ID: 1127604517

View in Genome Browser
Species Human (GRCh38)
Location 15:60573005-60573027
Sequence CTGAGTAAGTACATGAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127604514_1127604517 5 Left 1127604514 15:60572977-60572999 CCGAGAGTGTATTTTTATTTTAA 0: 1
1: 0
2: 8
3: 142
4: 1266
Right 1127604517 15:60573005-60573027 CTGAGTAAGTACATGAGTGTGGG 0: 1
1: 0
2: 0
3: 18
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127604517 Original CRISPR CTGAGTAAGTACATGAGTGT GGG Intronic
900580936 1:3408608-3408630 GTGTGTGAGTGCATGAGTGTGGG + Intronic
900978214 1:6030824-6030846 ATGTGTAAGTATATGTGTGTAGG + Intronic
903945025 1:26957273-26957295 CTGAGTAAGGCCAGGAGAGTAGG - Intronic
905660806 1:39722784-39722806 CTGAATACATACATAAGTGTAGG + Intronic
906716051 1:47970042-47970064 ATGAGTAAGTGCTTGAGTGTGGG - Intronic
907516544 1:54996717-54996739 TTAAGTAAGGACATGTGTGTAGG - Intergenic
910471385 1:87556749-87556771 CTGAGTAGGTAAAAGAGTGATGG + Intergenic
911224031 1:95284639-95284661 CTGAGTAAGTGTTTAAGTGTTGG - Intergenic
912671220 1:111628013-111628035 CTTACTAAGTACATGATTGGAGG + Intronic
914198463 1:145463494-145463516 CTGAGTCAGTCCCTGAGTGGGGG - Intergenic
914477569 1:148036622-148036644 CTGAGTCAGTCCCTGAGTGGGGG - Intergenic
914513972 1:148357909-148357931 CTGAGTCAGTCCCTGAGTGGGGG - Intergenic
916470080 1:165115131-165115153 GTGAGTAGGTGCGTGAGTGTGGG - Intergenic
917486638 1:175460898-175460920 ATGAGCATGTACATGTGTGTGGG - Intronic
919418611 1:197342342-197342364 CTCATTAAGTCCATGATTGTTGG - Intronic
923423898 1:233848625-233848647 CTGAGTAAGAACGAGAGTGTTGG - Intergenic
1063330208 10:5151088-5151110 CTGAGTCAGTTCATGGGTGGGGG + Intergenic
1063538651 10:6910222-6910244 TGGAGTAAGTAGATGAGTGGAGG + Intergenic
1066260860 10:33728534-33728556 CTGAGTCAGTTCCTGAGTGGGGG - Intergenic
1067307112 10:45074153-45074175 ATGAGAATGTACATGCGTGTTGG - Intergenic
1067451445 10:46384458-46384480 CTGAGTAAGGACAAGTGTGGGGG - Intronic
1067585796 10:47475298-47475320 CTGAGTAAGGACAGGTGTGGGGG + Intronic
1067823419 10:49550750-49550772 CTGAGTCAGTTCCTGAGTGTGGG + Intergenic
1071424295 10:85532947-85532969 CTGAGTCAGTTCCTGAGTGGGGG - Intergenic
1072076959 10:91986352-91986374 CTTAGTAAGTGCATGAGATTAGG + Intronic
1072785974 10:98282546-98282568 CTGTGTGTGTACATGTGTGTTGG + Intergenic
1078258437 11:9681592-9681614 CTGGGTAAGTTGGTGAGTGTGGG + Intronic
1078551636 11:12285167-12285189 CTGAGTCAGTTCCTGAGTGGGGG + Intronic
1078991183 11:16648050-16648072 ATGAGTGAGTGCAGGAGTGTAGG + Intronic
1079547633 11:21653370-21653392 TTGAGTAAGTACATGAACTTTGG - Intergenic
1079604967 11:22353963-22353985 CTGAGTCAGTAGATGTGTTTGGG - Intronic
1080889418 11:36396666-36396688 CTGAGTGACTACCTGAGGGTTGG - Intronic
1081689427 11:45067243-45067265 ATGAGTAAGTTCATGCATGTGGG - Intergenic
