic
932565526 2:72905389-72905411 AGGAAGGAAAGAAAGAAAAAAGG - Intergenic
932957162 2:76366057-76366079 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
933242978 2:79943409-79943431 AAGAAGTCCAGAGACAAACATGG + Intronic
933444251 2:82357375-82357397 AAATAGTCAACACAGACAAAGGG - Intergenic
933491548 2:82991343-82991365 AAGAATTAAAGAAAGGAAAAAGG - Intergenic
933529156 2:83484157-83484179 AAGAAGTAAAGAAGGAACAAAGG - Intergenic
933662272 2:84937507-84937529 AAAAAGTCAAGCCAGGAATAGGG + Intergenic
933884656 2:86706890-86706912 AAGAAATGAAAACAGAAAAAAGG + Intronic
934670708 2:96210481-96210503 ACGAAGACAAGACAGACAGAAGG - Intergenic
934940161 2:98495179-98495201 AAGAAATAATGACAGAAAAATGG + Intronic
935379358 2:102435303-102435325 AAGAAGTGGAAACAGAAAGAAGG + Intronic
935806420 2:106752938-106752960 AAGAAGGAAAGAAAGAAAAAAGG + Intergenic
936280785 2:111137988-111138010 AAGAAAGAAAGAAAGAAAAAAGG - Intronic
936694622 2:114931189-114931211 AACAAGCAAAGACAGAAAATTGG - Intronic
936702832 2:115034326-115034348 AAGGAGAGAAGAGAGAAAAAAGG - Intronic
936741200 2:115511618-115511640 AAGAAGTCAGGAAAAAAACAAGG - Intronic
936962467 2:118089604-118089626 AAGAATGAAAGACAGAAAACAGG - Intronic
937112887 2:119380249-119380271 AAGATGTTAAAAAAGAAAAAGGG - Intergenic
937503881 2:122514450-122514472 GAGACGTAAAGAAAGAAAAATGG + Intergenic
937550995 2:123091636-123091658 AACAAGTAAAGTCTGAAAAATGG - Intergenic
937682198 2:124655981-124656003 AAGAAAGAAAGAAAGAAAAAAGG + Intronic
937707205 2:124935081-124935103 TACAAGACAAGACAGAATAAAGG + Intergenic
937724598 2:125147052-125147074 CAGAAGGTAATACAGAAAAATGG - Intergenic
937728691 2:125199087-125199109 AACAATTGAAGGCAGAAAAATGG + Intergenic
937994924 2:127686072-127686094 AAGCAGGCAAGAAGGAAAAAGGG - Intergenic
938826881 2:135014366-135014388 AAGAAGAAAAGAAAAAAAAAAGG + Intronic
939087267 2:137736309-137736331 AAGATGGCAAGTCAGAAAGATGG - Intergenic
939087519 2:137739219-137739241 AAGATGGCAAGTCAGAAAGATGG - Intergenic
939174443 2:138733264-138733286 AAGAAATCAAGATAAACAAAAGG + Intronic
939253549 2:139714691-139714713 GAGAAGTGAAGAAAGAAAGAGGG + Intergenic
939289008 2:140169119-140169141 AAGAAAGAAAGAAAGAAAAAAGG + Intergenic
939362822 2:141195843-141195865 AAGAAAACAAGACGGAAAAATGG + Intronic
939508770 2:143081108-143081130 AAGATGTCCAGGCAGGAAAAAGG - Intergenic
939617093 2:144373888-144373910 ATGAAGTTAAGACAAACAAATGG - Intergenic
939869915 2:147515569-147515591 AAAAAGAAAAGAAAGAAAAAAGG - Intergenic
940094362 2:149957430-149957452 TAAAAGTCATGACACAAAAATGG + Intergenic
940945902 2:159616795-159616817 AAGAAGACAGGACAGAAAACGGG + Intergenic
941210612 2:162633664-162633686 AATAAGTTAACATAGAAAAAGGG - Intronic
941320790 2:164051643-164051665 GAGAAGTAAACACACAAAAATGG + Intergenic
941355874 2:164490382-164490404 AAGAACTCAAGATGGAAAACTGG + Intergenic
941408777 2:165126521-165126543 AAGAAGGAAATAAAGAAAAAAGG - Intronic
941452674 2:165678401-165678423 AAGTAGGGAATACAGAAAAAAGG + Intronic
941589156 2:167397265-167397287 TAGAAGGGAAGAAAGAAAAAAGG - Intergenic
941740199 2:169027897-169027919 AAGAATTGAAGAAAAAAAAAGGG + Intronic
941766171 2:169299065-169299087 AAGAAGGAAAGAAAGAAAGAAGG + Intronic
942216992 2:173731115-173731137 AAGAAATCAGGAAAGAATAAAGG + Intergenic
942261653 2:174171526-174171548 AAGAAGTCACAAGAGAAATAAGG + Intronic
942392325 2:175508565-175508587 CAAAAGTCAAAACAGACAAATGG + Intergenic
942589440 2:177525988-177526010 AAGCTGTCATTACAGAAAAAAGG + Intronic
942640568 2:178056993-178057015 AAGAGGACAAGACAAATAAATGG + Intronic
942777474 2:179600735-179600757 AAGTAGTTAAGACTGACAAATGG - Intronic
942836786 2:180309006-180309028 AAGAAGTCAAAAAGGATAAAGGG - Intergenic
943022559 2:182592785-182592807 AACAAGTCAAAAAAGGAAAAAGG + Intergenic
943260347 2:185652032-185652054 AAGAAGTGAAGAATGACAAAAGG + Intergenic
943337752 2:186639473-186639495 GAGAAGTCAAAACGGAACAAAGG - Intronic
943640226 2:190349544-190349566 CAAAATTCAAGGCAGAAAAAAGG - Intronic
943890323 2:193277659-193277681 AAAAAGAAAAGAAAGAAAAATGG - Intergenic
944143713 2:196483985-196484007 AAAAAGGCAAGACAGAGTAATGG + Intronic
944198917 2:197084603-197084625 AAGAAGTCAAGACCCAGAGAGGG - Intronic
944415723 2:199477797-199477819 AGGGAGACAGGACAGAAAAAGGG + Intergenic
944876679 2:203969269-203969291 AAGGAGTCAAGAGATAAACAAGG - Intergenic
944916480 2:204365743-204365765 AAGAAGCAAAAAGAGAAAAAAGG + Intergenic
944943979 2:204661576-204661598 AAGGAGTTAAGACAGCAAAGAGG - Intronic
945180028 2:207082367-207082389 ATGAAGTCAACAGAGAAAAAGGG + Intronic
945309015 2:208288680-208288702 AATAATTCAGGACAGTAAAAGGG - Intronic
945530316 2:210945208-210945230 GGGAAGGCAAGACAGCAAAAGGG + Intergenic
945611015 2:212003195-212003217 AAGAAAGAAAGACAGAAAGAAGG + Intronic
946072169 2:217043782-217043804 AAAAAATAAAAACAGAAAAATGG - Intergenic
946642110 2:221795022-221795044 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
947003935 2:225489171-225489193 AAGAAAGAAAGAAAGAAAAAGGG - Intronic
947029899 2:225782457-225782479 AGGAAGGGAAGACAGAGAAAGGG - Intergenic
947207212 2:227672830-227672852 AAGAAGTGAGGGCAGAAAAATGG - Intergenic
947216339 2:227753585-227753607 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
947217471 2:227762656-227762678 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
947305342 2:228740359-228740381 AAGAAAGAAAGAAAGAAAAAAGG - Intergenic
947370214 2:229438130-229438152 ATGAAGCAAAGACAGAAGAAGGG + Intronic
947452918 2:230224850-230224872 TAGAAATCCAGGCAGAAAAATGG - Intronic
947501468 2:230674388-230674410 TAGTAGCCAAGACAGAGAAAGGG + Intergenic
947628171 2:231634444-231634466 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
947689816 2:232124636-232124658 AAGAAGATGAGACAGAAAATGGG + Intronic
947725963 2:232400876-232400898 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
947871000 2:233437968-233437990 AAGAAGAGAAGACAGCAGAAAGG + Intronic
947916819 2:233838037-233838059 AAGAAGATAAGACGTAAAAACGG + Intronic
948096546 2:235338911-235338933 AAGAAGAAAAGAGAGAAAAGTGG + Intergenic
948108428 2:235434326-235434348 AAGAAAGAAAGAAAGAAAAAAGG - Intergenic
948287410 2:236796741-236796763 AAGAAGGAAAGATAGAAAGAAGG - Intergenic
948401090 2:237686031-237686053 AACAAGTCAAGACAGAGAAGGGG - Intronic
948412421 2:237774425-237774447 ATGAACTTAAGGCAGAAAAACGG + Intronic
948633263 2:239316070-239316092 CAAAAGCAAAGACAGAAAAACGG + Intronic
948724216 2:239921916-239921938 AGGAAGGAAGGACAGAAAAATGG - Intronic
949030176 2:241791981-241792003 AAGAAAAGAAAACAGAAAAATGG - Intronic
949061556 2:241961543-241961565 AAGTTCTCAAGACAGAAAACAGG - Intergenic
1168817258 20:747410-747432 AAGATGTCAAGGAAGAAAAGAGG + Intergenic
1168912689 20:1462367-1462389 AAGAACTGAAGACAAGAAAAAGG - Intronic
1168961636 20:1874181-1874203 CAAAAGCCAAGACAGAGAAAAGG - Intergenic
1169108390 20:3016833-3016855 AAGAAGCCAATAGATAAAAATGG - Intronic
1169373003 20:5043111-5043133 AATAAGTCCTGAGAGAAAAAGGG - Intergenic
1169401545 20:5285115-5285137 AGAAAGTCAACAAAGAAAAATGG + Intergenic
1169410666 20:5367012-5367034 AAGAAGGAAAGAAAGACAAAAGG + Intergenic
1169757754 20:9061693-9061715 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
1169810121 20:9601339-9601361 AAGAGGTCAGGAGACAAAAAGGG + Intronic
1170079220 20:12452872-12452894 AAGAAGTGAAATCATAAAAAAGG + Intergenic
1170371130 20:15649190-15649212 AAGAAGGAAAGAAAGAAGAAAGG - Intronic
1170839591 20:19913385-19913407 CAGAAGTCAAGGCAGGAAGATGG - Intronic
1170907954 20:20533047-20533069 AAGAAAGAAAGAAAGAAAAATGG + Intronic
1170917296 20:20639549-20639571 AAGGAGTAAAGAGAGAAAAATGG + Intronic
1171375069 20:24687032-24687054 AAGAAGTCATTATACAAAAAAGG - Intergenic
1172319317 20:33983916-33983938 AAGAAAGAAAGAAAGAAAAAAGG + Intergenic
1172324237 20:34022070-34022092 AAGAAAGAAAGAAAGAAAAAAGG - Intronic
1172500682 20:35424525-35424547 AAGAAGTCAAGTAAGTCAAATGG - Intergenic
