ID: 1127605112

View in Genome Browser
Species Human (GRCh38)
Location 15:60579105-60579127
Sequence ATGAAGAATACCATGACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127605111_1127605112 21 Left 1127605111 15:60579061-60579083 CCGGTTTTTTTTTTTTTTTTTTT 0: 1074
1: 33570
2: 37782
3: 77809
4: 142926
Right 1127605112 15:60579105-60579127 ATGAAGAATACCATGACTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 155
1127605110_1127605112 22 Left 1127605110 15:60579060-60579082 CCCGGTTTTTTTTTTTTTTTTTT 0: 347
1: 7723
2: 54644
3: 72903
4: 130393
Right 1127605112 15:60579105-60579127 ATGAAGAATACCATGACTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 155
1127605109_1127605112 27 Left 1127605109 15:60579055-60579077 CCGCGCCCGGTTTTTTTTTTTTT 0: 6
1: 198
2: 1808
3: 11579
4: 47150
Right 1127605112 15:60579105-60579127 ATGAAGAATACCATGACTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 155
1127605108_1127605112 30 Left 1127605108 15:60579052-60579074 CCACCGCGCCCGGTTTTTTTTTT 0: 1
1: 81
2: 921
3: 7702
4: 39544
Right 1127605112 15:60579105-60579127 ATGAAGAATACCATGACTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127605112 Original CRISPR ATGAAGAATACCATGACTGC TGG Intronic
900912996 1:5615328-5615350 ATGAAAGATACAATGGCTGCAGG + Intergenic
902944959 1:19828809-19828831 ATTAAGAATAGAATTACTGCTGG - Intergenic
904755336 1:32765761-32765783 ACGAACACCACCATGACTGCGGG - Intronic
905456117 1:38088969-38088991 ATGCAAAATACCATCACAGCCGG + Intergenic
909390806 1:75119319-75119341 GTGAAGAATAGAATGAATGCTGG + Intergenic
910359417 1:86400130-86400152 ATGAAGAATACAAAGATTGTGGG - Intergenic
912195169 1:107389267-107389289 GTGAAGAAAAACATGAATGCAGG - Intronic
917179488 1:172279850-172279872 ATGAAGAACACACTAACTGCAGG - Intronic
921500039 1:215890581-215890603 GTGATTTATACCATGACTGCTGG - Intronic
923439985 1:234008225-234008247 ATGGAGGACACCATGATTGCTGG + Intronic
923861198 1:237893802-237893824 ATGAATACTACCATGACTATGGG - Intergenic
924038362 1:239958262-239958284 ATGAAGGATACCAGGGCTGGTGG - Intergenic
924389558 1:243537991-243538013 ATCAAGAAAACAATGACGGCAGG + Intronic
1065274156 10:24068289-24068311 CTGAAGAATACAATAACTGAGGG - Intronic
1065338599 10:24680796-24680818 GTGGAGAAACCCATGACTGCTGG - Intronic
1067381005 10:45773347-45773369 ATGAAGAATACCTTTGTTGCAGG - Exonic
1067888704 10:50113986-50114008 ATGAAGAATACCTTTGTTGCAGG - Exonic
1069409697 10:68140718-68140740 ATGAAGAATAGCTTGACTGTTGG + Intronic
1069804784 10:71113904-71113926 ATGAATTATACCATGACTAGTGG + Intergenic
1070064458 10:73019603-73019625 CTGAAGAATTCAATGAATGCAGG + Intronic
1071575161 10:86719984-86720006 ATGAAGAATAACAGAGCTGCAGG + Intronic
1072552114 10:96487008-96487030 GTGAACAATACGAAGACTGCAGG - Intronic
1074904658 10:117850985-117851007 ATGAAGAAAAAAATAACTGCAGG + Intergenic
1078599056 11:12714773-12714795 AGCAAGAAGACCATTACTGCAGG - Intronic
1080124427 11:28715646-28715668 GTGAAGAATATAATGACTACTGG + Intergenic
1081451583 11:43175737-43175759 ATGAAGAATACCATTTATTCTGG + Intergenic
1082685497 11:56233126-56233148 ATGAACAACACCATGACTCAAGG + Exonic
1082879007 11:58019822-58019844 AGGAAGAACACCATGTCTTCAGG - Intergenic
1083504500 11:63143256-63143278 ATGAAGAATGAGCTGACTGCAGG + Intronic