1085016203 11:73175671-73175693 CTGGGTAAGAACAAGAGTGCAGG - Intergenic
1088749756 11:112833826-112833848 CTGAGTCAATACATCTGTGTTGG + Intergenic
1090070009 11:123535883-123535905 CTGAGTAGGTTCCTGAGTCTGGG + Intronic
1090257265 11:125293760-125293782 CTGTGTCAGTATGTGAGTGTGGG - Intronic
1090929870 11:131287602-131287624 ATGAATAAGTAAATGAATGTTGG + Intergenic
1091956013 12:4643858-4643880 CTGAGTTTTTACATGAGTTTAGG - Intronic
1094491129 12:30961413-30961435 CTGACTAACCACATGATTGTGGG - Intronic
1095220196 12:39602759-39602781 CTTACTAACTACATTAGTGTGGG - Intronic
1096012866 12:48236247-48236269 CTGAGTCAGTTCCTGAGTGGGGG - Intergenic
1099696536 12:86028808-86028830 CTGAGAAAGTAAATAAGTGGGGG + Intronic
1099719096 12:86338266-86338288 CTGAGTCAGTTCCTGAGTGGGGG + Intronic
1100810127 12:98329605-98329627 CTGAGTGAGCACGTGAGAGTAGG - Intergenic
1102165435 12:110802458-110802480 ATGAGTGAGTCTATGAGTGTGGG + Intergenic
1104929608 12:132331263-132331285 CTGTGTATGCACATGTGTGTAGG + Intergenic
1108528406 13:51305126-51305148 CTGAGCAATTACATGATAGTGGG + Intergenic
1110356637 13:74575130-74575152 CTGATTGAGTAAATGAGTGATGG - Intergenic
1111679164 13:91423225-91423247 CTGGTTAAGTGCATGAGTTTTGG + Intronic
1111897235 13:94156858-94156880 CTAAGTAATTAGATGAGTGCTGG + Intronic
1112028332 13:95433675-95433697 CTGAGGAAGTACAGGAATTTAGG - Intronic
1113323747 13:109264139-109264161 CTGAGTGGGCATATGAGTGTGGG - Intergenic
1114977821 14:28123753-28123775 CTGAGTCAGTTCCTGGGTGTGGG - Intergenic
1115704792 14:35987931-35987953 CTGAGTCAGTTCCTGAGTGGGGG - Intergenic
1116374329 14:44178879-44178901 CACAGAAAGTACATTAGTGTGGG + Intergenic
1117496995 14:56315336-56315358 CTGAGTTAGTTCCTGAGTGTGGG - Intergenic
1118088243 14:62443067-62443089 CTGAGTAAGTTCCTGGGTGGGGG - Intergenic
1121883212 14:97518687-97518709 CTGAGTATGTATATATGTGTGGG - Intergenic
1121932661 14:97987112-97987134 CTGAGGAAGTGCATGAGTAATGG + Intergenic
1124018784 15:25901568-25901590 CAGAGTATGTACATGAGGGTGGG - Intergenic
1126512386 15:49493762-49493784 TTGCTTAAGTAGATGAGTGTAGG - Intronic
1126545079 15:49864415-49864437 CTGATTAAGTTCAAGAATGTTGG + Intronic
1127604517 15:60573005-60573027 CTGAGTAAGTACATGAGTGTGGG + Intronic
1129953841 15:79615318-79615340 CAGAGTTAGTCCATGGGTGTAGG - Intergenic
1131753529 15:95535949-95535971 CTGAGTTTGTGTATGAGTGTGGG + Intergenic
1133728997 16:8562800-8562822 ATGAGTGAGTAAATGAGTGAGGG + Intergenic
1133729003 16:8562860-8562882 ATGAGTGAGTAAATGAGTGAGGG + Intergenic
1133729048 16:8563781-8563803 CTGAGTGAGTAAATGAGTGAGGG + Intergenic
1133729087 16:8564449-8564471 GTGAGTGAGTAAATGAGTGAGGG + Intergenic
1135971242 16:27073577-27073599 ATGAGTGAGCACATGAGTGAAGG + Intergenic
1140056392 16:71529641-71529663 GTGAGTAAATAGATGAGTGTGGG - Intronic
