ID: 1127597166

View in Genome Browser
Species Human (GRCh38)
Location 15:60497221-60497243
Sequence GAAAAAGGGTCCATATCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 119}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127597162_1127597166 20 Left 1127597162 15:60497178-60497200 CCTCCTGTTGTAAACAGAGGTCA 0: 1
1: 0
2: 1
3: 12
4: 110
Right 1127597166 15:60497221-60497243 GAAAAAGGGTCCATATCTGTAGG 0: 1
1: 0
2: 0
3: 10
4: 119
1127597160_1127597166 23 Left 1127597160 15:60497175-60497197 CCTCCTCCTGTTGTAAACAGAGG 0: 1
1: 0
2: 0
3: 12
4: 141
Right 1127597166 15:60497221-60497243 GAAAAAGGGTCCATATCTGTAGG 0: 1
1: 0
2: 0
3: 10
4: 119
1127597163_1127597166 17 Left 1127597163 15:60497181-60497203 CCTGTTGTAAACAGAGGTCAATG 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1127597166 15:60497221-60497243 GAAAAAGGGTCCATATCTGTAGG 0: 1
1: 0
2: 0
3: 10
4: 119
1127597159_1127597166 24 Left 1127597159 15:60497174-60497196 CCCTCCTCCTGTTGTAAACAGAG 0: 1
1: 0
2: 2
3: 10
4: 193
Right 1127597166 15:60497221-60497243 GAAAAAGGGTCCATATCTGTAGG 0: 1
1: 0
2: 0
3: 10
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127597166 Original CRISPR GAAAAAGGGTCCATATCTGT AGG Intronic
901021683 1:6259267-6259289 GAAAAAGGCTCTAGGTCTGTGGG + Intronic
908301593 1:62766351-62766373 TCAAAAGAGTCCATATCTGCAGG - Intergenic
910475521 1:87602141-87602163 GAAAAAGATTCCATATTTCTGGG + Intergenic
911957311 1:104254258-104254280 GAAAAAGGGTCTAGATTTGTTGG + Intergenic
919210269 1:194474020-194474042 GAAAATGTGTCCATCACTGTTGG - Intergenic
923973146 1:239227756-239227778 GAAAATGTGTTCATTTCTGTTGG - Intergenic
1063478093 10:6346292-6346314 TAACAAGGGTCCATTTCTATTGG - Intergenic
1065294638 10:24262640-24262662 AAAAAAGAGTCAATATTTGTGGG + Intronic
1065981726 10:30904402-30904424 GGAAAAGGGGACATATCTGAAGG - Intronic
1075316793 10:121459534-121459556 GAAAAAGTTTGCATACCTGTTGG + Intergenic
1077294678 11:1820534-1820556 GAAAAAGCGTTCTTATCTTTTGG + Intergenic
1078263558 11:9734943-9734965 GAATTAGGTTACATATCTGTGGG + Intronic
1079760087 11:24318761-24318783 GAAAGAGGGTCCATTTGTTTGGG - Intergenic
1080103824 11:28490749-28490771 AAAAAATAGTCCTTATCTGTTGG + Intergenic
1081438092 11:43050286-43050308 GAAGTAGGGTGCATTTCTGTTGG - Intergenic
1081754807 11:45536963-45536985 GAAAATGGCTCAATATCTCTTGG + Intergenic
1082639870 11:55645908-55645930 AAAAAAGTGTTCATATCTATTGG + Intergenic
1082708203 11:56519563-56519585 GATAAAAGGTCCCTCTCTGTGGG + Intergenic
1089556489 11:119318235-119318257 GAAAAGGGGTCCACATCTGCTGG + Intronic
1091093387 11:132793649-132793671 GAAAAAGGGACCCTTTCTGAGGG + Intronic
1092011385 12:5115585-5115607 GGAAAAGGGTGCATGCCTGTTGG + Intergenic
1094799790 12:34019967-34019989 GAAAAATGGGCAATTTCTGTTGG - Intergenic
1095112580 12:38314272-38314294 GAAAAATGGGCAATTTCTGTTGG - Intergenic
1099420473 12:82452480-82452502 GAAACAGGGTCCTGCTCTGTTGG - Intronic
1099583205 12:84480478-84480500 GAAAAAGGGGCTAGCTCTGTTGG - Intergenic
1106495920 13:30274845-30274867 GAAAATGTGTGCATATATGTTGG + Intronic
1111562725 13:89972151-89972173 GAAAGAGTGTCCATGTCTCTTGG + Intergenic
1113282753 13:108808273-108808295 GAAGAAGGTTCTATTTCTGTAGG - Intronic
1114976504 14:28107208-28107230 GAAAAATGGTTCAAATGTGTAGG - Intergenic
1116856248 14:49954965-49954987 GAAAGATGGGCAATATCTGTGGG - Intergenic
1117385849 14:55212051-55212073 TAAAAGGGGTCCTTATCTGAAGG - Intergenic