1172620824 20:36317219-36317241 AAGAAAGAAAGAAAGAAAAAAGG - Intronic
1172988874 20:39016960-39016982 AAAAAGCCAAAACACAAAAATGG - Intronic
1173476956 20:43366301-43366323 AAGAAGGAAAGACAGAAAGAAGG + Intergenic
1173491921 20:43489579-43489601 CAGAAGTCATGATAGAAAACTGG - Intergenic
1173508055 20:43604670-43604692 AAAAAGGCAAGAAAGAAGAAAGG - Intronic
1173527995 20:43747528-43747550 AAGAAAGAAAGACAGAAAAGAGG - Intergenic
1173529202 20:43755684-43755706 AAGAAGTGAAGAAAGATTAAAGG - Intergenic
1173778593 20:45734342-45734364 AATTAGTCAAGAGGGAAAAAAGG + Intergenic
1174099968 20:48119724-48119746 AAGAAGTCAAAGCAGCAAGATGG + Intergenic
1174368565 20:50071209-50071231 AAGAAAGAAAGAAAGAAAAAGGG + Intergenic
1174479317 20:50819802-50819824 AAGACGGAAAGACAGAAAGACGG - Intronic
1174501751 20:50990149-50990171 AAGAAAGGAAGAAAGAAAAAAGG - Intergenic
1174792679 20:53495354-53495376 AAGATGGCAAGAGAGGAAAAAGG + Intergenic
1174899292 20:54481520-54481542 AATAAGTCTAGGGAGAAAAAGGG - Intronic
1174998935 20:55604605-55604627 AAGAAGGCAAGAGAGAAGGAAGG - Intergenic
1175114876 20:56674960-56674982 AAAAAGAAAAGAAAGAAAAAGGG + Intergenic
1175321194 20:58089552-58089574 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
1175504934 20:59475426-59475448 AAGATTTATAGACAGAAAAAGGG + Intergenic
1176314241 21:5227228-5227250 AAGAAAGAAAGAAAGAAAAAAGG - Intergenic
1176635963 21:9193959-9193981 AAGAAATCAAAACAGACAAGTGG - Intergenic
1176637446 21:9261122-9261144 AAGAAATCAAAACAGACAAGTGG + Intergenic
1177017357 21:15808962-15808984 AAGAAATCAAGACAGACTTATGG + Intronic
1177070740 21:16503591-16503613 AAGAAAGAAAGAAAGAAAAAAGG + Intergenic
1177277695 21:18935484-18935506 AACATTTCAAGACAAAAAAATGG - Intergenic
1177454768 21:21322468-21322490 AAGAAGTAAAGAGAAAAAAAGGG + Intronic
1177467075 21:21499093-21499115 AAGAAGTGAAGAAATAAAAAAGG + Intronic
1177618049 21:23550296-23550318 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
1177635797 21:23785099-23785121 AGGAAGGAAAGAAAGAAAAAGGG + Intergenic
1177635828 21:23785251-23785273 AGGAAGGAAAGAAAGAAAAAGGG + Intergenic
1177707507 21:24726481-24726503 AAGAAAATAAGACAGAACAAAGG + Intergenic
1177731429 21:25031768-25031790 AAGAGGTCATGAAAGATAAAGGG - Intergenic
1177742804 21:25174269-25174291 AAGAATTACAGACAAAAAAAGGG - Intergenic
1177806146 21:25876949-25876971 AACAGGTTAAGAAAGAAAAAAGG + Intergenic
1177824980 21:26072866-26072888 AATAAGCCAACAGAGAAAAATGG + Intronic
1177863836 21:26488702-26488724 AGGAAGGTAAGACAGAAAATGGG - Intronic
1178059034 21:28831561-28831583 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
1178576083 21:33792907-33792929 AAGAAGGGAAGAAGGAAAAAAGG - Intronic
1178611333 21:34084027-34084049 AAGAAATAAAAACAGAAACATGG - Intronic
1178737406 21:35165551-35165573 AATCAGTCATGACAGACAAATGG + Intronic
1179107231 21:38412964-38412986 GAGAAATTAATACAGAAAAATGG - Intronic
1179142674 21:38740806-38740828 AAGAAGAAAAGAAAGAAAGAAGG - Intergenic
1179383753 21:40923112-40923134 GAGATGTCAGGAGAGAAAAACGG - Intergenic
1179432932 21:41337138-41337160 AAGAAGTATAGTCAGCAAAATGG - Intronic
1180246209 21:46549307-46549329 GAAAAGGCAACACAGAAAAAAGG + Intronic
1180421483 22:12868619-12868641 AAGAAATCAAAACAGACAAGTGG + Intergenic
1180470654 22:15652286-15652308 AAGATATCAAGAGAGAAAAAAGG - Intergenic
1180472657 22:15674881-15674903 AAGATGGAAAGAAAGAAAAAAGG - Intergenic
1181165462 22:20980720-20980742 ACGAAGGCAAGAGAGAGAAACGG - Intronic
1181356610 22:22300334-22300356 AAAAAATCAAAACAAAAAAATGG - Intergenic
1181659382 22:24331709-24331731 TAGAAGTCAACACAGTGAAAAGG - Intronic
1181825232 22:25509629-25509651 ATGAAGCCAACACAGGAAAATGG + Intergenic
1181860869 22:25817196-25817218 AAGAAAGAAAGAAAGAAAAAGGG - Intronic
1182037345 22:27209764-27209786 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
1182284307 22:29235522-29235544 AAGAAGACAAGAAAAGAAAAGGG - Intronic
1182735090 22:32527738-32527760 AAAAAGTCAAGAAAGGAGAAGGG - Intronic
1182773602 22:32814243-32814265 AAGAAGGAAAGAAAGAAAGAGGG + Intronic
1182830194 22:33298887-33298909 AAGATGGAAAGAAAGAAAAAAGG + Intronic
1183170540 22:36184540-36184562 AAGAAGCCAAGACAGTGACACGG + Intergenic
1183260020 22:36788576-36788598 AAGAAAGAAAGAAAGAAAAAAGG - Intergenic
1183673342 22:39285914-39285936 AAGAAAGAAAGAAAGAAAAAAGG - Intergenic
1184155865 22:42666579-42666601 AAGAAGGAAAGAAGGAAAAAAGG + Intergenic
1184442384 22:44525216-44525238 CAAAAGTCAAGGAAGAAAAAGGG + Intergenic
1184623576 22:45703497-45703519 AAGAAGTGGAGAGAGAACAAGGG - Intronic
1184986239 22:48137492-48137514 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
1185230779 22:49679686-49679708 GAGAAGTTAAAACAGAGAAATGG + Intergenic
1203237704 22_KI270732v1_random:21864-21886 AAGAACACAAGAAAGAAAGAAGG + Intergenic
949109368 3:240068-240090 AAGAAGTCATTACACAGAAAAGG - Intronic
949148975 3:741652-741674 AAGAAACGAAGACTGAAAAATGG + Intergenic
949584787 3:5426854-5426876 AAGAAGAAACGAGAGAAAAAAGG - Intergenic
949652088 3:6171421-6171443 AAGCAGTGAAGCAAGAAAAAAGG - Intergenic
949726520 3:7053413-7053435 AAGAATAAAAGACAGAAACAGGG - Intronic
949745498 3:7287263-7287285 CAGAAGTCAAGTCACAAAAGGGG - Intronic
950282881 3:11721703-11721725 AATATGGTAAGACAGAAAAAGGG + Intergenic
950398605 3:12753187-12753209 AAGAAAGAAAGAAAGAAAAAAGG - Intronic
950539578 3:13602894-13602916 AAGAAAGAAAGAAAGAAAAAAGG - Intronic
950565266 3:13765921-13765943 AAAAAGTGAGGAGAGAAAAAAGG - Intergenic
950606438 3:14085179-14085201 AAGAAAGAAAGAAAGAAAAAAGG + Intergenic
951177930 3:19623557-19623579 AAGAACTGAAGACAGACACAAGG - Intergenic
951930010 3:27954946-27954968 AAGAACTAAAGACAGCAGAAGGG + Intergenic
952032449 3:29160249-29160271 AAGAAGGCAAGAAAGAAAAAAGG - Intergenic
952039676 3:29247064-29247086 AAGAAGACATGACAGAAGTATGG + Intergenic
952196830 3:31084667-31084689 GAGATGTGAAGACAGAAATAAGG + Intergenic
952525391 3:34205081-34205103 TAGAAGACAAGACAGAAAAAGGG + Intergenic
953128513 3:40114596-40114618 AACAAGCCAAGAAAGAAAAAAGG + Intronic
953173858 3:40531527-40531549 GAGAAGTAAAGACACAGAAATGG - Intronic
953313626 3:41905548-41905570 AAAAAGACAATCCAGAAAAAGGG + Intronic
953429735 3:42829407-42829429 AAGAAGTGAAGGGAGAAAATGGG + Intronic
953657941 3:44868574-44868596 GAGAAGGCAAGCCAGGAAAAGGG + Intronic
954210055 3:49091333-49091355 AAGCAGACAAGAAAGAAATATGG + Intronic
954650611 3:52159720-52159742 AAGAAATGAAGAAAGAAAGAAGG - Intergenic
954722554 3:52577790-52577812 AAAAAGTCAAGGCAGAAGCAAGG - Intronic
954773388 3:52995025-52995047 AAGAAAGCAAGAAAAAAAAAAGG + Intronic
954837798 3:53485370-53485392 AAAAAGATAAAACAGAAAAATGG + Intergenic
954958769 3:54546211-54546233 AAGAAATAAAGACAGAAACCAGG + Intronic
955105458 3:55893423-55893445 AAGAGGTCAAGTGAGGAAAAAGG - Intronic
955118657 3:56032443-56032465 AAGAAGTAGAGAAAGAGAAAGGG + Intronic
955150160 3:56359247-56359269 AAGAAGTAGAGAAAGGAAAAAGG - Intronic
955526200 3:59822271-59822293 AAGAAGTCATTATACAAAAAAGG - Intronic
955772898 3:62404443-62404465 AAGAAATTAAGTCAGAAACAAGG - Intronic
955805055 3:62725051-62725073 AAGAAGCAAAGGCAGAAAACTGG - Intronic
956678326 3:71754870-71754892 AAGAATTCAAGACGGAGAAGAGG + Exonic
956692170 3:71888610-71888632 AACAAGTCATGACAGTAACATGG - Intergenic
956980140 3:74626928-74626950 AAGCAGTAAAGAGAGAAATAAGG - Intergenic
957007978 3:74972342-74972364 AAGATGTCAAGAATAAAAAAAGG + Intergenic
957123234 3:76123895-76123917 AAAAAAGCAAGAAAGAAAAAGGG - Intronic
957124984 3:76147684-76147706 AAGCAGCCAAGACAGGAAATGGG + Intronic
957231991 3:77531530-77531552 AAGAAGTCCAAAAAAAAAAATGG + Intronic
957305652 3:78455627-78455649 AAGAAGGGAAGAGGGAAAAATGG - Intergenic
957392806 3:79599707-79599729 CAAATGTAAAGACAGAAAAACGG + Intronic
957431752 3:80119176-80119198 AAAAAGAAAAGAAAGAAAAACGG - Intergenic
957511925 3:81200684-81200706 AAAAAATAAAGAAAGAAAAAAGG - Intergenic
957550345 3:81696120-81696142 AAGAATACAAGACAGTAATAGGG + Intronic