1140671960 16:77288048-77288070 ATGAATAAATGCATGAGTGTAGG - Intronic
1141872864 16:86800823-86800845 CTGAGAATGGACATGAATGTGGG - Intergenic
1142321322 16:89384833-89384855 GTGTGTAAGAACATGTGTGTGGG + Intronic
1145325008 17:21815547-21815569 CTGAGTCAGTTCCTGGGTGTGGG + Intergenic
1146081316 17:29783136-29783158 CTGAGTCAGTTCCTGAGTGGGGG + Intronic
1146814886 17:35934743-35934765 CTGAGTGAGGACAGGAGTCTTGG + Exonic
1147235327 17:39052965-39052987 CTGAGTGAGAACAGGAGTCTTGG - Intergenic
1147664192 17:42135613-42135635 ATGTGTAAGTCCATGAATGTGGG + Intronic
1148596124 17:48857100-48857122 CTGAGCAAGAACATGAGAATGGG - Intronic
1152128338 17:78460862-78460884 ATGAGTATGTACATGAATGAAGG - Intronic
1153788641 18:8557318-8557340 CTGATTACGTTCATGAGTGAAGG - Intergenic
1154109679 18:11555820-11555842 CTGAGTCAGTGAATGAGTGGTGG + Intergenic
1155730613 18:29153132-29153154 CTGAGGAAGTACATTAGTCTGGG + Intergenic
1157300500 18:46475620-46475642 ATGTGTGTGTACATGAGTGTGGG - Intergenic
1158179242 18:54695175-54695197 CTAAGTAAAGACAGGAGTGTGGG - Intergenic
1158544776 18:58386741-58386763 CTGTGTAGGTACCTGAGTGAAGG - Intronic
1159112612 18:64076733-64076755 CTGAGTCAGTTCTTGAGTGGGGG - Intergenic
1163085717 19:14978588-14978610 CTGAGGGTGTACATGAATGTGGG - Intronic
925714935 2:6775360-6775382 CTGACTCAGTTCATGTGTGTCGG - Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
931067198 2:58600195-58600217 CTTAGAAAGGACATGAGGGTGGG - Intergenic
931837125 2:66110854-66110876 CAGAGCAAGTACATCAGGGTGGG + Intergenic
935960650 2:108422709-108422731 CTGAGAAAGAAGATGAGAGTAGG - Intergenic
937010543 2:118559030-118559052 CTGAGTCAGTTCCTGAGTGGAGG + Intergenic
939223712 2:139338002-139338024 TTGAGTAACTACATGACTGGTGG + Intergenic
942925245 2:181424830-181424852 CTGAGTAAGTGAGTGAGTGGGGG + Intergenic
947014216 2:225600216-225600238 CTGAGTAAGTTCCTGAGTGGAGG + Intronic
947688635 2:232114026-232114048 CTGAGTCAGTTCCTGAGTGGAGG - Intronic
1169726689 20:8741390-8741412 ATGAGTAAGTAGATGAATGATGG + Intronic
1169740468 20:8888233-8888255 CTGAAGAAGTACATGAGGGATGG + Intronic
1170068207 20:12338418-12338440 CTCAGTAAGTAAATCAGAGTAGG - Intergenic
1171029119 20:21661387-21661409 TTGAGTACCTACATGAATGTTGG + Intergenic
1173096415 20:40033661-40033683 CTAAGTGAATAAATGAGTGTAGG - Intergenic
1178469724 21:32881573-32881595 CGGAGTAAGAAGATGAATGTTGG + Intergenic
1179191441 21:39125671-39125693 GTGTGTGAGTACATGTGTGTTGG - Intergenic
1181488165 22:23244689-23244711 CTCAGTAAGTACATTTGTCTGGG + Intronic
1182482134 22:30615880-30615902 CTGAGTCAGCACAAGATTGTGGG + Intronic
1183062155 22:35342802-35342824 CTGTGTAGGTGTATGAGTGTAGG - Intronic
1183127539 22:35798949-35798971 CTGAGTTAATACATCAGTTTAGG - Intronic
1183722602 22:39571245-39571267 CTCAGAAAGTCCTTGAGTGTGGG + Intronic
