ID: 1127607028

View in Genome Browser
Species Human (GRCh38)
Location 15:60596692-60596714
Sequence CTGCTGTTTATGAGTATAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127607026_1127607028 -2 Left 1127607026 15:60596671-60596693 CCAACAGTAAGACAAGGAACTCT 0: 1
1: 0
2: 2
3: 13
4: 143
Right 1127607028 15:60596692-60596714 CTGCTGTTTATGAGTATAAAGGG 0: 1
1: 0
2: 0
3: 14
4: 143
1127607024_1127607028 5 Left 1127607024 15:60596664-60596686 CCAGAAGCCAACAGTAAGACAAG 0: 1
1: 1
2: 1
3: 25
4: 216
Right 1127607028 15:60596692-60596714 CTGCTGTTTATGAGTATAAAGGG 0: 1
1: 0
2: 0
3: 14
4: 143
1127607023_1127607028 6 Left 1127607023 15:60596663-60596685 CCCAGAAGCCAACAGTAAGACAA 0: 1
1: 0
2: 4
3: 23
4: 274
Right 1127607028 15:60596692-60596714 CTGCTGTTTATGAGTATAAAGGG 0: 1
1: 0
2: 0
3: 14
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127607028 Original CRISPR CTGCTGTTTATGAGTATAAA GGG Intronic
903099050 1:21012025-21012047 GTTCTATTTAAGAGTATAAAGGG + Intronic
905046693 1:35009436-35009458 CTAATGTTTCTGAATATAAATGG - Intronic
915713602 1:157924211-157924233 CAGATATTTATGAGTATCAAAGG - Intergenic
916280092 1:163040613-163040635 ATAATGTTTAAGAGTATAAAGGG - Intergenic
916412787 1:164562751-164562773 CTTGTGTTTATGAGAATACAGGG + Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918376983 1:183919008-183919030 ATGCTGTTTCAGAGTATAAAGGG - Intronic
923042205 1:230327430-230327452 CTGCTGTTTCTGAGGAAAGAAGG - Intronic
924055676 1:240121962-240121984 CTGATATTTCTGAGTCTAAATGG + Intronic
1064644079 10:17442930-17442952 CTGCTGTTCTAGATTATAAATGG + Intronic
1064798288 10:19039086-19039108 CTGCTGTTGATGAGCACACAGGG - Intergenic
1065893564 10:30141383-30141405 ATGATGTTTAAGAGTGTAAAGGG + Intergenic
1066603262 10:37132325-37132347 ATGCAGTTAATAAGTATAAATGG + Exonic
1067401226 10:45975637-45975659 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1067869578 10:49945215-49945237 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1079667026 11:23119105-23119127 CTGTTGTTTATTATTCTAAATGG - Intergenic
1083461010 11:62811885-62811907 CTGCTGGGTCTGAGGATAAAAGG - Intronic
1087739071 11:101867398-101867420 CAGCTGTTCATGAGTAGAGATGG + Intronic
1087919541 11:103850437-103850459 TTGCTGGTTTTGAGTATAAAAGG - Intergenic
1088465328 11:110129520-110129542 CTTCTGTATTTGTGTATAAAAGG + Intronic
1089326084 11:117658175-117658197 CTCCTGTTTATGCTTAAAAATGG - Intronic
1090184969 11:124732121-124732143 CTGCTGTTTATGAGGAATTAAGG - Intergenic
1090476410 11:127025593-127025615 ATGATGTTAATGAGAATAAAAGG + Intergenic
1091683760 12:2546770-2546792 CTGCTTTTAATCAGTTTAAATGG - Intronic
1097851141 12:64411538-64411560 CTGCTTTTTGTCAGTAAAAATGG + Intronic
1099223887 12:79945589-79945611 CCGCGGTTTAGGAGGATAAATGG - Intergenic
1099655577 12:85485528-85485550 CTGCTGTTTCTTAGTATATTTGG - Intergenic
1099674997 12:85747697-85747719 CTACTGTTTATATGTATAATTGG - Intergenic
1100702988 12:97167569-97167591 CAGCTGTTAATGAGAATGAAGGG + Intergenic