957722484 3:84021305-84021327 AGGAAGCCAGGACAGACAAAAGG - Intergenic
957801484 3:85089337-85089359 AAATATTCAAGAGAGAAAAATGG - Intronic
957834423 3:85568574-85568596 AAGAAGGAAAGAAAGAAAGAAGG - Intronic
957973362 3:87411378-87411400 AAAAACTCAAAACAGAAAAATGG + Intergenic
958557484 3:95699074-95699096 AAGAAATCAATACAATAAAATGG - Intergenic
959154061 3:102644791-102644813 AGGAATTCAAGAGAGAAATATGG - Intergenic
959327883 3:104960838-104960860 AAGAGGTTATGACAGGAAAAAGG - Intergenic
959351225 3:105267022-105267044 ATGAAATTAAGAGAGAAAAAGGG + Intergenic
959547806 3:107617872-107617894 AATAAGTCAAGGAAAAAAAAAGG - Intronic
959674277 3:109016874-109016896 AAAAAGAAAAGAAAGAAAAAAGG + Intronic
959771171 3:110098445-110098467 AAGAGGTTAGGAGAGAAAAAGGG - Intergenic
959813837 3:110652329-110652351 AAGAAAGGAAGACAGGAAAAAGG - Intergenic
960061515 3:113327495-113327517 AAGAAGACAAGAAAGAGATAAGG + Intronic
960094108 3:113671726-113671748 AAGGAGAAAAGAAAGAAAAAAGG - Intronic
960172435 3:114477878-114477900 AAGAAAGAAAGAAAGAAAAAAGG - Intronic
960228317 3:115193403-115193425 AAGAACTTAAGAAAGAAAATTGG + Intergenic
960281478 3:115785225-115785247 ATTAAAACAAGACAGAAAAACGG - Intergenic
960335456 3:116411930-116411952 AAGCATACAAGACAGAGAAATGG - Intronic
960498232 3:118402629-118402651 AAGAAATGAAGACATAAAAGAGG + Intergenic
960575008 3:119220681-119220703 AAGAAGACAAGTCAGCAAGAAGG + Intronic
960632489 3:119746548-119746570 GAGAAATGAAGAGAGAAAAAAGG + Intronic
961609741 3:128127131-128127153 ATGAAGCCAAGACAGAGGAAAGG + Intronic
961777117 3:129296007-129296029 AAGAAAAAAAGAAAGAAAAATGG - Intronic
961817924 3:129560775-129560797 CAGAAATGAAGACAGAAAGATGG + Intronic
961837945 3:129679646-129679668 ATGAAGTCAAGAAAGAAAATAGG - Intronic
961916531 3:130381005-130381027 CAGAAATCAAGAAAGACAAAAGG + Intronic
961947843 3:130712780-130712802 AAGAAGTGAAGGTAGAGAAAAGG + Intronic
962291064 3:134136747-134136769 AAGAAATAAAAGCAGAAAAAGGG + Intronic
962361659 3:134748213-134748235 GTGAAGGCAAGACAGAAAAAAGG - Intronic
962547952 3:136456554-136456576 AAGGAGACGAGAGAGAAAAAGGG + Intronic
962564441 3:136642977-136642999 AAGAAGAGAAGACAGACACAGGG - Intronic
962707442 3:138058645-138058667 AAGAAGGGAAGACAGGAAAGAGG + Intergenic
962945033 3:140160639-140160661 AATAAGACAAGAAAGAAACAAGG - Intronic
963076675 3:141353578-141353600 AAGAAGGAAAGAGAGAACAATGG + Intronic
963146942 3:142003632-142003654 AAGAACTCAGAACTGAAAAAAGG + Intronic
963357884 3:144232956-144232978 AAGAAAGGAAGAAAGAAAAAAGG + Intergenic
963413485 3:144962581-144962603 AGGAAGTAAAGCCAGAGAAATGG - Intergenic
963772840 3:149406497-149406519 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
963783550 3:149510627-149510649 AAGAAGGAAAGAAAGAAAGAGGG - Intergenic
963974734 3:151467905-151467927 AAGAAAAAAAGAAAGAAAAATGG + Intergenic
964251223 3:154719679-154719701 AGGAAGGAAAGAGAGAAAAAAGG + Intergenic
964497520 3:157309054-157309076 TAGAACACAAGACAGAAATAAGG - Intronic
964506526 3:157405804-157405826 AAGATGTAAAGACAGATAATTGG - Intronic
964579956 3:158222700-158222722 AAGAAGTAAATACAGCAAAGTGG - Intronic
964714184 3:159704860-159704882 AAGAAAGAAAGAAAGAAAAAAGG - Intronic
964809262 3:160645111-160645133 AAGAATTCTGCACAGAAAAAGGG - Intergenic
965188460 3:165498129-165498151 AAGAAAGAAAGAAAGAAAAAAGG + Intergenic
965391957 3:168115669-168115691 AAGGAGCCAAGATAGGAAAATGG + Intergenic
965492596 3:169357806-169357828 AGAAAATAAAGACAGAAAAAGGG + Intronic
965667991 3:171116484-171116506 AAAAAGTCAAAACAGAAAATTGG + Intronic
965671026 3:171147942-171147964 AACAAGTAAAGATAGAAAGAGGG - Intronic
965698013 3:171429399-171429421 CAGAAGTTAAGAGAGAAGAAGGG + Intronic
966077473 3:175955294-175955316 AAAATGTCAAGAGAGAAATATGG - Intergenic
966147245 3:176826058-176826080 AAGAGGTCCAGAGAGAAAAACGG + Intergenic
966250670 3:177861565-177861587 AAGATGGCAAGAGAGGAAAAGGG - Intergenic
966332687 3:178832624-178832646 AAGAAGTAAAGAGAGACAAAAGG - Intronic
966483047 3:180432876-180432898 AAAAAGTAAAAACAGAAGAAGGG + Intergenic
966577345 3:181517557-181517579 AAGAAGTAAAGAGATGAAAAGGG + Intergenic
966683472 3:182668359-182668381 AAGAAAGAAAGAAAGAAAAAAGG + Intergenic
966763987 3:183442306-183442328 GAGAAATCAGGAGAGAAAAAGGG - Intergenic
966967594 3:185010699-185010721 AAGAAGACTAAACAGAAACAGGG + Intronic
967049413 3:185769029-185769051 AACAAATCAAAACAAAAAAAAGG + Intronic
967290258 3:187912916-187912938 AAGAGGGCAAGAGAGAAAACAGG + Intergenic
967372492 3:188762765-188762787 AAGAAGTAAAAAAAAAAAAATGG - Intronic
967414951 3:189206043-189206065 AAGAAAGAAAGACAGAAGAAAGG - Intronic
967591197 3:191275777-191275799 AAGAAAGGAAGAGAGAAAAAGGG + Intronic
967747537 3:193074641-193074663 AATAAGGCAAGAAAGAAAAAAGG + Intergenic
967803726 3:193693645-193693667 AAAAAGTGAAGACAGATATATGG + Intronic
967992064 3:195138880-195138902 AAGAAAGAAAGAAAGAAAAATGG + Intronic
1202749449 3_GL000221v1_random:143898-143920 AAGAAATCAAAACAGACAAGTGG - Intergenic
969424158 4:7114195-7114217 AAAAAATGAAGTCAGAAAAATGG + Intergenic
969579188 4:8054187-8054209 CAGAACTGAAGACAGAAACAAGG - Exonic
969975084 4:11090920-11090942 AAGTTGACAAGACAGAAAAATGG + Intergenic
970006092 4:11412230-11412252 TGGAAGTCAAGACAGAACCAGGG - Intronic
970111900 4:12647048-12647070 AAAAAGTAAAGAGCGAAAAAAGG - Intergenic
970582779 4:17488560-17488582 AAGAAGACAGGAATGAAAAAGGG + Intronic
970734528 4:19150527-19150549 AAGAAAACAAGAAAGAAAATCGG - Intergenic
970777174 4:19689173-19689195 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
971148826 4:24009306-24009328 AAGGAGGCAAGAAAGAAAGATGG + Intergenic
971215508 4:24658767-24658789 AAGAAAGAAAGAAAGAAAAAAGG - Intergenic
971270545 4:25140455-25140477 TAGAAGTTAAGACAGAGAATAGG + Intronic
971275741 4:25194893-25194915 AAGCAGGCAAGACAGGAAACAGG + Intronic
971302328 4:25451813-25451835 AAGAAAGGAAGACAGAGAAAAGG + Intergenic
971638235 4:29092514-29092536 TAGAAGTTAAAACAAAAAAATGG + Intergenic
971814285 4:31466670-31466692 ACAAAGACAAGACAGACAAAAGG + Intergenic
971848702 4:31955077-31955099 AAGAAGCAAAGAAAGAAAGAAGG + Intergenic
971907366 4:32743857-32743879 AAGAAACCAAGACAGGAAAGAGG - Intergenic
971931129 4:33084673-33084695 CAGAAGACATGACAGGAAAAGGG + Intergenic
971932433 4:33102161-33102183 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
972128073 4:35794593-35794615 AAGACAGCAAGAGAGAAAAAAGG + Intergenic
972456964 4:39264269-39264291 AATAAGCCAGGACAGAGAAATGG - Intronic
972619175 4:40730399-40730421 AAGAAGTTAAGAAAGAGAAAAGG + Intergenic
972812325 4:42604008-42604030 AAGAAGTGATGACAGGAAAGAGG - Intronic
972974538 4:44617604-44617626 AACCAGTAAAGACAGAAAAATGG + Intergenic
973569757 4:52226058-52226080 AAGAAGTCTAGACAAGCAAAGGG + Intergenic
973603442 4:52563706-52563728 AAGAAAGAAAGAAAGAAAAAGGG + Intergenic
973740949 4:53919023-53919045 AAGAAATGAAGGAAGAAAAAAGG - Intronic
974099582 4:57402066-57402088 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
974222348 4:58991836-58991858 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
974287446 4:59886955-59886977 AAGAAGACAAGAAGTAAAAAAGG - Intergenic
974330819 4:60475978-60476000 AAGAAGTCTAATAAGAAAAAAGG + Intergenic
974410933 4:61539879-61539901 AAGAAGTCAGGGCACAGAAAAGG - Intronic
974568806 4:63616093-63616115 AATAATCCAAGAGAGAAAAAAGG - Intergenic
974834198 4:67227652-67227674 AAAAAGTCAAAACAAAAAACAGG + Intergenic
974860427 4:67514131-67514153 AAGAAATTCAGACAGAAATATGG - Exonic
974863918 4:67556851-67556873 AACAGCTCAAGACAGAAATAGGG - Intergenic
974865519 4:67576108-67576130 AAGAAACAAAGACACAAAAAGGG - Intronic
974939451 4:68447535-68447557 AAGACTTCTAGAAAGAAAAAGGG - Intronic
975021808 4:69500486-69500508 AAGAAAGCAAGAAAGAAAGAAGG + Intronic
975315569 4:72948707-72948729 AAGAAGTCAAGAGTCAAAAACGG - Intergenic
975376331 4:73650610-73650632 GAGAAGTCAAGAATGAAGAAGGG - Intergenic