1118628914 14:67685294-67685316 GCAAAAGAGTCCATATGTGAAGG - Intronic
1121365170 14:93302419-93302441 GAAAAGGGGTACATATCAGAGGG + Intronic
1126056145 15:44731461-44731483 GAATAAGGGTTCAAATATGTGGG + Intronic
1127597166 15:60497221-60497243 GAAAAAGGGTCCATATCTGTAGG + Intronic
1128127618 15:65204588-65204610 GAACAAGGGGCCATATCAGCAGG + Intronic
1129525706 15:76212748-76212770 GAAAATGGGTCCAGTGCTGTGGG - Intronic
1131355675 15:91743720-91743742 GAACAAGGGTCACTATCTGCTGG + Intergenic
1132123611 15:99199614-99199636 AAAAAAGAGTCCTTATCAGTTGG + Intronic
1133672350 16:8035139-8035161 GAAAAAGCATCCATTTTTGTAGG + Intergenic
1138032737 16:53573335-53573357 GAAGAAGGGTCCAGAGCTGATGG - Intergenic
1140570118 16:76094313-76094335 GAAAAAGGGTACATTTCTCTAGG - Intergenic
1141114171 16:81294086-81294108 GAAAAAGGGTGCAGTTCTGCGGG + Intergenic
1141564109 16:84889901-84889923 GAAACAGGGCCCAGGTCTGTTGG - Intronic
1142818179 17:2444697-2444719 AAAAAATGGTCCATCTGTGTAGG - Intronic
1147512680 17:41084712-41084734 GTAGAAGGGTCTACATCTGTGGG - Exonic
1147514873 17:41106059-41106081 GTAGAAGGGTCTACATCTGTGGG - Exonic
1158445279 18:57514862-57514884 GAAAACAGACCCATATCTGTAGG - Intergenic
1158635618 18:59154033-59154055 GAATAAGTATCAATATCTGTGGG - Intronic
1159039009 18:63305543-63305565 AAAAAAAATTCCATATCTGTTGG - Intronic
1162193229 19:8963557-8963579 AACACAGGGTCCATATCTCTTGG - Exonic
926286487 2:11492862-11492884 GAAAATGGCTCCTTATCTGCTGG + Intergenic
929465281 2:42138309-42138331 GAAAAGGGATCCGTATTTGTTGG - Intergenic
935304771 2:101726891-101726913 GAATAAGGGACCAAATCTGGTGG + Intronic
935306023 2:101737240-101737262 GAAAATGGGGCCAGAGCTGTGGG + Intronic
937387340 2:121447758-121447780 GAAACATGGTCCATTTCTTTGGG - Intronic
937698133 2:124832488-124832510 GAAAAAGGTTCCAATTTTGTTGG - Intronic
937786777 2:125908708-125908730 TTGAAATGGTCCATATCTGTTGG + Intergenic
938227432 2:129627961-129627983 AAAAAAAGGTTCATTTCTGTAGG - Intergenic
938785901 2:134629284-134629306 TCAAAAGTGTGCATATCTGTAGG + Intronic
938979073 2:136508438-136508460 GAGACAGGGGCCATATCTTTGGG - Intergenic
939644381 2:144678711-144678733 GAAAAAGGATCATGATCTGTGGG - Intergenic
940910825 2:159208569-159208591 GAAAATGGGTTCATGTCTGTCGG + Intronic
943093391 2:183400195-183400217 GAAAAAGGCTCAATATCAGCAGG - Intergenic
944265559 2:197721633-197721655 GAAAGACGGTCCATAACTCTTGG + Intronic
946197146 2:218040498-218040520 GAAAACGTGTTCATTTCTGTGGG + Intronic
1168763368 20:365051-365073 GAGAAAGGGACCATAGCTGGAGG + Intronic
1170041914 20:12048076-12048098 GAAAAAGGGTACATCTGTATAGG - Intergenic
1174282205 20:49447399-49447421 GAAAAATGGACCATTTCTGGTGG + Intronic
1175843173 20:62043604-62043626 GAAAAATGGTGCATCTGTGTAGG - Intronic
1177593053 21:23198074-23198096 GAAAAAGCTTCCATGTCTATTGG + Intergenic
950464206 3:13143678-13143700 GAGAGAAGGTCCATTTCTGTTGG + Intergenic
956362545 3:68464495-68464517 GAAAATGAGTCCATAACTCTTGG + Intronic
956530514 3:70212584-70212606 GAAAAAGAGTCCAGATGTGAGGG - Intergenic
957210309 3:77250353-77250375 GAAAAAGGCTAAACATCTGTTGG - Intronic
957400557 3:79707331-79707353 GAAAAAGGGGACATAACTCTGGG - Intronic
957682713 3:83458360-83458382 AAAAAAGGATAAATATCTGTAGG + Intergenic
961174183 3:124820492-124820514 GAAAAAAGGACTATAACTGTAGG - Intronic
965617984 3:170614182-170614204 AAGCAGGGGTCCATATCTGTGGG - Intronic
970114476 4:12678735-12678757 GAAAAAGGGTGCTAATCTTTTGG + Intergenic
970882343 4:20946816-20946838 GAAATGGGGTCCTAATCTGTGGG + Intronic