1184739612 22:46419990-46420012 TTGAGTATGCACATGATTGTGGG - Intronic
949997584 3:9630641-9630663 CTGAGTAAGTTCCTGGGTGGGGG + Intergenic
950824645 3:15805000-15805022 CTACGTAAGTACATGTGTGTTGG - Intronic
951927135 3:27920761-27920783 GTGAGTGAGTACATTTGTGTTGG + Intergenic
954583672 3:51717304-51717326 CTGTGTAAGTGCATGTATGTGGG - Intronic
956300767 3:67770286-67770308 CTGAGTCAGTTCTTGAGTGGGGG + Intergenic
959793087 3:110388221-110388243 CTGAGTGAGTATAGGTGTGTGGG - Intergenic
959910805 3:111761690-111761712 CTGATTCAGTACATGTGGGTGGG + Intronic
960830727 3:121844019-121844041 CTGACTTAGTTCATGAATGTTGG - Intronic
963503211 3:146154406-146154428 CTGTGCAAGTTCATGAGTGATGG - Intronic
963671955 3:148261981-148262003 ATAAGTAAGTACATGAATTTGGG + Intergenic
963999968 3:151758829-151758851 ATGAGTATGTGCATGTGTGTGGG + Intronic
964068536 3:152604525-152604547 CTGAGTAAGTTCCTGGGTGGGGG + Intergenic
969402972 4:6969118-6969140 CTCACTAAGTAAATCAGTGTTGG + Intronic
970138442 4:12952749-12952771 CTGAGTTAGTCCAGGAGTGGTGG + Intergenic
976413843 4:84748397-84748419 CTGAGGAATTACATGTGTGCTGG - Intronic
976618748 4:87106047-87106069 CTGATGATGTAGATGAGTGTGGG - Intronic
977779152 4:100959915-100959937 GTGATTAAGTCCATGAATGTGGG + Intergenic
980497098 4:133600179-133600201 CTGAGTTAGTTCCTGAGTGGAGG - Intergenic
981218379 4:142200096-142200118 CTGAATAAGTAAATGAATGGAGG - Intronic
983422337 4:167535174-167535196 CTGAGTGAGTCAATGAGTGAGGG - Intergenic
986034405 5:3924337-3924359 CTGAGTGTGTTCATGTGTGTGGG + Intergenic
986212195 5:5684454-5684476 CTGAGTCAGTTCCTGAGTGGGGG + Intergenic
986615964 5:9617849-9617871 CCGAGTATGTACATGTGTGCTGG - Intergenic
989654693 5:43733900-43733922 GTGGGTAGGTACATGAGTGGTGG - Intergenic
990726541 5:58761637-58761659 GTGAGTGTGTACATGTGTGTGGG - Intronic
991213901 5:64138830-64138852 TTGAGTATGTACCTCAGTGTGGG - Intergenic
991425988 5:66492222-66492244 CTGAGTCAGTTCCTGAGTGAGGG + Intergenic
991604553 5:68387667-68387689 CTGAGTCAGGTCATGAGTGGAGG - Intergenic
992661151 5:78962068-78962090 CTGATTAAGTACATGAGGTCTGG + Intronic
997886635 5:137636327-137636349 CTGAGTGTGTACATGAGAGATGG + Intronic
999529124 5:152442842-152442864 CTGAGTCAGTTCCTGAGTGGAGG - Intergenic
1000762534 5:165244095-165244117 CTCAGTAAGAACATGAGTGAAGG - Intergenic
1003258304 6:4492928-4492950 CATAGTAGGTACATGAGTATGGG + Intergenic
1006069995 6:31491285-31491307 CTGAGTCAGTTCCTGAGTGGGGG + Intergenic
1006416960 6:33910395-33910417 CTGAGGATGTACAGGAGAGTAGG + Intergenic
1007573260 6:42908516-42908538 TTCAGTAAGTCCATGAGTGGTGG - Intergenic
1011394154 6:86888592-86888614 TTGAGTAAGTAAATGAGTCTCGG - Intergenic
1011723457 6:90183782-90183804 CTGAGTTAGTTAATGAGTGATGG + Intronic
1013748711 6:113376024-113376046 TGGAGTAAGTACATGCGTATGGG - Intergenic