975549641 4:75599174-75599196 AAAAAGGCAAGACAGACAAATGG + Intronic
975623058 4:76313986-76314008 AAGAAAGAAAGAAAGAAAAAAGG - Intronic
975631260 4:76404870-76404892 AAGAAAAGAAGACAAAAAAAAGG + Intronic
975687909 4:76935976-76935998 AATAAGTCAACTTAGAAAAACGG - Intergenic
975819352 4:78253975-78253997 AATAAGTAAAGACAAATAAAAGG - Intronic
976259536 4:83132689-83132711 AAGAAGTCAAGAAAGAAGAGGGG + Intronic
976283869 4:83352000-83352022 AAGAAGACTAGAAAGAAAAAAGG - Intergenic
976709257 4:88051594-88051616 ATGAAGGCAAGAAAGCAAAAGGG + Intronic
976913149 4:90334056-90334078 AAGAATACAAAACAGAAAGAAGG - Intronic
977202788 4:94136658-94136680 AAGAAATCAAAAGAAAAAAAAGG + Intergenic
977370883 4:96133868-96133890 AAGAAGTCTAGACAGACAGTAGG + Intergenic
977446751 4:97140197-97140219 ACAAAGTAAATACAGAAAAATGG + Intergenic
977545993 4:98378400-98378422 AACAAATCAAGAATGAAAAAAGG + Intronic
977565120 4:98572718-98572740 AGGAAGTCAAGAAGGTAAAAGGG - Intronic
977718621 4:100212322-100212344 AAGAAGAGAAGAAAGAAACAGGG - Intergenic
977757237 4:100687199-100687221 AATTAGGCAAGAAAGAAAAAAGG - Intronic
978098624 4:104809678-104809700 AAGAAATAAAAACAAAAAAATGG + Intergenic
978104689 4:104887264-104887286 ACTAAGGCAAGACAGGAAAATGG + Intergenic
978121189 4:105081095-105081117 AAGAAGTCAAAATTGACAAATGG - Intergenic
978393566 4:108253374-108253396 AAGACGTCAAGTCAGAAAGAAGG - Intergenic
978710691 4:111777029-111777051 ATGAAGGCAGGACAGAAGAAAGG - Intergenic
979064379 4:116109882-116109904 AAGAAGTAAAGACATCTAAATGG + Intergenic
979364154 4:119800687-119800709 AAGAAGCCAAGAAAGAGACAAGG - Intergenic
979824014 4:125210643-125210665 AGAAAGGCAAGAGAGAAAAAAGG + Intergenic
979840249 4:125430340-125430362 ATGAAATCAAGGGAGAAAAATGG - Intronic
979880900 4:125958803-125958825 AAGTACTCAAGACAGGAAGAAGG - Intergenic
979950265 4:126884004-126884026 AAAAATGCAAGACTGAAAAATGG + Intergenic
980332363 4:131426299-131426321 AGGAAGGAAAGAGAGAAAAAAGG + Intergenic
980413550 4:132455642-132455664 AAGAAGTTAAGAAAGAAAATGGG + Intergenic
980470722 4:133248189-133248211 TAGAAGTAAAGGGAGAAAAATGG - Intergenic
980531508 4:134061851-134061873 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
980554964 4:134391812-134391834 AAGAAGTGAAGACACAGAAAAGG + Intergenic
980686978 4:136241206-136241228 AAAAAGCCCAGACAGTAAAAAGG + Intergenic
980733688 4:136854778-136854800 AAAAAGTAGAGAGAGAAAAATGG - Intergenic
980868718 4:138585631-138585653 CAGTAGAAAAGACAGAAAAAGGG + Intergenic
980927419 4:139151869-139151891 AAGCAGTTAAATCAGAAAAAAGG - Intronic
980976421 4:139615097-139615119 AATAAGTGAAGAAAGAAGAAAGG + Intergenic
981588780 4:146333530-146333552 AAGGAGTCAGAACAGAAGAAGGG + Intronic
981704213 4:147641962-147641984 AAGGAGTCAAGACTTAGAAATGG - Intronic
981826134 4:148943577-148943599 AAGAAGTAAAGATAGATAGATGG + Intergenic
981837212 4:149067999-149068021 AGGAAGTCAAAAAAGAAACATGG + Intergenic
982257431 4:153464815-153464837 GAGAAGTGAAGAGAAAAAAAGGG + Intergenic
982567581 4:157005449-157005471 AAGAAGCCAAAGCAGAAATAAGG + Intergenic
982583127 4:157204353-157204375 AAGAAGTGAAGACACTAAAGGGG + Intronic
982633469 4:157863361-157863383 AAGAAAGAAAGACAGAAAGACGG - Intergenic
982719505 4:158845398-158845420 AAAAAGACAAGACAGCAACATGG - Intronic
982773378 4:159418676-159418698 AAGAAGTCAGTTCAGAACAATGG - Intergenic
982800447 4:159699061-159699083 AAAAAGAAAACACAGAAAAATGG - Intergenic
983067330 4:163226729-163226751 AAGAATTTGAGCCAGAAAAATGG - Intergenic
983234343 4:165162234-165162256 AAGAGGTAATGACAGTAAAAGGG + Intronic
983334785 4:166378009-166378031 AAGAAGCAAAGAAAGAGAAAGGG - Intergenic
983352566 4:166610718-166610740 CAGAAATCAAGACAGAGAAAAGG - Intergenic
983370031 4:166846034-166846056 AACAAGTCTAAACATAAAAAAGG + Intronic
983440026 4:167770056-167770078 AAGAAGACAAGAAAGAATAAAGG - Intergenic
984244748 4:177261688-177261710 AATAATTAAAGACAGAAATATGG + Intergenic
984545659 4:181099389-181099411 GAGAAGAAAAGAGAGAAAAAAGG + Intergenic
984877031 4:184378531-184378553 AAAAAGTGAAGTAAGAAAAAAGG - Intergenic
984993565 4:185405559-185405581 AAGAAGTAAAGGCTGAGAAATGG - Intronic
1202752339 4_GL000008v2_random:19538-19560 AAGAAATCAAAACAGACAAGTGG + Intergenic
985528514 5:420349-420371 AGGAAGTCAAGGGAGAAAGAAGG + Intronic
985808812 5:2068379-2068401 AAGAAGGAAAGACAGAGACATGG + Intergenic
985856360 5:2430344-2430366 AAGAAAGAAAGAAAGAAAAATGG + Intergenic
986105120 5:4652128-4652150 TATAAGCCAAGAAAGAAAAAAGG - Intergenic
986468488 5:8050531-8050553 AAGAAGGAAAGAAAGAAGAAAGG + Intergenic
986558851 5:9040161-9040183 AAGAATTAAAGAAAGAAGAAAGG + Exonic
986714722 5:10514609-10514631 AATAAATAAAGACAGATAAAAGG - Intronic
986788335 5:11136431-11136453 AAAAAGGCAAGAATGAAAAAAGG + Intronic
986859708 5:11912143-11912165 AAAAAGAAAAGAAAGAAAAAGGG + Intergenic
986933242 5:12853411-12853433 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
986942788 5:12975660-12975682 AAGAAAGAAAGAAAGAAAAAAGG + Intergenic
987046708 5:14115747-14115769 AAGAATTCTGGACAGAAATAGGG - Intergenic
987291550 5:16513087-16513109 CAGAAGTCATGACAGAAATAGGG + Intronic
987372799 5:17208580-17208602 AAGAAAGAAAGAAAGAAAAATGG + Intronic
987414824 5:17651948-17651970 AAGAAGGAAAGACAGAAGAAAGG - Intergenic
987472974 5:18355265-18355287 AAAAAGTTAAAACAGAAAAGTGG - Intergenic
987625104 5:20388778-20388800 ACGAAATCAAGGCAGAAATAAGG - Intronic
987694910 5:21315745-21315767 AAGAAATAAAGAAAAAAAAAAGG - Intergenic
987695257 5:21320466-21320488 AAGAAGGAAGGAAAGAAAAAAGG - Intergenic
987747578 5:21995940-21995962 AAGGATTCAAGACATAAAATGGG - Intronic
988016319 5:25564312-25564334 AAAAAATTAAGACAGAAAATTGG - Intergenic
988035719 5:25824846-25824868 AAGAAAGCAAGAAAGAAAGAAGG - Intergenic
988213331 5:28237929-28237951 AAGAAAGAAAGAAAGAAAAAAGG - Intergenic
988250097 5:28745910-28745932 AAGAACTAAAGACAGAAATTGGG + Intergenic
988361395 5:30240351-30240373 TAGAAGTCATGATAGAAAATGGG - Intergenic
988636037 5:32986019-32986041 AAGAAGTCATTACATGAAAAAGG + Intergenic
989492476 5:42073867-42073889 AAGCAGACAACACAGACAAAGGG - Intergenic
989503979 5:42203803-42203825 ATGCAGTCAAGAAAAAAAAATGG + Intergenic
990093080 5:52080069-52080091 AAGAATTCAAGAATGAAAAATGG - Intronic
990579764 5:57156645-57156667 AAGAAAGAAAGAAAGAAAAAAGG + Intergenic
990601669 5:57365112-57365134 AAGAAGTCAAAGGAGAAAAAGGG - Intergenic
990787917 5:59443820-59443842 AAAAGGTCAAGAGAGAGAAAAGG - Intronic
990862480 5:60342266-60342288 AAGAAGTAAATGCAAAAAAATGG - Intronic
990933213 5:61116734-61116756 AAGGAGTAAACAAAGAAAAAGGG + Intronic
991126825 5:63079127-63079149 AAGAACACAATACAGAAAATTGG + Intergenic
991474055 5:67000794-67000816 CAGAATTCAAGTCAGTAAAAAGG + Intronic
991767759 5:70005740-70005762 AAGGATTCAAGACATAAAATGGG - Intergenic
991846993 5:70880816-70880838 AAGGATTCAAGACATAAAATGGG - Intergenic
992028039 5:72690714-72690736 AAAAAGGAAAGACAAAAAAATGG + Intergenic
992119044 5:73572095-73572117 AATATGGAAAGACAGAAAAAGGG - Intronic
992665622 5:79006051-79006073 AAGAAGTAAAAAAAAAAAAAAGG - Intronic
992752608 5:79874963-79874985 AAGAGGCCAGGAAAGAAAAAAGG + Intergenic
992813710 5:80415036-80415058 AAGAAGTCCAGAAAGAAGGAAGG - Intronic
992862273 5:80923209-80923231 AAGAAGGCAAGAAAAAGAAAAGG + Intergenic
992892844 5:81219798-81219820 AAGAAATTAATAAAGAAAAAAGG + Intronic
993091535 5:83432738-83432760 AAGAAGACAAGACACAGAGAAGG + Intergenic
993110857 5:83655899-83655921 AAGGAGTGAAGACAGAGGAAAGG + Intronic
993239506 5:85363036-85363058 CAAAAGTCAAAATAGAAAAAAGG - Intergenic
993320249 5:86461704-86461726 AGGAAGTCAAGATAGTCAAATGG + Intergenic
993544866 5:89199200-89199222 AAGAAGTAAAGACAGATGTATGG - Intergenic
993612519 5:90072915-90072937 AAGAAAGGAAGAAAGAAAAAGGG - Intergenic
993828133 5:92719284-92719306 TGAAAGTCAAGACAGAAAGAGGG - Intergenic
994066510 5:95549161-95549183 AAGATGACAAGACTTAAAAATGG + Intronic
