ID: 1127606629

View in Genome Browser
Species Human (GRCh38)
Location 15:60592865-60592887
Sequence CTTTCTGCCCCCACTCGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 134}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127606623_1127606629 -1 Left 1127606623 15:60592843-60592865 CCGCGGAACGCGCCTCTGACCAC 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1127606629 15:60592865-60592887 CTTTCTGCCCCCACTCGGTGGGG 0: 1
1: 0
2: 0
3: 14
4: 134
1127606622_1127606629 0 Left 1127606622 15:60592842-60592864 CCCGCGGAACGCGCCTCTGACCA 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1127606629 15:60592865-60592887 CTTTCTGCCCCCACTCGGTGGGG 0: 1
1: 0
2: 0
3: 14
4: 134
1127606621_1127606629 1 Left 1127606621 15:60592841-60592863 CCCCGCGGAACGCGCCTCTGACC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1127606629 15:60592865-60592887 CTTTCTGCCCCCACTCGGTGGGG 0: 1
1: 0
2: 0
3: 14
4: 134
1127606619_1127606629 25 Left 1127606619 15:60592817-60592839 CCGGTCGCTTTTCTGCACGCAGC 0: 1
1: 0
2: 0
3: 4
4: 79
Right 1127606629 15:60592865-60592887 CTTTCTGCCCCCACTCGGTGGGG 0: 1
1: 0
2: 0
3: 14
4: 134
1127606618_1127606629 28 Left 1127606618 15:60592814-60592836 CCGCCGGTCGCTTTTCTGCACGC 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1127606629 15:60592865-60592887 CTTTCTGCCCCCACTCGGTGGGG 0: 1
1: 0
2: 0
3: 14
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127606629 Original CRISPR CTTTCTGCCCCCACTCGGTG GGG Intronic
900151229 1:1180129-1180151 CTTTCTGCCCCCTCCAGGTCCGG - Exonic
900372706 1:2339323-2339345 GTTTCTGCTGCCACACGGTGGGG + Intronic
901452658 1:9345338-9345360 CTTTCTGCTTCCACTCTTTGGGG + Intronic
903547614 1:24136574-24136596 CTTGCTGCTCCCACTCTCTGGGG - Intronic
904028841 1:27521462-27521484 CGTTCTGCGCCCACTCACTGGGG - Intergenic
904521712 1:31100909-31100931 CTTTCTGCACCCTCTGGCTGGGG - Intergenic
904607098 1:31704023-31704045 CTCTCTTCCCCCACCCGGAGTGG - Exonic
906560339 1:46752015-46752037 CTGGCTGCCCCCACTCAGTTCGG + Intergenic
913580706 1:120224391-120224413 CTGTCTGCCCCTACTGGGGGGGG + Intergenic
914562637 1:148835831-148835853 CTGTCTGCCCCTACTTGGGGGGG + Intronic
914610192 1:149294391-149294413 CTGTCTGCCCCTACTGGGGGGGG - Intergenic
914938242 1:151999573-151999595 CTGTCTGCCCCCACACAATGGGG - Intergenic
915105621 1:153533603-153533625 TCTTCTGTCCCCACTGGGTGGGG - Intergenic
915634021 1:157173945-157173967 CTTTGAGCCCCCTCTCGATGGGG - Intergenic
915658367 1:157380543-157380565 CTTTGAGCCCCCTCTCGATGGGG - Intergenic
915844674 1:159251515-159251537 CCTTCTGCCCCCAGTCGGCTTGG - Intergenic
916663595 1:166945889-166945911 CTTTCTTCCCCAGCTCCGTGTGG + Intronic
917596314 1:176532642-176532664 CTTCCTGTCCCCACATGGTGTGG + Intronic
921321735 1:213947316-213947338 CTTCCTGCCCACCCTTGGTGGGG - Intergenic
922056025 1:222043405-222043427 TTTCCTGTCCCCACACGGTGAGG - Intergenic
1064992418 10:21267471-21267493 CTTTCTTCCCACCCTCGTTGTGG + Intergenic