1102105392 12:110317235-110317257 CTGTTGTTTTTGAATCTAAATGG - Intronic
1104175991 12:126333135-126333157 CTGCTGCTTATTAATAGAAAGGG + Intergenic
1105681288 13:22730117-22730139 GTGCTGTGAATGACTATAAATGG - Intergenic
1108625408 13:52223882-52223904 CTGTTGTTTATGATTTTTAAAGG + Intergenic
1108660652 13:52582528-52582550 CTGTTGTTTATGATTTTTAAAGG - Intergenic
1110014069 13:70377610-70377632 CAGCTGTTTATGTGGATATATGG + Intergenic
1110843298 13:80167068-80167090 TTGTTGTTTATGAGTAGCAAAGG - Intergenic
1112645407 13:101325889-101325911 CTTCTGTTAATCAGTTTAAAAGG - Intronic
1113178014 13:107588593-107588615 CTGCTGTCTGTGAGTGTAAAAGG + Intronic
1113544090 13:111133474-111133496 CTGCCATTTCTGACTATAAAAGG - Intronic
1114995643 14:28348709-28348731 CAGCTGTTAAAGAGTACAAAGGG - Intergenic
1115744298 14:36420136-36420158 CTTCTGTTTATAAGAAAAAATGG - Intergenic
1116606489 14:47003410-47003432 CTGCTGTTGAAGAATGTAAAAGG - Intronic
1117739862 14:58806183-58806205 TTGCTGTTTCTGGGTATAGATGG - Intergenic
1119251987 14:73164206-73164228 CTGCTGTTTATTGAGATAAATGG + Intronic
1119811508 14:77524506-77524528 CTGCTGTTTATCCAAATAAAAGG + Intronic
1124428497 15:29585228-29585250 CTCCTGTTTAAGTGTATATAGGG - Intergenic
1127607028 15:60596692-60596714 CTGCTGTTTATGAGTATAAAGGG + Intronic
1133311751 16:4852491-4852513 CTGCTGGTGATGAAAATAAAGGG + Exonic
1134458474 16:14411796-14411818 CTGCTCTTTATCAGAATAAATGG + Intergenic
1136939017 16:34502560-34502582 CTGCTTTTTAAAAGTATATAAGG - Intergenic
1136960803 16:34845996-34846018 CTGCTTTTTAAAAGTATATAAGG + Intergenic
1137295131 16:47085033-47085055 CTGCTGTCTTAGAGGATAAAAGG + Intronic
1137633512 16:49965698-49965720 TTACTGTTTTGGAGTATAAAGGG + Intergenic
1138793875 16:59943625-59943647 ATGCTGTTTAAAAGTATTAAGGG + Intergenic
1139121891 16:64029799-64029821 CTGCTGTTTATGAGTATTTGCGG + Intergenic
1141253832 16:82382736-82382758 GTGCTGTTTCTGAGTAACAATGG + Intergenic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1144184877 17:12787747-12787769 ATGCTTTTTATGTGTATAAACGG - Intergenic
1146636972 17:34513734-34513756 CTACTGTTCTTGTGTATAAATGG + Intergenic
1147033522 17:37661715-37661737 CTGCTTATTATGAGGATGAAAGG + Intergenic
1152429149 17:80237825-80237847 CTGCTGTTTGTGGAAATAAAAGG + Intronic
1154345925 18:13543473-13543495 CTGCAATTTAAGAGTCTAAAAGG + Intronic
1155408700 18:25518222-25518244 CTGCTGTTTAAAAATATAATTGG + Intergenic
1156136607 18:34047504-34047526 CTTGTGTTTATGACTATCAATGG - Intronic
1157124487 18:44943172-44943194 CTCCTGTTCATGAGCATAAATGG + Intronic
1157238271 18:45984357-45984379 CTGCTGTTTGTGAGTGAAAAAGG + Exonic
1157743187 18:50111702-50111724 CTGCAGTTTATGCTGATAAAGGG + Intronic
1157899470 18:51500681-51500703 CTGCTGTTAATGAGTATTCATGG - Intergenic
1159283283 18:66314924-66314946 TCTGTGTTTATGAGTATAAAAGG - Intergenic
1164398221 19:27884762-27884784 GTGCTGTTACTGAGGATAAAGGG - Intergenic
1166268973 19:41701890-41701912 CTCCTGTTAATGAGCAAAAAGGG + Intronic
1168104144 19:54156344-54156366 TTGGTTTTTAAGAGTATAAAGGG - Intronic