994112182 5:96019077-96019099 AACAAATCAAGATAGAAAAAGGG + Intergenic
994175472 5:96706300-96706322 AAAAAATAAAGAAAGAAAAAAGG - Intronic
995016345 5:107313912-107313934 CAGCAGTCAAAACAGATAAAAGG - Intergenic
995226526 5:109707371-109707393 AGGAAGGAAAGAAAGAAAAATGG - Intronic
996353916 5:122576180-122576202 AAGAAATCAAAACAGAAGCATGG + Intergenic
996408588 5:123130371-123130393 AAGAGATAAAGAGAGAAAAAAGG - Intronic
996410016 5:123148125-123148147 TATAAGTCAAGACTGAAATATGG - Intronic
996747730 5:126859240-126859262 AAGAAAGAAAGAAAGAAAAAAGG + Intergenic
996905779 5:128597928-128597950 AAGAAAGAAAGAAAGAAAAAAGG - Intronic
996930553 5:128881231-128881253 AAGGAGACTAGAAAGAAAAAAGG - Intronic
997121885 5:131182949-131182971 AAGAAAACAAAACAAAAAAATGG + Intronic
997175572 5:131772855-131772877 TTGATGTCATGACAGAAAAATGG - Intronic
997433357 5:133856864-133856886 AAGAAAGCAAGACAGCAAAATGG + Intergenic
997541483 5:134666582-134666604 AAGAAAGAAAGAAAGAAAAAAGG + Intronic
997849798 5:137321282-137321304 AAGAAGGAAAGACAGACAAAGGG + Intronic
997904074 5:137797482-137797504 TATAAGTTAAGACACAAAAATGG - Intergenic
997960048 5:138313959-138313981 AAGAAAGAAAGAAAGAAAAAGGG - Intronic
998350754 5:141499023-141499045 AGGAAGAAAAGAAAGAAAAAGGG + Intronic
998396055 5:141818805-141818827 AAGAAAGAAAGAAAGAAAAAAGG + Intergenic
998495817 5:142588418-142588440 AAAAAGAAAAGAAAGAAAAAAGG - Intergenic
998501075 5:142633372-142633394 GAGAAGTCAAGGAATAAAAATGG - Intronic
998705027 5:144749436-144749458 AACTAGTCAAGACAGAAAAATGG + Intergenic
999624340 5:153504610-153504632 CAGAAGTCAGGACAGGCAAAAGG + Intronic
1000474450 5:161687796-161687818 AAGATGTAAAGAAAGGAAAAAGG + Intronic
1000477874 5:161733387-161733409 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
1000604396 5:163312720-163312742 AGGAAGTCAAGCTAGAAATAGGG - Intergenic
1000652918 5:163839146-163839168 AAGAAGAAAAGACAGAGAAACGG - Intergenic
1000679662 5:164167728-164167750 AGGAAGTCGAGAAAGAAAAATGG - Intergenic
1000695443 5:164375509-164375531 AAGGAGTCTAGACAGACAGATGG - Intergenic
1000973800 5:167742800-167742822 AAGAAAGAAAGACAGAAAATTGG + Intronic
1001843377 5:174900550-174900572 AAGAAGTCTAGAAGGAAAGAGGG - Intergenic
1002074726 5:176701386-176701408 GAGAAGACAAGAGAGAAAGAAGG - Intergenic
1002345003 5:178542661-178542683 CAGAGCTCTAGACAGAAAAATGG + Intronic
1002804737 6:561896-561918 AATAAGGTAAGACAGAAAACAGG + Intronic
1003044996 6:2725621-2725643 AAGAAGGAAAGAAAGAAAGAAGG + Intronic
1003302954 6:4901486-4901508 AGGAACTTAAGACAGAACAAAGG - Intronic
1003656188 6:8011721-8011743 AAGAAGTCAAGAAACAGAAAAGG + Intronic
1003957930 6:11182415-11182437 CAAAAGTCAAGCCAGAAAATGGG - Intergenic
1004630255 6:17414260-17414282 AAGAAATAAAGAAAAAAAAAAGG - Intronic
1004672593 6:17811829-17811851 GAGAAGGAAAGAAAGAAAAAGGG - Intronic
1004771211 6:18784746-18784768 TAGAAGTAAAAAAAGAAAAAAGG + Intergenic
1004982570 6:21042526-21042548 AGGAAGTGGAGACAGTAAAAAGG - Intronic
1005099565 6:22155762-22155784 AAGAAGCCAGTACATAAAAATGG + Intergenic
1005160195 6:22850875-22850897 AAGAAATGAAGACCAAAAAAAGG + Intergenic
1005205574 6:23400040-23400062 AAGAAGTCATTATACAAAAAAGG - Intergenic
1005383622 6:25263366-25263388 AAGAAAGAAAGAAAGAAAAAAGG + Intergenic
1005465245 6:26106725-26106747 AAAAAGTTAAAACAGAAAAAGGG - Intergenic
1005686804 6:28260993-28261015 AAGAAGCCCAGAAAGAACAAAGG + Intergenic
1006174383 6:32113233-32113255 AAGAAGTCTAGAAAGAGGAAGGG + Intronic
1006195973 6:32242597-32242619 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
1006322174 6:33326108-33326130 AAGAGGTGATGAAAGAAAAAAGG + Intronic
1006385724 6:33729700-33729722 AAGAAAGAAAGAAAGAAAAAAGG - Intronic
1007122265 6:39392727-39392749 CAGAAAGCAAGACATAAAAATGG + Intronic
1007429083 6:41766241-41766263 AAGAAAGAAAGAAAGAAAAAAGG + Intergenic
1007554063 6:42751637-42751659 AAAAAGAAAAGAAAGAAAAAGGG - Intronic
1007672945 6:43571446-43571468 AAAAAACCAAGAAAGAAAAAAGG + Intronic
1007905762 6:45459054-45459076 AAGAAATCCAGACAGAAATAAGG - Intronic
1007986223 6:46209693-46209715 AACAAATAAAGAAAGAAAAAAGG + Intergenic
1008147984 6:47915151-47915173 AAAAAGTAAAGCCATAAAAAGGG + Intronic
1008228494 6:48953443-48953465 AAGAAGGAAAGAAAGAAAGAGGG + Intergenic
1008269228 6:49470224-49470246 AAGAAATCCAAAGAGAAAAAAGG + Exonic
1008671147 6:53770159-53770181 AAGATGTTAAAGCAGAAAAATGG - Intergenic
1008948665 6:57129803-57129825 AAGAAGAAAACAAAGAAAAAAGG - Intronic
1009026642 6:58007995-58008017 AACAAAACAAGACAGAAAAATGG - Intergenic
1009202185 6:60759468-60759490 AACAAAACAAGACAGAAAAATGG - Intergenic
1009373308 6:62936260-62936282 GAGAAGACAGGAAAGAAAAATGG - Intergenic
1009626731 6:66145258-66145280 AAAAAGACAAAACAGAAAAGAGG - Intergenic
1009758336 6:67970720-67970742 AAAAAGACAAAACAGAGAAAGGG + Intergenic
1010001181 6:70951369-70951391 AAGCAGAGTAGACAGAAAAAAGG + Intronic
1010254962 6:73747108-73747130 AAGAAGCCAAGGCAGAAATCGGG - Intronic
1010509279 6:76698103-76698125 AGGAAGTCAACAGAAAAAAATGG + Intergenic
1010529128 6:76944553-76944575 AAGAAGACAGGAAGGAAAAAAGG + Intergenic
1010714460 6:79212130-79212152 GAATAGACAAGACAGAAAAATGG + Intronic
1010768319 6:79801134-79801156 AAGAAAGAAAGAAAGAAAAAAGG + Intergenic
1010890362 6:81301022-81301044 AAGAAAGCAAGAGAGAAAAAGGG + Intergenic
1011073727 6:83415180-83415202 AAGAAATCAAGACACAATAGAGG - Intronic
1011300239 6:85865873-85865895 AAGAAGTCAAGAGAGTCAAGTGG - Intergenic
1011567974 6:88700073-88700095 AGGCTGTCATGACAGAAAAAAGG + Intronic
1011608651 6:89129167-89129189 AAGATGTGAGGAGAGAAAAAAGG + Intergenic
1011673623 6:89709202-89709224 AGGGAGGCAAGACACAAAAAAGG + Intronic
1012391188 6:98741776-98741798 AAGAAGTTAAGACAGGATATTGG + Intergenic
1012617652 6:101296777-101296799 AACAAGTTAAGAAGGAAAAAAGG - Intergenic
1013062928 6:106654699-106654721 AAAAAGTCAAGATACAAAATTGG - Intronic
1013184069 6:107742337-107742359 AAGGAGTCAAGCAAGAACAAGGG + Intronic
1013416898 6:109933688-109933710 AAGAAGTCAAGTCAAAAAGTTGG - Intergenic
1013436514 6:110115392-110115414 AAGAAGGCAAGACAACAAGAAGG + Intronic
1013548063 6:111179717-111179739 AAGAAGGGAAAGCAGAAAAAAGG - Intronic
1013588180 6:111597807-111597829 AAAAAGGAAAAACAGAAAAATGG - Intronic
1013627067 6:111949136-111949158 AAGCAGACAAGCCAGACAAAAGG - Intergenic
1013666130 6:112350435-112350457 AAGAGCTCAAGACAGAAGAATGG - Exonic
1014101225 6:117514098-117514120 TAAAAGGCAAGAAAGAAAAATGG - Intronic
1014724617 6:124960402-124960424 AAGAAGTCATGGCAAAATAAAGG + Intergenic
1014756646 6:125308990-125309012 CTGAAGTCAAGTCAGAAACAAGG - Intergenic
1014879198 6:126701276-126701298 ATCAAGTCAAGACAGAATAGGGG - Intergenic
1015052684 6:128862005-128862027 AAGAAGTAAAGAAAGAGACAGGG - Intergenic
1015210083 6:130687023-130687045 AAGAAGTCAACACAGAATCATGG + Intergenic
1015630133 6:135223612-135223634 CTGAAGCCAAGAGAGAAAAATGG - Intergenic
1015741438 6:136458936-136458958 AAGAAATCAACAGAGTAAAAAGG + Intronic
1015766370 6:136721375-136721397 AAGAACAAAAGAGAGAAAAAAGG + Intronic
1015874615 6:137810114-137810136 AAGAAGGAAAGAGAGAAAGAGGG + Intergenic
1015927572 6:138325506-138325528 AAGAAGTTGGGACAGAAGAAAGG + Intronic
1016130314 6:140460309-140460331 AAAAGGTTAAGAGAGAAAAATGG - Intergenic
1016207673 6:141489712-141489734 AAGCAGACAAGACAGAGAAGGGG + Intergenic
1016283505 6:142447309-142447331 AAAAAGTAAAAAAAGAAAAAAGG + Intergenic
1016409802 6:143770905-143770927 AAGAAAGAAAGAAAGAAAAAAGG - Intronic
1016548599 6:145251950-145251972 AAGAAATCAAAACAGATAGATGG - Intergenic
1016583803 6:145660966-145660988 AAGAAGACAATAAAGAAAAGGGG + Intronic
1016760961 6:147736947-147736969 AAGAAGTCAAAACCCAAATAAGG - Intronic
1016909482 6:149183397-149183419 AAGCATACAATACAGAAAAAAGG + Intergenic
1016919651 6:149279309-149279331 AAGAAGTTGAGCCAGAGAAATGG - Intronic
1017041035 6:150308912-150308934 AGGAAGGAAAGAAAGAAAAAAGG + Intergenic
1017138793 6:151171791-151171813 AAGAAGGAAAGAGAGAGAAAGGG - Intergenic