1016690754 6:146935182-146935204 CAGAAGAAATACATGAGTGTAGG - Intergenic
1017355886 6:153507201-153507223 ATGAGTATGTACAGCAGTGTGGG - Intergenic
1018228265 6:161651399-161651421 CTGAATAAGTCCCTGAGGGTGGG + Intronic
1018491490 6:164298401-164298423 CTGAGTTAGAACCTGAGTGTTGG - Intergenic
1019282706 7:208379-208401 ATGGGTATGTACATGACTGTGGG + Intronic
1023238960 7:38121789-38121811 CTGAGTAACTTCATGACTGTTGG + Intergenic
1024079010 7:45840380-45840402 CTGAGTCAGTTCCTGAGTGGGGG + Intergenic
1024386036 7:48753043-48753065 CTGAGTAAGTGGCTGAGTGAGGG + Intergenic
1025125766 7:56343566-56343588 CTGAGTCAGTTCCTGAGTGGGGG - Intergenic
1027467672 7:78535896-78535918 CTGAGTCAGTTCCTGAGTGTTGG - Intronic
1027980744 7:85218054-85218076 CTGAGTAATGCCAGGAGTGTAGG + Intergenic
1028123530 7:87084879-87084901 CTGAGTGACTACATGATTGTAGG - Intergenic
1028698122 7:93741363-93741385 CTGAATAAGTAAATGAATGGAGG - Intronic
1029428238 7:100511133-100511155 CAGAGTAAGTAAAGGAGGGTGGG + Intergenic
1031702286 7:124941607-124941629 CTGAGTCAGTTCCTGAGTGGGGG + Intergenic
1036256856 8:7213090-7213112 CAGAGTTAGTACAAGAGGGTCGG - Intergenic
1036308906 8:7671689-7671711 CAGAGTTAGTACAAGAGGGTCGG - Intergenic
1038485097 8:27929392-27929414 CTGGGTAGGTACATGTGTATGGG + Intronic
1038595692 8:28883806-28883828 TTGAGTAAATACATGAATGATGG + Intronic
1042973020 8:74431864-74431886 CTTAGTAAATACGTGATTGTGGG + Intronic
1045256066 8:100523427-100523449 CTGAGAAAGTAAATGTCTGTTGG + Intronic
1045559924 8:103251373-103251395 GTGAGTAAGAGCATGTGTGTTGG - Intergenic
1046140954 8:110091124-110091146 ATGAGTATGTAAATGAGTCTGGG - Intergenic
1048674254 8:136759601-136759623 CTGAGTGAGTATATGTGTGTGGG + Intergenic
1053451097 9:38194772-38194794 CTGAGTCAGTTCCTGAGTGGGGG - Intergenic
1055693221 9:78856428-78856450 GTGAGTAAGAGCATGAGGGTGGG + Intergenic
1056296713 9:85200629-85200651 TTGAGTCAGGACATGAGTGGCGG + Intergenic
1057270773 9:93649901-93649923 ATGAGTATGTCTATGAGTGTTGG - Intronic
1057714969 9:97485844-97485866 CATAGTATGTACATGAGTTTTGG - Intronic
1058980150 9:110161521-110161543 CTGGGTAAGTTCCTGAGAGTGGG - Intronic
1059446464 9:114341370-114341392 TTGAGTGACTATATGAGTGTTGG + Intronic
1060702553 9:125770539-125770561 CTGAGTAAGAACCTGAGTTTGGG - Intronic
1188060850 X:25599769-25599791 CTGAGTTAGAACATCAGGGTAGG + Intergenic
1188686469 X:33076129-33076151 CTGAGTCAGTTCCTGAGTGGGGG - Intronic
1195415578 X:104616671-104616693 CTGAGTCAGTACCTGGGTGGGGG - Intronic
1196089983 X:111730032-111730054 CTGATTAACTACATGACTTTAGG - Intronic
1196943142 X:120797533-120797555 CTGACTAAGAACATGTGGGTGGG - Intergenic
1197484186 X:127026877-127026899 CTGGTTAATTACATGAGTTTTGG + Intergenic
1198842820 X:140877069-140877091 CTCAGTGAGTATATGAGAGTAGG + Intergenic
1199988473 X:152969669-152969691 CTAAGACAGTAGATGAGTGTTGG + Intronic