1083525664 11:63362179-63362201 ATGCAGTATACCTTCACTGCAGG - Intronic
1088381751 11:109200723-109200745 ATGAAGACTACCCTGACACCTGG + Intergenic
1088901738 11:114123252-114123274 ATGTAGGATAACATGGCTGCTGG + Intronic
1091020204 11:132092672-132092694 ATCAAGAAAACAATGACTGAGGG - Intronic
1091147705 11:133294342-133294364 AGGAAGAATTCTATCACTGCTGG + Intronic
1091190172 11:133687068-133687090 CTGAAGGAGAGCATGACTGCGGG + Intergenic
1095792813 12:46185805-46185827 AGGAATAAGTCCATGACTGCTGG - Intronic
1096403561 12:51326366-51326388 ATGGAGAATAGCAGTACTGCGGG + Intergenic
1106107499 13:26745714-26745736 ATGAAGACTACTATAACTACAGG - Intergenic
1107433804 13:40363817-40363839 ATGAAGAATAACACGACTCTAGG - Intergenic
1108779973 13:53817896-53817918 ATGCACAAGACCTTGACTGCTGG + Intergenic
1110927458 13:81172949-81172971 ATGAAGGTTACAAAGACTGCTGG + Intergenic
1112562640 13:100527717-100527739 ATGCAGAATAGTATGACAGCTGG + Exonic
1113548341 13:111172417-111172439 CTGGAGAATGCCATGACTTCAGG - Intronic
1113673146 13:112188554-112188576 GTGTAGAATACCATGACAGTGGG + Intergenic
1116163284 14:41298470-41298492 AGGAAGAATCCCATAATTGCAGG - Intergenic
1117922096 14:60735454-60735476 ATGAAGAAAACCCGGACTGTAGG + Intronic
1118090111 14:62465302-62465324 ATGGAGAACAGCATGACTGTGGG - Intergenic
1118551931 14:66961743-66961765 ATGAATAATACCAACAATGCTGG + Intronic
1119157553 14:72424907-72424929 ATGAAGACAACCATCACTGAAGG - Intronic
1120629583 14:86873592-86873614 ATGAAGTTTACTATGACTGAAGG + Intergenic
1121664302 14:95660262-95660284 ATGAAGAAGCCCAGGACTGGAGG - Intergenic
1124451107 15:29791687-29791709 ATGAAGAATAGCATGGAGGCCGG - Intronic
1127605112 15:60579105-60579127 ATGAAGAATACCATGACTGCTGG + Intronic
1127936942 15:63650051-63650073 ATGAATAAGACCATGAAGGCAGG + Intronic
1128493480 15:68174322-68174344 AAAAAGAAGACCATGACTGAAGG - Intronic
1130563894 15:84979275-84979297 ATGAACAATCCCAGTACTGCTGG - Intergenic
1133146972 16:3795187-3795209 AAGCAGAACACCATGAATGCAGG + Intronic
1145841935 17:28002486-28002508 ATAAAAAATACCATGACTAGTGG - Intergenic
1146388472 17:32399049-32399071 ATGAAGAATACAGTGACTACTGG + Intergenic
1146657648 17:34644484-34644506 ATGAAGAATACCCAGTCTGATGG + Intergenic
1150331256 17:64296158-64296180 ATGAAAATTACCATGGATGCAGG - Intergenic
1152991870 18:370989-371011 ATGAAGAATACAATGAAGTCTGG + Intronic
1156615517 18:38779347-38779369 ATGAACAGTACAATAACTGCAGG + Intergenic
1157090903 18:44635723-44635745 ATAAAGAATACCAGGAATGTGGG - Intergenic
1158950378 18:62488820-62488842 GTGAAGAATACCATGACTAATGG - Intergenic
1159225791 18:65534010-65534032 TTCAAGAATAACATGATTGCTGG - Intergenic
1159226231 18:65539387-65539409 TTCAAGAATAACATGATTGCTGG + Intergenic
1160297133 18:77649211-77649233 ATCCAGACTACCATGACTGTGGG - Intergenic
1165398819 19:35584495-35584517 ATGAAGAATATCCTGACTTCTGG + Intergenic
1165777021 19:38410763-38410785 ATGCAGAAGTCCTTGACTGCTGG - Intronic
1166922414 19:46238639-46238661 ATAAAGAATAGCATGGCTGGAGG - Intergenic
1168121273 19:54253845-54253867 CTGAAGAATCCCATCAATGCAGG + Intronic
925394607 2:3524136-3524158 GTGAAAAACACAATGACTGCTGG + Intergenic
927696469 2:25242804-25242826 ATGAAGCAAACAATGCCTGCAGG + Intronic
932001999 2:67893704-67893726 ATGAAGATGACCATGACTCATGG + Intergenic