1017138803 6:151171849-151171871 AAGAAGGAAAGAGAGAAAGAGGG - Intergenic
1017238781 6:152144852-152144874 AAGAATTAAAGAAAGAAAAATGG - Intronic
1017241978 6:152180667-152180689 AAAAAGGAAAGAAAGAAAAAAGG + Intronic
1017547275 6:155466144-155466166 GAGAAGTGAGGAAAGAAAAAAGG + Intergenic
1017637283 6:156455959-156455981 CAGAAGCCAAGACAGAGGAATGG - Intergenic
1017848614 6:158282792-158282814 AATAATTCTAGACAGAGAAAGGG - Intronic
1018033348 6:159861748-159861770 AAGATGCCAAAACAGAAAGAAGG + Intergenic
1018164053 6:161077215-161077237 TAGAAGTGAAGAGAGAACAAAGG + Intronic
1018352530 6:162975797-162975819 AGGAAGGCAAGAAGGAAAAAGGG - Intronic
1018354951 6:163003542-163003564 AAGAAGTGGATATAGAAAAAAGG - Intronic
1018486729 6:164248041-164248063 AAGAAAGAAAGAAAGAAAAAAGG + Intergenic
1018645403 6:165943289-165943311 AAGAAGGAAAGAAAGAAAGAAGG + Intronic
1020331462 7:7021429-7021451 AAGAGGTCAAGACGATAAAAGGG - Intergenic
1020345577 7:7159406-7159428 AAGAAGGAAAGAAAGAAAACAGG + Intronic
1020602679 7:10295436-10295458 AAGAAGGAAGGAGAGAAAAAAGG - Intergenic
1020607179 7:10354045-10354067 AAAAAGACAAGAAAAAAAAAAGG + Intergenic
1020647337 7:10830818-10830840 AAGACTTACAGACAGAAAAAGGG - Intergenic
1020655365 7:10922680-10922702 AAAAAATTAAAACAGAAAAAAGG + Intergenic
1020780611 7:12513179-12513201 AAGAAAGAAAGAAAGAAAAAAGG - Intergenic
1020846238 7:13287668-13287690 AAGAAAGCAAGAAAGAAAAAAGG + Intergenic
1020940763 7:14533677-14533699 AATAACTCATCACAGAAAAAAGG + Intronic
1021177862 7:17470875-17470897 AATAAGTCAAGAAAAAGAAAAGG + Intergenic
1021248367 7:18292670-18292692 AAAAACTCAAGAGAGACAAATGG - Intronic
1021691502 7:23234912-23234934 AAGAACTCTAGAGAGAAAACCGG + Intergenic
1022354447 7:29599368-29599390 AAAAAGTGAAGACAGAGAGAAGG - Intergenic
1022461549 7:30613045-30613067 AAGAAGAGAAGACAGGAAATGGG - Intronic
1022597960 7:31730843-31730865 AAGATGACAAGTCTGAAAAAAGG + Intergenic
1022661718 7:32374007-32374029 AAGAAAGAAAGAAAGAAAAATGG + Intergenic
1022673153 7:32474827-32474849 AAGAAGGGCAGAGAGAAAAAGGG + Intergenic
1022830561 7:34061576-34061598 AACAAGCAAAGACAGAAAGAAGG + Intronic
1022950810 7:35336321-35336343 AAGAAAGAAAGAAAGAAAAATGG + Intergenic
1023229534 7:38011596-38011618 AAGAAGAGAAAACAGAGAAAGGG + Intronic
1023245313 7:38197132-38197154 AAGAAAGAAAGAAAGAAAAAAGG - Intronic
1023660571 7:42467308-42467330 AAGAAAGAAAGAAAGAAAAAAGG + Intergenic
1024091359 7:45944055-45944077 AAGAAGGCAAGAAAGAGAAAAGG - Intergenic
1024139055 7:46443171-46443193 AAGAAAGAAAGAAAGAAAAAAGG + Intergenic
1024371686 7:48591943-48591965 AATTAGTCAAGACAAAGAAAAGG - Intronic
1024489685 7:49965891-49965913 AATAGGTCAAGTCAGATAAATGG + Intronic
1024690099 7:51791245-51791267 AAGAAGGAAAAAAAGAAAAAAGG + Intergenic
1024726841 7:52207704-52207726 AAAATGTCAACACAGGAAAATGG + Intergenic
1025270867 7:57513909-57513931 AAGAACACAACACTGAAAAAGGG + Intergenic
1025474760 7:60905575-60905597 AAGAACACAAGAAAGAAAGAAGG + Intergenic
1025512243 7:61584299-61584321 AAGAACACAAGAAAGAAAGAAGG - Intergenic
1025742492 7:64209226-64209248 AAAAAGTCAAAAAAAAAAAACGG - Intronic
1026048734 7:66926650-66926672 AAAAAGAAAAGAAAGAAAAATGG + Intronic
1026632995 7:72054118-72054140 AAGAAGTCATTATACAAAAAAGG - Intronic
1026640341 7:72118778-72118800 AAGATGTCAAGTCAGAAGGAAGG + Intronic
1026780362 7:73262355-73262377 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
1027021221 7:74815776-74815798 AAGAAGGAAAGAAAGAAAGAAGG + Intronic
1027066805 7:75130149-75130171 AAGAAGGAAAGAAAGAAAGAAGG - Intronic
1027148486 7:75715411-75715433 AGGAAGGAAAGACAGAAAGAAGG + Intronic
1027169611 7:75862079-75862101 AAGAAATAAAGAAAGAAAATTGG - Intronic
1027740031 7:81989860-81989882 AAGAGGGCAAGACAGCAAAAAGG + Intronic
1027906562 7:84191937-84191959 AAGAAGTAAAAACAGGAAAGTGG - Intronic
1027921476 7:84400678-84400700 AAGAAGTAAAGGTAGAAATAGGG + Intronic
1027973317 7:85115525-85115547 AGGAATTGAAGACATAAAAAGGG - Intronic
1028105325 7:86869863-86869885 AAGGAGAAGAGACAGAAAAAGGG + Intergenic
1028490143 7:91402023-91402045 AAGAAGTCATTACATGAAAAAGG - Intergenic
1028605733 7:92653459-92653481 AAGATGCCAAGACATAGAAAAGG + Intronic
1028707380 7:93865673-93865695 GAGAAGTAAAGGCAGATAAAAGG - Intronic
1029164577 7:98578229-98578251 AAGAAAGAAAGACAGAAAGAAGG - Intergenic
1029228057 7:99042643-99042665 AAACAGTCAAGCCAAAAAAAAGG + Intronic
1029235118 7:99109144-99109166 AAGATGACAGGAGAGAAAAAGGG + Intronic
1029261407 7:99305203-99305225 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
1029320591 7:99755786-99755808 AGGAATTGAAGACACAAAAAAGG - Intergenic
1029481397 7:100815435-100815457 AAGATTTCAAGACAGAAAGTGGG + Intronic
1029485960 7:100840749-100840771 AAGCAGTTAAGAAAAAAAAAAGG + Intronic
1029820590 7:103142662-103142684 AGGAAGCCAAGTCAAAAAAAGGG + Intronic
1029972787 7:104805526-104805548 AGGAACTGAAGACAGAAAGAAGG - Intronic
1030130594 7:106196097-106196119 AAAAAATCAAGACAGGTAAAGGG - Intergenic
1030210040 7:106987058-106987080 AAGAAAGAAAGAAAGAAAAATGG - Intergenic
1030986678 7:116250001-116250023 AAGAAGTTAAAACTCAAAAACGG - Intronic
1031135039 7:117874703-117874725 AAGAAAGAAAGAAAGAAAAAAGG - Intergenic
1031196625 7:118623251-118623273 GAGAAGTCAAAACACTAAAATGG + Intergenic
1031305092 7:120116196-120116218 ATTAATTCAAGACAGATAAAAGG + Intergenic
1031729783 7:125285072-125285094 AAGAAGGCAGGACAGAAGGAGGG + Intergenic
1031779948 7:125948205-125948227 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
1031793174 7:126135689-126135711 AAGAAATGAAGAAAAAAAAAAGG - Intergenic
1031909325 7:127498158-127498180 AAGAAGTCAAATGAGAACAAAGG + Intergenic
1032554542 7:132817917-132817939 AAGAAAGAAAGAAAGAAAAAAGG + Intronic
1032774496 7:135096777-135096799 AAGAAAGAAAGAAAGAAAAAGGG + Intronic
1033027418 7:137788917-137788939 AAGAAGACAAAAAAGAAAAAAGG - Intronic
1033124213 7:138693559-138693581 AAGAAAGAAAGAAAGAAAAAAGG + Intronic
1033124214 7:138693575-138693597 AAAAAGGAAAGAAAGAAAAAAGG + Intronic
1033370484 7:140703095-140703117 GCGATGTCCAGACAGAAAAATGG - Intronic
1033735485 7:144217728-144217750 AAAAATTCAGGAAAGAAAAATGG - Intergenic
1033861375 7:145632099-145632121 AAGAAGTTATTACATAAAAAAGG - Intergenic
1034052005 7:147993908-147993930 AAGGAATCAAGAAAAAAAAAAGG + Intronic
1034070519 7:148180302-148180324 AAGAAGAAAAGAAAAAAAAAGGG - Intronic
1034298566 7:149995376-149995398 AAGAAGGAAAGAAAGAAGAAAGG + Intergenic
1034733483 7:153408851-153408873 AGGAATCCAAGACAGAAAACAGG - Intergenic
1034807448 7:154101402-154101424 AAGAAGGAAAGAAAGAAGAAAGG - Intronic
1034895955 7:154876459-154876481 AGGAAGGAAGGACAGAAAAAGGG + Intronic
1035233152 7:157478487-157478509 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
1035541277 8:440388-440410 AAGAGGTAAAGACAAGAAAATGG + Intronic
1035820574 8:2587387-2587409 AAGAAATAAAGAAGGAAAAAGGG - Intergenic
1036046082 8:5142259-5142281 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
1036064694 8:5366731-5366753 AAGAAGCAAAGACAGTACAATGG + Intergenic
1036183873 8:6607738-6607760 CAGCAGACAAGAGAGAAAAATGG - Intronic
1036488697 8:9203560-9203582 AAGAAGTTAAGACATGAAAATGG + Intergenic
1036535006 8:9640292-9640314 CAGACGGCAAGACAGAAAAATGG + Intronic
1036911711 8:12762916-12762938 ATAAAGTCAAGAGAAAAAAAAGG + Intergenic
1037287365 8:17315709-17315731 AAAAAAACAAAACAGAAAAAAGG + Intronic
1037468036 8:19179255-19179277 AAGAATTAAAGAAAGAAATAGGG - Intergenic
1037704550 8:21308212-21308234 AAGGAGTGAAGACAGAACAAGGG + Intergenic
1038161047 8:25038208-25038230 ACAATGTCAAGACAGGAAAAAGG - Intergenic
1038189836 8:25309833-25309855 AAGAAAGAAAGACAGAAAAATGG + Intronic
1038688251 8:29738163-29738185 AAGAAATCAGCAGAGAAAAAGGG + Intergenic
1038883253 8:31637942-31637964 AAAAAGTCGAGTCAGAAATATGG + Intergenic
1039032776 8:33327948-33327970 AAGGAGTGAAGGCAGAAAAATGG - Intergenic
1039051543 8:33499232-33499254 AAGCTGTGAAGACAGAAAAGTGG - Exonic