925140716 2:1548194-1548216 CTCCTGTTTAGGAGTATGGAAGG + Intergenic
926524674 2:13963706-13963728 TTGCTGTTGATGTATATAAATGG + Intergenic
926783217 2:16494806-16494828 CTGCTCTTTATAAGTTTAGATGG + Intergenic
928717857 2:34083501-34083523 ATGCTGTTTATGAATAATAAGGG - Intergenic
931470274 2:62532299-62532321 CTGGTGTTTATGAGCCTAAATGG + Intergenic
933120630 2:78532676-78532698 CTCTTGTTTACCAGTATAAAAGG + Intergenic
937049245 2:118875190-118875212 CTGCTGTTTAAGAGTGGCAAGGG + Intergenic
937642894 2:124233894-124233916 CTGGTGTTTTTGAGTTTAAAAGG - Intronic
938002824 2:127758613-127758635 ATTCTCTTTATGAGTATAATGGG + Intronic
940185744 2:150983399-150983421 ATGCTTTTTGTGAGTAGAAATGG + Intergenic
943321808 2:186453895-186453917 CTGATGTTGATTAGTATAACTGG - Intergenic
943618516 2:190120679-190120701 CTGCTGATTATAAATATATAGGG - Intronic
945003860 2:205381794-205381816 CTGCAGTTAATGAGTAGGAAAGG + Intronic
945188378 2:207163047-207163069 TTGCTGCTTCTGAGTATAAGGGG - Intronic
945330358 2:208532228-208532250 CTGATTTTTAAGAGTGTAAAAGG + Intronic
1176364997 21:6027410-6027432 CTGCTGTTTCTGAGTCCACAGGG - Intergenic
1179758521 21:43511135-43511157 CTGCTGTTTCTGAGTCCACAGGG + Intergenic
949289169 3:2443856-2443878 CAGCTGATTTTGTGTATAAATGG + Intronic
952143926 3:30510979-30511001 TTGCTGTATAGGAGTGTAAATGG - Intergenic
953223115 3:40991631-40991653 CAGCTGTTTATGAGCATATGAGG - Intergenic
954832533 3:53434734-53434756 CTGCTCTTTAGGAATATAACTGG + Intergenic
955646650 3:61145956-61145978 CTGATGTTTATAAGTATGATGGG - Intronic
957008746 3:74981317-74981339 CTTGTGTTTATGAGAATAATTGG - Intergenic
957024577 3:75166957-75166979 CTGCAGTAAATGAGTTTAAAAGG + Intergenic
957748923 3:84386218-84386240 CTGGTGTTTATGAGAATCTATGG + Intergenic
958691814 3:97478912-97478934 CTGCTGTTTAGCAGTGAAAATGG + Intronic
959210044 3:103366917-103366939 GTGGTTTTTATGACTATAAAGGG + Intergenic
959331791 3:105015141-105015163 CTGCAGTTTATGAGAAAGAAAGG - Intergenic
960131802 3:114064728-114064750 CTGGTGTTTATGAAAATATATGG - Intronic
961706985 3:128794699-128794721 CTTCTGGTTATGAGTAGACAAGG + Intronic
962590720 3:136887374-136887396 CTGCTATTTATCAGGAGAAAAGG - Intronic
963508019 3:146212401-146212423 GTGCTGTTTGTGGGTATATATGG + Intronic
967497292 3:190155989-190156011 CTGCTGTTGATGACTAGAAGTGG + Intergenic
967900915 3:194451488-194451510 CTGCTGTTGCTGAATATAATGGG - Intronic
970512320 4:16793572-16793594 CTGCTTTTTGTATGTATAAATGG - Intronic
976764417 4:88584341-88584363 CTGATGTTTCTGAGGGTAAATGG - Intronic
979696794 4:123621831-123621853 CTTCTGTTTATTAGTAGAAGGGG - Intergenic
983461514 4:168029943-168029965 CTGTTGTGTATGTGTAAAAACGG + Intergenic
985096326 4:186416334-186416356 CTCCTGTTTTTGAGGAGAAAAGG + Intergenic
986017506 5:3770615-3770637 CTACAGTTTATAAGTATAGATGG + Intergenic
987627895 5:20426437-20426459 CTTCTATTTATGAGTAAATATGG + Intronic
987916337 5:24219504-24219526 ATGCTATCTATAAGTATAAATGG + Intergenic
989494509 5:42096423-42096445 TTGCTGTTAATGTGTATAAAGGG + Intergenic