934630693 2:95917715-95917737 ATGAAGACTCTCAGGACTGCTGG + Intronic
936669162 2:114636386-114636408 TTGAAAAATACCTTGATTGCTGG + Intronic
937800827 2:126078458-126078480 GTGTGGAATACCATGATTGCTGG - Intergenic
938382113 2:130842531-130842553 ATGAAGAATCCAAGGACTGCCGG - Intronic
939060530 2:137416361-137416383 ATGAAGAGTCCCATGACAGGAGG - Intronic
943593355 2:189826069-189826091 ATGGAGAATATCATGAGTGCAGG - Intronic
944405869 2:199382761-199382783 ATGAAAAATCCCATGTCTCCAGG + Intronic
944948002 2:204712802-204712824 AGGAAGATTACTATGACTGGAGG - Intronic
945613127 2:212030863-212030885 ATTTACAATACCATGACGGCTGG - Intronic
947467327 2:230362895-230362917 AAAAAGAATAACATGACTGGAGG + Intronic
947776252 2:232712489-232712511 GTGAAGAATATAGTGACTGCTGG + Intronic
948542516 2:238700655-238700677 AAGAAGGAGACCTTGACTGCAGG - Intergenic
1168855949 20:1009120-1009142 ATGAAAAATACCATAACTGGGGG + Intergenic
1170601463 20:17844505-17844527 ATGAAGAGTGCAAAGACTGCTGG - Intergenic
1174979216 20:55373830-55373852 ATGTAGAATACCATAGCTTCGGG + Intergenic
1176894067 21:14354705-14354727 ATGATGAATACCAAGATTGATGG - Intergenic
1177149722 21:17443330-17443352 ATGAAGAAAACAATTACTTCTGG - Intronic
1178385718 21:32148381-32148403 ATGAAGAAAACCATGCCTAGGGG + Intergenic
1181993479 22:26856442-26856464 ATGTTGGGTACCATGACTGCTGG - Intergenic
1182280563 22:29215722-29215744 ATGCACAGTACCATGCCTGCTGG + Intronic
1185101445 22:48843038-48843060 ATAAAGGATTCCAGGACTGCAGG - Intronic
949630998 3:5926266-5926288 ATGAAGGATAACATGGATGCTGG - Intergenic
950573372 3:13815816-13815838 ATGAAGCAAAACATGACTGTGGG - Intergenic
953541046 3:43818476-43818498 ATGAATAATACCACAACTACTGG + Intergenic
954239504 3:49282627-49282649 ATGAAGTATAGCATGTCAGCAGG - Intronic
957804430 3:85128968-85128990 ATGAAAAATACCACATCTGCTGG - Intronic
958063636 3:88514387-88514409 AAGAAGTATAACATCACTGCAGG + Intergenic
958878728 3:99645237-99645259 TTGATGAACACCATGACTCCTGG - Intronic
959917692 3:111836341-111836363 ATGAAGAAATTCATGAATGCTGG + Intronic
960010660 3:112831421-112831443 GTGAAGAATACAATGACTATTGG + Intronic
961706340 3:128788914-128788936 ATGAAGAAGGTGATGACTGCAGG + Intronic
962220807 3:133563201-133563223 ATGTAGAACACCATCAGTGCCGG - Intergenic
965842204 3:172919312-172919334 ATGAAAAATACCATAGCAGCAGG + Intronic
965951286 3:174310860-174310882 ATGAAGAACACAATCACTGCAGG - Intergenic
966392280 3:179465305-179465327 ATGAAGAATACCATTATGGCCGG + Intergenic
970512562 4:16795629-16795651 ATGAACAATACCATGAATGGAGG + Intronic
971297385 4:25408985-25409007 AAAAAGAATACAGTGACTGCTGG + Intronic
980702786 4:136454698-136454720 ATGAAGGTTACCATGTCTGGAGG - Intergenic
982869726 4:160563130-160563152 ATGAAGAATTTCAGAACTGCAGG + Intergenic
984455332 4:179959376-179959398 ATGATGAATAGCATTTCTGCAGG - Intergenic
988094826 5:26592147-26592169 TTCAAGAATACCATTACTCCTGG - Intergenic
990046228 5:51435159-51435181 ATGAACAATACCATGATTTTAGG + Intergenic
991016152 5:61934694-61934716 ACCAAGAATTCCAGGACTGCTGG + Intergenic
991244168 5:64491185-64491207 TTGAAGAATATGATGACTGTAGG - Intergenic
993505691 5:88706276-88706298 ATAAAGTATTCCATGACTGTTGG - Intergenic
996747859 5:126860910-126860932 ATGAAGAAGAGGATAACTGCAGG + Intergenic
998553113 5:143096717-143096739 GTGAAGAATACAATGACTATTGG + Intronic