1067702208 10:48582103-48582125 CTCTCTGCCCCCAAGCTGTGGGG + Intronic
1067779411 10:49188612-49188634 CTTTGTTCCCACACTCTGTGGGG - Intergenic
1071575896 10:86726088-86726110 CCCGCTGCCCCCACTGGGTGCGG + Intronic
1073082487 10:100868731-100868753 CTTTCTGCCCTCTCTCTGGGAGG - Intergenic
1074443469 10:113498748-113498770 CAATCTGCCCCAACTGGGTGTGG - Intergenic
1075491973 10:122879383-122879405 TTTTCTGCCTCCACTCCGTCGGG - Intronic
1075644959 10:124091474-124091496 CTTTCTGCCCCAACGCTGGGTGG + Intronic
1076423509 10:130351171-130351193 ATCTCTGCCCCCACCCTGTGTGG - Intergenic
1076478978 10:130771935-130771957 CATTCTGCCACAACTCGGCGCGG - Intergenic
1076827135 10:132974713-132974735 CTTGCTGCCCACACACGGTGCGG + Intergenic
1080100889 11:28458014-28458036 CCTTCTGCCCCTACAGGGTGAGG - Intergenic
1084371604 11:68749035-68749057 CTTTCTGACTCCACTCTGTGAGG + Intronic
1084372930 11:68756518-68756540 CCTTCTCCTCCCACCCGGTGAGG - Exonic
1086219109 11:84420333-84420355 CTTTCTTCCCCCACTCTGAATGG + Intronic
1089848522 11:121477600-121477622 CTTTCTGCCCCCACATGCTTGGG + Intronic
1092320650 12:7470812-7470834 CTTTGTGCCCTCACCAGGTGTGG + Exonic
1094430703 12:30366761-30366783 CTGTCTGCCCCTACTGGGAGGGG + Intergenic
1095419844 12:42013730-42013752 CTTTTTGCCCCCTCTCTCTGAGG + Intergenic
1095626854 12:44325302-44325324 ATGTCTGCCCCCACTTAGTGTGG - Intronic
1102201060 12:111058201-111058223 CTTTCTGTCCCCAGACAGTGTGG + Intronic
1102779706 12:115553468-115553490 CTCTCTGCTCCCACAAGGTGTGG + Intergenic
1106582335 13:31028980-31029002 CTCTCTGCCCTCACTCACTGAGG - Intergenic
1110418529 13:75278617-75278639 CTTTCTTCCCACACTCCTTGGGG - Intergenic
1113716890 13:112516373-112516395 CCTCCAGCCCCCACTGGGTGCGG - Intronic
1118285287 14:64465450-64465472 CTGTCTGTCCCCGCGCGGTGGGG + Intronic
1120940606 14:89945109-89945131 TTTTCCCCCCCCACTCAGTGTGG + Intronic
1121845926 14:97172230-97172252 CTCTCTGCCCCCACATGGTGAGG + Intergenic
1121872093 14:97417613-97417635 CTTTCTGCCCCCAGTCCATGCGG - Intergenic
1122423632 14:101592637-101592659 CTATCAGCCCCCACTCCATGAGG - Intergenic
1122986418 14:105213750-105213772 CTTTCTGGCCCCCCAGGGTGAGG - Intronic
1124079433 15:26477658-26477680 CCCTCTGCCCACACTTGGTGGGG + Intergenic
1124405889 15:29391220-29391242 CTTTCTGCCCCCTCTCCTTAGGG + Intronic
1127606629 15:60592865-60592887 CTTTCTGCCCCCACTCGGTGGGG + Intronic
1128846693 15:70904453-70904475 CTTTGTGCTCCCATTCTGTGAGG - Intronic
1130866328 15:87936076-87936098 CTCTCTGGCCCCTCTCCGTGGGG + Intronic
1131328880 15:91477494-91477516 CTTTCTGTCCACACTTGGTGTGG + Intergenic
1137391036 16:48081723-48081745 TTTTCTGCCCACACTCGCTTTGG - Intergenic
1138353137 16:56357333-56357355 CTTTCTATTCCCAATCGGTGAGG + Intronic
1142918612 17:3164255-3164277 CTCCCTGCCCCCTTTCGGTGTGG + Intergenic
1144462915 17:15472630-15472652 CTTTCAGCCCCCAGTCTCTGGGG + Intronic
1146696054 17:34909740-34909762 AACTCTGCCCCCACTGGGTGTGG - Intergenic
1152139907 17:78530180-78530202 CTTTCTGCTCACGCTTGGTGGGG + Intronic