990132486 5:52604057-52604079 CTGTTTTTTATGAGTAAAAATGG - Intergenic
991179079 5:63727742-63727764 TTGATGTTTATGAATATAAGTGG - Intergenic
991453014 5:66772684-66772706 CTGCTGTTTTAGGGTGTAAATGG + Intronic
991696857 5:69281081-69281103 CTGCTGTGTATGAAAACAAATGG - Exonic
992184822 5:74233749-74233771 GTGCTGTTAATGACTTTAAAAGG + Intergenic
993179792 5:84537985-84538007 GTGCTGTTTCTTAGTAGAAATGG + Intergenic
997042074 5:130268528-130268550 TTGATGATTATGAGTATATATGG + Intergenic
997177238 5:131792135-131792157 CTGCTGTTCATGATGATAACTGG + Intronic
997574774 5:134966228-134966250 TTGCTGTTGATGATTTTAAATGG + Exonic
1000913596 5:167052141-167052163 ATGTAGTTTATGATTATAAAAGG - Intergenic
1000931233 5:167254122-167254144 CTAGTCTTTATGAGTGTAAAGGG - Intergenic
1003209117 6:4043931-4043953 CTGATGTTAAAGAGTATGAACGG + Exonic
1003294169 6:4809360-4809382 CTGGTGTTTGTAATTATAAACGG + Intronic
1004754645 6:18598736-18598758 AAGCTCTTTATGAGTCTAAAGGG + Intergenic
1005527585 6:26666410-26666432 CTGCTGTTTTAGGGTATACAGGG - Intergenic
1005646334 6:27842246-27842268 CTGCTGATTATCTGTATTAATGG - Intronic
1007814583 6:44512141-44512163 CTACTGGTTTTGAGGATAAATGG + Intergenic
1008021415 6:46582277-46582299 CAGCTATTTCTAAGTATAAAAGG + Intronic
1009466393 6:63975166-63975188 TTGCAGTTTATGTGTATAAATGG + Intronic
1009965227 6:70570693-70570715 ATCTTGTTTATGATTATAAAGGG + Intronic
1010539904 6:77079973-77079995 TTGCTGTTGATGTATATAAATGG - Intergenic
1010787639 6:80023177-80023199 CTGATAATTAAGAGTATAAAAGG - Intronic
1012686886 6:102261660-102261682 CTGCTGGCTGTGATTATAAACGG - Intergenic
1014113184 6:117644227-117644249 TTGCTCTTCATGAATATAAAAGG - Intergenic
1018283702 6:162215255-162215277 CTGGTGTTGATGAATAAAAACGG + Intronic
1020954736 7:14726802-14726824 ATTGTGTTTATGATTATAAAGGG - Intronic
1021190299 7:17612668-17612690 ATACTTTTTAAGAGTATAAAAGG - Intergenic
1029928318 7:104342532-104342554 ATGCTATTTGTGGGTATAAAAGG - Intronic
1040495140 8:47959819-47959841 TTTCTGTGTATGTGTATAAAGGG - Intronic
1044249185 8:89986529-89986551 ATGCTTTTTTTGAGTAGAAATGG + Intronic
1046744454 8:117862167-117862189 CTGCTGTTAAAGAGTCTGAATGG + Intronic
1049655257 8:143794361-143794383 CTGTTGTTCATGAGGATGAAGGG + Intronic
1050876714 9:10648236-10648258 TTGATGTTTTTGAGAATAAAAGG + Intergenic
1052022273 9:23538946-23538968 ATTCTGTTGATGAGTGTAAATGG - Intergenic
1055278950 9:74651756-74651778 CTGCAGTTGATGAGTTTTAAGGG - Intronic
1058602665 9:106687292-106687314 CAGCTGTTGATGAGTGTACAGGG - Intergenic
1060213876 9:121726731-121726753 CTGCTTTGTGAGAGTATAAAAGG + Intronic
1060982071 9:127798722-127798744 CTGCTATATGTGGGTATAAAAGG + Intronic
1061602254 9:131678928-131678950 CTGCTTTTTATGAGTGAAACTGG + Intronic
1189186925 X:39062796-39062818 CTGCTGGCTATGAGAATACAAGG - Intergenic
1190882460 X:54501866-54501888 ATGCTTTTTAAGAATATAAAGGG + Intergenic
1191946533 X:66540405-66540427 ATGCTGATTAAGAGCATAAATGG - Intergenic
1198472600 X:136962418-136962440 CTGGTCTTTAAGTGTATAAATGG + Intergenic