1039355460 8:36810432-36810454 AGGAAGTAAGCACAGAAAAAAGG + Intronic
1039769438 8:40668797-40668819 ATGGAGCCAATACAGAAAAATGG - Intronic
1040579788 8:48688410-48688432 AAGAAATCAAGATAGAAAGGTGG - Intergenic
1040629272 8:49190848-49190870 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
1040629277 8:49190964-49190986 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
1040720859 8:50321600-50321622 AAGAAGACAGGAAAGAAAGAAGG - Intronic
1041043264 8:53867719-53867741 AAGAAGGAAAGAAAGAAAGAAGG - Intronic
1041203457 8:55473897-55473919 AAGAAGGAAAGACAGAGAGAGGG - Intronic
1041380000 8:57244667-57244689 AAGAAGTCCAGGGAGACAAATGG - Intergenic
1041641289 8:60205141-60205163 AAGAAACAAAGCCAGAAAAATGG - Intronic
1041808831 8:61886152-61886174 AAGAAATGAAGATAAAAAAATGG - Intergenic
1041809584 8:61892858-61892880 AAGAAAGAAAGAAAGAAAAAAGG + Intergenic
1041865979 8:62573517-62573539 AAGAAGGCAGGAAAGAAAGAAGG - Intronic
1042027841 8:64443094-64443116 AGGAAAGCAAGACAGAATAAGGG + Intergenic
1042082362 8:65069513-65069535 AAAAAGTCAAGAAAAAAGAAAGG - Intergenic
1042136945 8:65641885-65641907 AACAAGAAAAGACTGAAAAACGG + Intergenic
1042358635 8:67856974-67856996 AAGAAGAAAAGTCAGAGAAAGGG - Intergenic
1042648953 8:71018487-71018509 AAGATGTAAAGAGAGAAAAGTGG + Intergenic
1042982162 8:74541521-74541543 CTGAAGTAGAGACAGAAAAAAGG + Intergenic
1043123208 8:76358018-76358040 AGGAAGAAAAGAGAGAAAAATGG - Intergenic
1043205732 8:77436807-77436829 AGGAAGTCAACAAAGAACAATGG - Intergenic
1043243674 8:77970937-77970959 AAGAAGACAACTCTGAAAAATGG + Intergenic
1043246341 8:78006977-78006999 AAGTAGTCAGGATAGGAAAAAGG - Intergenic
1043267481 8:78285036-78285058 AAGAAGTCAAGGTAGAAGCAAGG + Intergenic
1043328909 8:79088826-79088848 AAGAAAGCAAGGCAGAGAAAAGG + Intergenic
1043438843 8:80259296-80259318 AAGAAGAAAAGAAAGAAAAGAGG + Intergenic
1043691044 8:83152324-83152346 TAGGAGGCAGGACAGAAAAATGG - Intergenic
1043710410 8:83409896-83409918 AACAAGGCAAAACAGTAAAATGG - Intergenic
1043766623 8:84142361-84142383 GAGAAGTCAAGTCAGTAGAAAGG - Intergenic
1043988340 8:86720664-86720686 AAGAAGTCATTATAGCAAAAAGG + Intronic
1044035366 8:87296408-87296430 AAGAAGTGAAAATAGAAAAGAGG + Intronic
1044141678 8:88661882-88661904 AACAAGTGAATACAGAAAATGGG + Intergenic
1044153933 8:88818925-88818947 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
1044367827 8:91370276-91370298 AAGAAGAAAAGAAAGAAAATGGG - Intronic
1044415062 8:91928793-91928815 TAGAAGTCAAGAAAGGAGAAGGG - Intergenic
1044912005 8:97069725-97069747 AAGAAAAAAAGAAAGAAAAAAGG - Intronic
1045129675 8:99136054-99136076 AAGAAGTATAGATAGTAAAAAGG - Intronic
1045456211 8:102381834-102381856 AAAAAGTCAAAAAAGAAAAAAGG + Intronic
1045492228 8:102678878-102678900 AAGAAAGAAAGAAAGAAAAAAGG - Intergenic
1045799473 8:106085565-106085587 AATAAGTCAATAAAGAAAGACGG + Intergenic
1046551641 8:115725039-115725061 AAGGAGTCCAGAAAGCAAAAGGG + Intronic
1046555235 8:115766609-115766631 AAGAAGAGAAGAAAGAAAAAGGG + Intronic
1047132102 8:122032990-122033012 AAGAAGTCAAGTTACAAAACTGG + Intergenic
1047157153 8:122332175-122332197 AAGAAAGAAAGAAAGAAAAAGGG - Intergenic
1047333191 8:123911166-123911188 AAAGATTCAAGACAAAAAAATGG + Intronic
1047560253 8:125979643-125979665 GAGAAGTCACTATAGAAAAAGGG + Intergenic
1047705315 8:127493294-127493316 AAGGATTCAAGACAGAAGGAGGG + Intergenic
1047894283 8:129348749-129348771 AAGAAGTCACAAAAGGAAAAGGG + Intergenic
1048408052 8:134142966-134142988 AAGAAGACAAGAAGAAAAAAAGG - Intergenic
1048718445 8:137295983-137296005 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
1048739772 8:137542314-137542336 AAAATGAAAAGACAGAAAAAAGG - Intergenic
1049260970 8:141639052-141639074 AAGAAAGAAAGAAAGAAAAAAGG + Intergenic
1049362197 8:142217357-142217379 AAGAAAGAAAGAAAGAAAAAAGG + Intronic
1050069236 9:1792974-1792996 AGGAAGAAAAGAGAGAAAAAGGG - Intergenic
1050116298 9:2266959-2266981 AAGAAGTGAGGACAGAGAAAAGG - Intergenic
1050894961 9:10874726-10874748 AAGAAGTTAAAACTGAAAATAGG + Intergenic
1051260208 9:15256618-15256640 AAGATGCCAAGACAGAGAAATGG + Intronic
1051281952 9:15450329-15450351 ATGAAGACAAGAAAGAAAAATGG + Intronic
1051401387 9:16687288-16687310 AAGAAGACAACAAAGGAAAAAGG + Intronic
1051422187 9:16900281-16900303 AAGAAGTCAAAAAGGGAAAATGG + Intergenic
1052206940 9:25854074-25854096 AAGATTTTAAGAAAGAAAAAGGG + Intergenic
1052273932 9:26656972-26656994 AAGCAGGCTAGACAGAAGAATGG + Intergenic
1052305664 9:27006593-27006615 AAGAAAGAAAGACAGAAAGAGGG + Intronic
1052367337 9:27627710-27627732 AAGGTTGCAAGACAGAAAAAGGG - Intergenic
1052426016 9:28306340-28306362 AAGAAATGAAGGCAGAAATAAGG + Intronic
1052532777 9:29708922-29708944 AAGAAGAAAGGACAGAAGAAAGG + Intergenic
1052602006 9:30646225-30646247 AAGAAGTAGAGACAGAGAGAGGG + Intergenic
1052679837 9:31676029-31676051 AAGAAGTCAAGTTTCAAAAAAGG - Intergenic
1053206989 9:36194699-36194721 AGGAACTCCAGACAGAAAAAGGG - Intronic
1053225712 9:36354464-36354486 AATAAGTAAATACATAAAAATGG - Intronic
1053337932 9:37294135-37294157 AGAAAACCAAGACAGAAAAAGGG + Intronic
1053381675 9:37654187-37654209 AAGAAGTCATTACATAAATAAGG + Intronic
1054513528 9:66013415-66013437 GAGAAGTCAAAAAAAAAAAAAGG + Intergenic
1054730783 9:68701010-68701032 AAGAAAGAAAGAAAGAAAAAAGG + Intergenic
1054947507 9:70811214-70811236 CGGGAGTCAAGAGAGAAAAACGG + Intronic
1055139964 9:72865076-72865098 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
1055153986 9:73038587-73038609 AAGAAAGCAAGACAGAAGAAGGG - Intronic
1055213369 9:73827664-73827686 TGGAAGTCAAGAGAGAAAAGAGG - Intergenic
1055601467 9:77923450-77923472 AAGAAGACAAGACAGAAAAATGG + Intronic
1055989116 9:82086243-82086265 AACAAGTCATAACAGAAAGAAGG - Intergenic
1056048813 9:82746646-82746668 AGGAAGTTAAGGCAGGAAAAAGG - Intergenic
1056259185 9:84830757-84830779 AAGAAGTAAACACAGAATATGGG - Intronic
1056441341 9:86624661-86624683 AAGAATGCAAGAAAAAAAAAAGG - Intergenic
1056472044 9:86915108-86915130 AAGAAGTAAAAAGAGAAAGAAGG + Intergenic
1056519168 9:87384325-87384347 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
1056764120 9:89434310-89434332 TAGAAGGGAAGACAGAACAATGG + Intronic
1056953917 9:91067402-91067424 ATGCAGTCCAGACAGAAGAATGG + Intergenic
1056961947 9:91132813-91132835 AAAAAGGAAAGAAAGAAAAAAGG + Intergenic
1057169502 9:92952693-92952715 AAGAAGGAAAGAGAGAAAGAAGG - Intronic
1057241444 9:93414788-93414810 AACAAAACAAAACAGAAAAAAGG - Intergenic
1057573866 9:96224376-96224398 AATAAGGCAAGAAAAAAAAAAGG + Intergenic
1058132324 9:101266797-101266819 AAGAACTCAAGACAAACACAAGG - Intronic
1058415288 9:104781512-104781534 AAGAAGAAAACACAGACAAATGG + Exonic
1058716504 9:107727063-107727085 AAGAAAACAAGAAAGAAAAGGGG - Intergenic
1058729542 9:107836719-107836741 AAGAAGACAAAGCAGATAAATGG + Intergenic
1058815247 9:108676788-108676810 AAGAATTCCAGTCAGAACAAGGG + Intergenic
1059030738 9:110693256-110693278 AAGAAGGCAAGAAAAGAAAAGGG - Intronic
1059038185 9:110782207-110782229 AAAGAATCAAGACAGAAAATTGG + Intronic
1059141541 9:111857628-111857650 CAGAAGTTAAGACAGAGAAATGG - Intergenic
1059280611 9:113130424-113130446 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
1059360446 9:113738176-113738198 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
1059566995 9:115392605-115392627 AAGAAGGAAGGACAGAAAGAAGG - Intronic
1059706945 9:116833945-116833967 AAGAAGGCAAGCAAGGAAAAGGG + Intronic
1059870452 9:118568109-118568131 TGGAAGTGAAGACAGAGAAAAGG + Intergenic
1059915446 9:119094633-119094655 AACAAGTAAAAGCAGAAAAAGGG + Intergenic
1060356994 9:122918402-122918424 AATAACTCAAAACAGAAAATGGG + Exonic
1060709252 9:125840575-125840597 GAGGAGTTAAGAAAGAAAAATGG - Intronic
1060769032 9:126317447-126317469 AAAAGGTGAAGACAGTAAAAAGG + Intergenic
1061018813 9:128000444-128000466 AAAAAGACAAGAAAGAAAAAAGG - Intergenic