1154502052 18:15001957-15001979 CGTGCAGCCCCCACTGGGTGCGG - Intergenic
1157470823 18:47986776-47986798 CTTTCTGCCCCCTATGGATGGGG + Intergenic
1160735687 19:661393-661415 CTTTCTGTCCCCACTGGCCGTGG - Intronic
1161166280 19:2789547-2789569 CTTGTTCCCCCCACTGGGTGTGG + Intronic
1167791903 19:51688531-51688553 CTTTGAGCCCCCAGTGGGTGGGG + Intergenic
925103882 2:1272690-1272712 CTTTCTGCACCCGCTCCCTGGGG - Intronic
925103890 2:1272717-1272739 CTTTCTGCACCCGCTCCCTGGGG - Intronic
925103898 2:1272744-1272766 CTTTCTGCACCCGCTCCCTGGGG - Intronic
925103906 2:1272771-1272793 CTTTCTGCACCCGCTCCCTGGGG - Intronic
925103914 2:1272798-1272820 CTTTCTGCACCCGCTCCCTGGGG - Intronic
925831684 2:7902680-7902702 ATTTCTGCCCCCACTGTGTAGGG + Intergenic
929280448 2:40072469-40072491 CCTTCTGCCCCCAGTCAGTTTGG + Intergenic
934752293 2:96800817-96800839 CTCTCTGTTCCCACTTGGTGTGG + Intronic
935029938 2:99312046-99312068 CTTTCTGCCCCTTCTCTGAGGGG - Intronic
938103419 2:128513489-128513511 CTTTGTGACCCCATTCTGTGTGG + Intergenic
938501230 2:131832129-131832151 CATGCAGCCCCCACTGGGTGTGG - Intergenic
939319644 2:140601634-140601656 TTTTCTTCCCCCACTAGATGTGG - Exonic
946335443 2:219032437-219032459 CTCCCTGCCCTCACTCGCTGTGG + Intronic
1168937040 20:1674430-1674452 GTTTCTGTCCCCAGTCTGTGAGG + Intergenic
1171331333 20:24341341-24341363 TTTTCTGCCCCAACTCTGTCAGG - Intergenic
1172023156 20:31929836-31929858 CTTTTTACCCTCACTGGGTGTGG + Intronic
1174137346 20:48389279-48389301 CATTCTGCCCCCACTCCCTTTGG + Intergenic
1175680424 20:60984240-60984262 CTTCCTGCTCCCACTTGGTGGGG - Intergenic
1175944108 20:62550855-62550877 CTCTCTGCCCCCACCAAGTGCGG + Exonic
1178051490 21:28752718-28752740 ATTTCTGCCCCCATCCGATGAGG - Intergenic
1178687863 21:34725489-34725511 CGTTCTGCCCCCTCTAGATGGGG - Intergenic
1179823089 21:43948301-43948323 CGTTCTTCCCTCCCTCGGTGAGG - Intronic
1180944895 22:19687532-19687554 CTTTCTGCCCCCACGCCCTGCGG + Intergenic
1181456957 22:23065221-23065243 CCTTCTTCCCCCACTCCCTGAGG + Intronic
1184221696 22:43104857-43104879 CTTTCTGCCCACACTTTGGGAGG + Intergenic
1184698255 22:46151262-46151284 CTTTGTGCCCCAACGCGGCGGGG + Intronic
951141412 3:19166061-19166083 CTTTCAGCTCCCACTCACTGTGG - Intronic
951452444 3:22854364-22854386 CCTTCTCTCCCCACTTGGTGGGG - Intergenic
953868922 3:46609453-46609475 GTTCCTGCCCCCACTGGGGGAGG + Intronic
955871412 3:63442366-63442388 CTTTGGGTCCCCACTCGGTGCGG - Intronic
959653647 3:108776365-108776387 CCTTCTCCCCCCACTGGGTTGGG - Intergenic
960993382 3:123325868-123325890 CTTCCTCCCCCTACTCTGTGGGG + Intronic
963088223 3:141457936-141457958 CCTTCTGCCCTCACTTTGTGTGG + Intergenic
966988879 3:185208204-185208226 CTTTCAGCCCACAGTCAGTGAGG + Intronic
968625767 4:1626027-1626049 TTTCCTGCCCCGACTCGGTGTGG + Intronic
969458244 4:7313371-7313393 CTGTCTTCCCCCAGACGGTGAGG - Intronic
975148358 4:70994001-70994023 CTCTCTGCAGCAACTCGGTGAGG + Intronic
982924794 4:161321800-161321822 CCTGCTGCTCCCACTCTGTGAGG + Intergenic