974309689 4:60188991-60189013 GAAACAGGATCCCTATCTCTTGG + Intergenic
974428928 4:61771560-61771582 GGAAAAGGGTCCATCTCTTCTGG - Intronic
976137424 4:81953880-81953902 GAAAAAGGGGGTATTTCTGTTGG - Intronic
978881849 4:113714210-113714232 GAAAATGGATCCACATATGTGGG - Intronic
979766744 4:124472596-124472618 GAAATAGAGTCCATATTTATTGG - Intergenic
981635287 4:146870647-146870669 GAAAAAAGGTAAATAACTGTAGG + Intronic
983450868 4:167909590-167909612 GATAAAGGGACAAAATCTGTTGG - Intergenic
987129501 5:14847691-14847713 GAGACTGGGTCCATATCTATAGG - Intronic
990280380 5:54244392-54244414 CAGAAAGGGTCTTTATCTGTAGG + Intronic
991340638 5:65604408-65604430 TAAAAAGAGTCCTTATCTTTTGG + Intronic
992645946 5:78811014-78811036 GAAAAAATGTCCAGAGCTGTAGG + Intronic
996176431 5:120365161-120365183 GAAAAACGGTCCAACTATGTAGG - Intergenic
1000143872 5:158433833-158433855 GACAAATCGTCCATATTTGTAGG - Intergenic
1000535076 5:162469652-162469674 CAAAAAGGGAGTATATCTGTTGG - Intergenic
1001274297 5:170339165-170339187 CAAAAATAGTCCATTTCTGTGGG + Intergenic
1006441761 6:34057659-34057681 GAACAATGGTCCTTATCTGGGGG - Intronic
1009375217 6:62960036-62960058 AAAAAAGGCTCCAAATCTGTTGG - Intergenic
1014993405 6:128110491-128110513 GCAAAAGGCTCCATATCTTTTGG + Intronic
1016229301 6:141783441-141783463 GAAAAAGGCTTGATATCTCTGGG - Intergenic
1019938783 7:4273305-4273327 GAAAATGCGTCCGTTTCTGTGGG + Intergenic
1020516460 7:9126823-9126845 TAAAAATGGTACATCTCTGTAGG + Intergenic
1021143732 7:17059511-17059533 ATAAAAGGGTCCATATGTGTAGG - Intergenic
1023206740 7:37758965-37758987 GCAAAAGGGTCTATTTCAGTAGG - Intronic
1024586106 7:50843364-50843386 AAAAAAGTGTACATATCTGTAGG - Intergenic
1029159408 7:98541048-98541070 GAAAAAGCATCCATATCAGCTGG + Intergenic
1031832174 7:126641289-126641311 GAAAAAGTCTGCAAATCTGTGGG + Intronic
1032977873 7:137246163-137246185 AAAAAATGGTACATCTCTGTAGG - Intronic
1033848139 7:145460767-145460789 GACAAAGGGTCCATATAAGATGG + Intergenic
1035077431 7:156190172-156190194 CAAAAAGGCTCCATATCTTGAGG - Intergenic
1038185477 8:25270135-25270157 GAAAAAAGGACCAAAACTGTGGG - Intronic
1042150842 8:65781876-65781898 GAAAAAGGCTGCACATTTGTGGG + Intronic
1043453369 8:80391018-80391040 GAAAAAGTATCTATATCTGCAGG + Intergenic
1043623243 8:82224235-82224257 GAAAAAGGGTCCAAATTACTTGG - Intergenic
1046483095 8:114849332-114849354 GAAAAGGGCTCCATATCTCCAGG + Intergenic
1046484814 8:114874024-114874046 GAAAAAGAGACCATATCTTTGGG + Intergenic
1048195087 8:132325974-132325996 GTAAAAGGGACAATATTTGTTGG + Intronic
1049556052 8:143282745-143282767 GAAACAGGGTCCATGTCTCCAGG - Intergenic
1050363877 9:4856158-4856180 GATAAACAGTCCACATCTGTGGG - Intronic
1052282737 9:26751812-26751834 TAAAAGGGGGCCATAGCTGTAGG - Intergenic
1053009680 9:34625892-34625914 GAACAAGGGTCCCTAGCTGAAGG + Intronic
1054854744 9:69886498-69886520 GAAAAAGGCACTATATTTGTGGG + Intronic
1055653807 9:78434209-78434231 GAAAAAGGGACAATTTCTGCAGG + Intergenic
1057253270 9:93521328-93521350 GAAAAAGGGGCCACATGTGGTGG + Intronic
1058956155 9:109950623-109950645 GAAAAAGGGTCTTGATCTCTTGG - Intronic
1061762528 9:132860339-132860361 GAAAAAGGGCCCTTATCTTTGGG + Intronic
1187221355 X:17329255-17329277 GAAAAAGCTTCTATTTCTGTAGG + Intergenic
1189307231 X:39995965-39995987 GAAGAAGTGGCCAGATCTGTAGG - Intergenic
1189681472 X:43520734-43520756 GAAAAAGTGTCCAGATGTGGTGG - Intergenic
1196118763 X:112025810-112025832 GAGAAAGGGGGTATATCTGTGGG - Intronic