998612284 5:143702452-143702474 ATGATCAATACCATGAATTCTGG - Intergenic
999529742 5:152449792-152449814 ATGAAGAAAACAATGATTTCTGG + Intergenic
1001171451 5:169423406-169423428 ATCAAGAATTCCATCACTGCGGG - Intergenic
1004345708 6:14847293-14847315 AAGAATAATACCAGGACTGGTGG + Intergenic
1004460187 6:15828168-15828190 ATGGAGAAGACCAAGACAGCTGG + Intergenic
1005587054 6:27287077-27287099 ATAAAGAAAAACATGACTGGGGG + Intronic
1006660325 6:35636675-35636697 GTGGAAAATACCATGACTACTGG + Intronic
1009391516 6:63149223-63149245 AGGAAGAATACCATGAGCACAGG + Intergenic
1009854189 6:69239981-69240003 ATGAAAAATAACAGGCCTGCAGG - Intronic
1009899477 6:69794258-69794280 GTGAAGAATACAATGATTACTGG - Intronic
1010371315 6:75111470-75111492 ATGAAGCATTCCATGACAGTTGG + Intronic
1013899253 6:115133250-115133272 AAGAAGAATACAATGATTACTGG + Intergenic
1015383881 6:132600520-132600542 ATGGAGAATAAAATGACTCCTGG + Intergenic
1016119777 6:140331537-140331559 ATGTTGAATACCATGACGGTGGG + Intergenic
1016889497 6:148992031-148992053 GTGAAGAATACCATGACCTGTGG + Intronic
1020337675 7:7074793-7074815 ATGAAGAATAGTATCACTGAGGG - Intergenic
1020749260 7:12119869-12119891 GTGAAAAATACCATGACTTTAGG + Intergenic
1020900704 7:13999778-13999800 AAGCAGAATACCATTACTTCAGG + Intergenic
1025262108 7:57426380-57426402 ATGAGGAAGACCATCACCGCGGG - Intergenic
1027466154 7:78516843-78516865 ATAAACAATACCAAGACTGGGGG + Intronic
1030480244 7:110094356-110094378 AGTAAGAATAGCATGAGTGCAGG + Intergenic
1032819019 7:135507528-135507550 ATGAAGAATTCAGTAACTGCGGG + Intronic
1035495127 7:159318372-159318394 AAGAAGAATACAATGATTGGTGG - Intergenic
1035616767 8:1007708-1007730 ATGAAGGTTTCCATCACTGCTGG - Intergenic
1039045981 8:33449808-33449830 ATGAAGAACAGCATGAATGGAGG - Intronic
1040889695 8:52304129-52304151 ATGAAGATTAAAATAACTGCAGG + Intronic
1042819194 8:72911613-72911635 TTGGAGACTACCATGACAGCTGG - Intronic
1043606928 8:82012275-82012297 ATGGAGGATACCATTACTACAGG + Intergenic
1047060652 8:121220946-121220968 AAAAAGAATACCTTGAATGCAGG + Intergenic
1050694021 9:8259566-8259588 ATTAAAAATTCCTTGACTGCAGG + Intergenic
1052730927 9:32284305-32284327 ATGAAGAATACAGTGAAAGCTGG - Intergenic
1053595626 9:39558104-39558126 AACAAGAACACCATGTCTGCTGG - Intergenic
1053853592 9:42314736-42314758 AACAAGAACACCATGTCTGCTGG - Intergenic
1054881977 9:70153662-70153684 ATGAAGATTTTAATGACTGCTGG - Intronic
1056037055 9:82617994-82618016 ATGAAGAAGACCATGATTTTGGG + Intergenic
1056414879 9:86366470-86366492 AGGAAGAATAACATGAGTACAGG + Intergenic
1057102882 9:92380158-92380180 ATAAAGAATATCATCACAGCAGG + Intronic
1058604442 9:106705691-106705713 ATGATGAGCACCATGACTTCTGG - Intergenic
1058704775 9:107629241-107629263 GTGGAGAGTACCAGGACTGCGGG - Intergenic
1058935420 9:109765412-109765434 ATGAAGACGGCAATGACTGCAGG - Intronic
1185600182 X:1333725-1333747 ATTAAGAAAACCATGGCGGCAGG - Intergenic
1187553532 X:20329286-20329308 ATGAAGAATACCACAATTACTGG - Intergenic
1193652270 X:84151802-84151824 ATGAAGACTACAATGACTACTGG + Intronic
1195080625 X:101366645-101366667 CTGACAAATACCATGATTGCTGG - Intronic
1197597383 X:128481807-128481829 ATGAAGAACTCCACTACTGCTGG - Intergenic
1200269894 X:154672772-154672794 ATGAAGAATACAATCACTTGTGG - Intergenic