987625594 5:20395811-20395833 CTTTCTGCCCTCACTGGAAGTGG - Intronic
990135551 5:52640256-52640278 CTCTCTGTCCCCACTATGTGAGG + Intergenic
997618537 5:135270158-135270180 CTTTTTCCCCCCACCCAGTGGGG + Intronic
1003419920 6:5948006-5948028 CTCTCTACACCCACTCAGTGGGG + Intergenic
1005367188 6:25090384-25090406 CTATCTGCCCCCATTTTGTGGGG - Intergenic
1006676903 6:35771189-35771211 CTTCCTTCTCCCACTCGGTGAGG - Intergenic
1006788940 6:36686282-36686304 GATGATGCCCCCACTCGGTGAGG - Exonic
1007711360 6:43826249-43826271 CTTTCTTCCCCCACTGGCAGAGG + Intergenic
1011618248 6:89217809-89217831 CTTCCTGCCCCCACTTCCTGTGG + Intronic
1014272197 6:119348519-119348541 CTTCGTGCCCCCAATCGGGGTGG - Exonic
1014397428 6:120943040-120943062 CTTTCTTCCCCCAATGGCTGTGG - Intergenic
1018703392 6:166445668-166445690 CTTTCTGTCATTACTCGGTGGGG + Intronic
1019253094 7:31025-31047 CTTTCTGTCCCGGCTCAGTGCGG - Intergenic
1019285233 7:219982-220004 CTTTGTGTCCACACTGGGTGTGG + Intronic
1019409683 7:901090-901112 CTCTCTGCCCACTCTCGGTAGGG - Intronic
1025158772 7:56635037-56635059 CTTTCTGCCCCCAGTCAGCTTGG - Intergenic
1035743824 8:1947420-1947442 CTTTCTGATCCCACCCGGAGAGG - Intronic
1036544034 8:9749292-9749314 CTATCTGCCCCCTGTTGGTGGGG - Intronic
1037411355 8:18601640-18601662 CCTTCTGCCTCCACTAGGTGAGG + Intronic
1039427873 8:37501684-37501706 CTCTCTGCCCTCACTCGCTGGGG - Intergenic
1042100746 8:65272632-65272654 CTTATTGCCCCTACTGGGTGGGG - Intergenic
1044869840 8:96607859-96607881 TTTCCTGTCCCCACTCTGTGGGG - Intronic
1045941996 8:107750031-107750053 ATTTTTGTCCCCACTCTGTGGGG - Intergenic
1046894774 8:119461597-119461619 CGTTCTGCCCCTACTGGGGGGGG + Intergenic
1047363440 8:124190697-124190719 ATTTCTGCCCCCAAGCTGTGAGG - Intergenic
1049487819 8:142875636-142875658 CTGTCTGCCACCACCCAGTGGGG + Intronic
1049492594 8:142913209-142913231 CTGTCTGCCACCACCCAGTGGGG + Intronic
1049646588 8:143738444-143738466 CTCACTGACCCCACTCGGTGGGG + Intergenic
1057440169 9:95077280-95077302 CTTTCTGCTCCCACCCTGTCTGG - Intronic
1059378697 9:113906960-113906982 ATTTCTGCCACCACTTGGAGAGG - Intronic
1060052147 9:120385183-120385205 CTTGCTGACCACACTAGGTGTGG + Intergenic
1060891113 9:127189124-127189146 CTTTGTGGCCTCACTCAGTGAGG + Intronic
1061783334 9:133008375-133008397 GTTTCTGCCCCCACTTGAAGAGG - Intergenic
1062493725 9:136821867-136821889 CTGGCTGCCCCCAGCCGGTGCGG + Intronic
1062526564 9:136980268-136980290 CTTCCTGCCCCAAACCGGTGAGG + Exonic
1189442287 X:41048284-41048306 TTCTCTGACCCCACTGGGTGTGG + Intergenic
1189655545 X:43240753-43240775 CTGTCTGCCCCGACTTGGAGAGG - Intergenic
1190903164 X:54698223-54698245 CAGTCTGCCCCTACTCGGGGGGG - Intergenic
1194460516 X:94161628-94161650 CTCTCTGTTCTCACTCGGTGAGG - Intergenic
1195599343 X:106727511-106727533 CTTTCTGTCCCCACGGAGTGGGG + Intronic
1196400296 X:115309005-115309027 TTTTGTACCCCCACTAGGTGTGG + Intergenic
1197215038 X:123859814-123859836 CTTACTGCCCCCATCCGGTTCGG + Intronic
1200122407 X:153797408-153797430 CCTTCTGCCCCCTCTGGGTGTGG - Intronic