1061377843 9:130236636-130236658 AAGATGCCAAGACAGAAGATGGG - Exonic
1061389396 9:130309200-130309222 GAGAAGTCAGGCAAGAAAAATGG + Intronic
1061617342 9:131789000-131789022 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
1203718090 Un_KI270742v1:173989-174011 AAGAAATCAAAACAGACAAGTGG - Intergenic
1203533130 Un_KI270743v1:4239-4261 AAGAAATCAAAACAGACAAGTGG + Intergenic
1203652315 Un_KI270751v1:137538-137560 AAGAAATCAAAACAGACAAGTGG - Intergenic
1185501724 X:601871-601893 AAGAAAGAAAGAAAGAAAAATGG - Intergenic
1185538534 X:883639-883661 AAGAGGTAGAGACAGAAACAGGG + Intergenic
1185645529 X:1612974-1612996 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
1186142757 X:6594109-6594131 ATGAATTCAAGGCAGAAGAAGGG + Intergenic
1186327853 X:8499026-8499048 AAGAAATGAAGAAAGAAAAAAGG + Intergenic
1186392531 X:9175203-9175225 AAGAAATCACGCCTGAAAAAGGG + Intergenic
1186616325 X:11191904-11191926 AAGATGATAAGCCAGAAAAAGGG - Intronic
1186697566 X:12053485-12053507 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
1186706363 X:12143560-12143582 AAGAAGAGAAAACAGGAAAAAGG - Intronic
1186752462 X:12635371-12635393 AAGAAGCCAACACAGGAAAGTGG - Intronic
1186830536 X:13385702-13385724 GAGAAGTCAAAACAGATACAGGG - Intergenic
1186906012 X:14111247-14111269 AAGAAGTGGGGAGAGAAAAAAGG - Intergenic
1187456659 X:19447192-19447214 CAGAAGACAAGAAATAAAAAGGG - Intronic
1187468859 X:19550780-19550802 AGGATGGCAAGGCAGAAAAATGG + Intronic
1187762172 X:22599471-22599493 AAGAAGTCAAGGCCGAACACAGG + Intergenic
1187876791 X:23810630-23810652 AAAAAGTCAAAAAATAAAAAAGG + Intergenic
1187915951 X:24151964-24151986 GAGAAATCAGGATAGAAAAAAGG - Intronic
1187971749 X:24665730-24665752 AAGAATTCAAAACAAAAAAATGG - Intronic
1188013476 X:25082390-25082412 AAGAAGTAGAGAAACAAAAATGG + Intergenic
1188128963 X:26406689-26406711 AAGAAGACAAGAGAGATAAATGG - Intergenic
1188181939 X:27066979-27067001 AAGAAAGAAAGAAAGAAAAAGGG - Intergenic
1188214021 X:27456212-27456234 AAGAAGAAAAGAAAGAGAAAAGG - Intergenic
1188377986 X:29456494-29456516 CAGAATACAAGAAAGAAAAAGGG + Intronic
1188516678 X:30994885-30994907 ATAAAGTCAAAACAGAAAATTGG + Intergenic
1188584287 X:31753425-31753447 AAGAATAGAAGAAAGAAAAAGGG - Intronic
1188611610 X:32106373-32106395 TAGAAGTCTAGTCAGGAAAAGGG + Intronic
1189001853 X:36956645-36956667 AAAAAGTCAAGAGATAACAAGGG + Intergenic
1189170286 X:38902879-38902901 AAGATGGCAGGAGAGAAAAAAGG + Intergenic
1189246481 X:39567293-39567315 AAGAGGTCAAGGCAGAAGACAGG + Intergenic
1189666104 X:43356604-43356626 AATAAATTAAGACAGAAATATGG - Intergenic
1189708135 X:43780254-43780276 AAGAAGGAAAGAAAGAGAAAAGG + Intronic
1189795286 X:44640061-44640083 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
1189828564 X:44946646-44946668 AAGAAGAAAACACGGAAAAATGG - Intronic
1189835628 X:45018685-45018707 AAGAATTCAGGAAAGGAAAAAGG - Intronic
1189901447 X:45710947-45710969 AAGAAAGAAAGAAAGAAAAAAGG - Intergenic
1190132737 X:47765572-47765594 AAGAAATCAATACAACAAAAAGG - Intergenic
1190177004 X:48158610-48158632 AAGTAGCCAAAGCAGAAAAAGGG - Intergenic
1190203706 X:48384723-48384745 AAGTAGCCAAAACAGGAAAAGGG - Intronic
1190206830 X:48410680-48410702 AAGTAGCCAAAACAGGAAAAGGG + Intronic
1190995981 X:55609757-55609779 AAGAAGACAGGACAGGATAATGG - Intergenic
1191656952 X:63608453-63608475 AAGAAGTATAGAGAAAAAAAGGG + Intergenic
1191812709 X:65207174-65207196 AAGAAGTCATTATACAAAAAAGG + Intergenic
1191834449 X:65449021-65449043 AAGAAGGAAAGAAAGAAAGAAGG + Intronic
1191876201 X:65799389-65799411 AAGAAATGAAGGCAGAAATAAGG + Intergenic
1192008168 X:67239525-67239547 CAGAAGTCAAAATAGACAAATGG + Intergenic
1192087192 X:68112218-68112240 AAGACATAAAGAAAGAAAAAAGG + Intronic
1192356551 X:70409491-70409513 GAGAAGTACACACAGAAAAATGG + Intronic
1192543779 X:71996243-71996265 AAGAAGTCAAAAAAGAAATGGGG - Intergenic
1192730072 X:73794237-73794259 AAAAAGAAAAGAAAGAAAAAAGG + Intergenic
1193163713 X:78258100-78258122 AAGAAGAGAAAGCAGAAAAAGGG - Intergenic
1193168305 X:78306758-78306780 AAGGAGAAAAGACAGCAAAAGGG + Intronic
1193212215 X:78820522-78820544 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
1193242290 X:79185219-79185241 AAGCAGTGAAGACAGAGAACAGG - Intergenic
1193528141 X:82618978-82619000 AGGCAGTCTAGACAGAAAAAGGG + Intergenic
1193623483 X:83787084-83787106 AAGAAGTTGAGCCAGAACAAGGG + Intergenic
1193643716 X:84042420-84042442 ATGAAATTAAGACAAAAAAAGGG - Intergenic
1193799019 X:85913370-85913392 AAGAAAGAAAGAAAGAAAAAAGG + Intronic
1193987994 X:88270152-88270174 AAGAAACAAAGACAGAAATAAGG - Intergenic
1194598874 X:95895245-95895267 AAAAAGTGAAAACATAAAAATGG + Intergenic
1194754766 X:97725554-97725576 CAGAAGTCTACAGAGAAAAACGG + Intergenic
1194864076 X:99043921-99043943 AAGCAGCAAAGACAGTAAAATGG - Intergenic
1194882999 X:99276953-99276975 AAGGAGTCAATTCAGCAAAAGGG + Intergenic
1195109915 X:101637750-101637772 TAGAAGACATGGCAGAAAAAGGG - Intergenic
1195159522 X:102156954-102156976 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
1195263285 X:103154891-103154913 AAGAAGGAAAGAAAGAAAGAAGG + Intergenic
1195394280 X:104394304-104394326 AATAAGTGAAGATAGAGAAAAGG + Intergenic
1195489617 X:105452277-105452299 AAGAAGTTAAAAAAGATAAACGG - Intronic
1195524732 X:105873652-105873674 AAGAAGGGAAGAAAGGAAAAAGG - Intronic
1195548287 X:106138189-106138211 AAGAAAGAAAGAAAGAAAAAAGG + Intergenic
1195692861 X:107642673-107642695 CGGAAGACAAGACAGAAAAGGGG + Intronic
1195804263 X:108745125-108745147 TAGAAGTCAAAAGAGAAATAAGG + Intergenic
1196659496 X:118254863-118254885 AAAAAGGGAAGACAGAAAATTGG - Intergenic
1196691595 X:118564764-118564786 AAGAAGGAAAGAAAGAAAGAAGG - Intronic
1196743907 X:119050664-119050686 AAGATGTCAAAAAATAAAAAAGG + Intergenic
1197039034 X:121912633-121912655 AAAAAGAAAAGACAGAGAAAGGG - Intergenic
1197116672 X:122841926-122841948 AAAAAGGCCAGACACAAAAAGGG + Intergenic
1197504445 X:127284117-127284139 AAGAAGTCATTATATAAAAAAGG + Intergenic
1197508409 X:127338467-127338489 AAGAAGAAAAGAAAGAAAGAAGG - Intergenic
1197511615 X:127375826-127375848 AGGAAGTCAACAAAGAAAACTGG + Intergenic
1197520227 X:127488735-127488757 AGGAGGTCAAGAAAGAAAGAGGG - Intergenic
1197817035 X:130508536-130508558 AAAAAGACAGGACAAAAAAAAGG - Intergenic
1197905924 X:131425578-131425600 AAGAAGGAAGGAAAGAAAAAAGG + Intergenic
1198255477 X:134920661-134920683 AAGGAATCAAGACAGGAGAAAGG - Intergenic
1198535958 X:137586686-137586708 CAGAAGCCAAGACAAAAATAGGG - Intergenic
1198559392 X:137832393-137832415 AGGAAGTCATTACACAAAAAAGG - Intergenic
1198665900 X:139022495-139022517 AAGATATAAAGAAAGAAAAAAGG - Intronic
1199034138 X:143031693-143031715 AAGAACTAAAAACACAAAAAAGG - Intronic
1199199578 X:145071412-145071434 AAGAAGAAAAGAAAAAAAAAAGG - Intergenic
1199200352 X:145080277-145080299 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
1199248813 X:145636949-145636971 AAGAAAACAAGACAGGACAATGG + Intergenic
1199511310 X:148626128-148626150 AAGAATTGAAGACAGAATAGGGG - Intronic
1199891336 X:152085755-152085777 ATGAAGTTGAGACAGAAAGAGGG + Intergenic
1199938355 X:152599846-152599868 AAGATTTGAAAACAGAAAAAGGG + Intergenic
1200724170 Y:6645723-6645745 AAAAAGGCAACCCAGAAAAATGG - Intergenic
1200738846 Y:6831442-6831464 AAGAAAGAAAGAAAGAAAAAAGG - Intergenic
1201341156 Y:12935763-12935785 AAGAAAGAAAGAAAGAAAAAAGG - Intergenic
1201469993 Y:14322575-14322597 AAGAAGGAAAGAAAGAAAGAAGG - Intergenic
1201470003 Y:14322678-14322700 AAGAAGAAAAGAAAGAAAAAAGG - Intergenic
1201624127 Y:15995192-15995214 ATGAATTCAAGACAGAAGAAGGG + Intergenic
1201856611 Y:18551456-18551478 AGCAAGGCAAGAAAGAAAAAAGG + Intronic
1201876710 Y:18768924-18768946 AGCAAGGCAAGAAAGAAAAAAGG - Intronic
1202083515 Y:21110479-21110501 AAAAAGGAAAGAAAGAAAAAAGG - Intergenic
1202334059 Y:23787848-23787870 AAGAAAACAAAACTGAAAAATGG - Intergenic
1202536709 Y:25882211-25882233 AAGAAAACAAAACTGAAAAATGG + Intergenic