ID: 1127611219

View in Genome Browser
Species Human (GRCh38)
Location 15:60639477-60639499
Sequence GTCCACTGGAAGCCGGGACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 124}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127611219_1127611229 25 Left 1127611219 15:60639477-60639499 CCACGTCCCGGCTTCCAGTGGAC 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1127611229 15:60639525-60639547 CTTCCGCTCAGATACTGTCAAGG 0: 1
1: 0
2: 1
3: 5
4: 56
1127611219_1127611225 -6 Left 1127611219 15:60639477-60639499 CCACGTCCCGGCTTCCAGTGGAC 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1127611225 15:60639494-60639516 GTGGACAGCCCTGTGAGATGGGG 0: 1
1: 0
2: 3
3: 35
4: 260
1127611219_1127611224 -7 Left 1127611219 15:60639477-60639499 CCACGTCCCGGCTTCCAGTGGAC 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1127611224 15:60639493-60639515 AGTGGACAGCCCTGTGAGATGGG 0: 1
1: 0
2: 3
3: 19
4: 191
1127611219_1127611223 -8 Left 1127611219 15:60639477-60639499 CCACGTCCCGGCTTCCAGTGGAC 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1127611223 15:60639492-60639514 CAGTGGACAGCCCTGTGAGATGG 0: 1
1: 0
2: 2
3: 23
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127611219 Original CRISPR GTCCACTGGAAGCCGGGACG TGG (reversed) Intronic
900946034 1:5831926-5831948 GCCCACTGGAAGCCCAGACGGGG + Intergenic
901198018 1:7451167-7451189 GTCAACTGGAGTCAGGGACGGGG - Intronic
901208013 1:7508335-7508357 GGCCCCTGGAAGCTGGGACGTGG + Intronic
901321078 1:8340247-8340269 GACCACTTGAACCCGGGAGGCGG - Intronic
901881553 1:12197032-12197054 GACCACTCGAACCCGGGAGGCGG - Intronic
911063944 1:93770917-93770939 TTCCACTGAGAGCCGGGACTGGG - Intronic
912439550 1:109687920-109687942 GTCCGCTGGACGGTGGGACGAGG + Intronic
915977337 1:160400149-160400171 ATCCAATGGAATCTGGGACGTGG - Intergenic
921041615 1:211438181-211438203 ATTCACTGGAACCCGGGAGGCGG + Intergenic
921950227 1:220921941-220921963 GTACACTGCAAGCCAGGAAGAGG + Intergenic
924707068 1:246510096-246510118 GTCCACTGGGAGTCGGGACATGG + Intergenic
924774383 1:247105604-247105626 GTCAACTCGAAGCCAGGAGGGGG + Intergenic
1065912201 10:30317942-30317964 AATCACTTGAAGCCGGGACGCGG - Intronic
1067062098 10:43082825-43082847 GTGCTCTGGGTGCCGGGACGAGG + Intronic
1070179264 10:73998434-73998456 GGCCACAGGCAGCCGCGACGCGG - Intronic
1072600700 10:96925160-96925182 AACCACTTGAACCCGGGACGCGG - Intronic
1075650315 10:124123779-124123801 GTCCACAGGAAGCAGGGAAATGG - Intergenic
1076414989 10:130279687-130279709 AACCACTGGAACCCGGGAGGAGG - Intergenic
1076664605 10:132079099-132079121 GGCCACTGTAAGCCGGGCCCAGG - Intergenic
1077339599 11:2020299-2020321 AACCACTGGAACCCGGGAGGCGG + Intergenic
1077532079 11:3102061-3102083 GTCCCCTGGAAGCCGGCCCTCGG + Intronic
1078949368 11:16112139-16112161 GTTCGGTGGAAGCAGGGACGAGG - Intronic
1083156298 11:60825332-60825354 AACCACTGGAAGCTGGGACGAGG - Intergenic
1083730693 11:64650916-64650938 GTCCTCTGGAGGCAGGGACTGGG + Intronic
1084709864 11:70837233-70837255 GTCCCCTGGAAGCCTGTAAGGGG - Intronic
1088886917 11:114015056-114015078 GTGCACTGGAAGGGGGGAGGGGG + Intergenic
1202822584 11_KI270721v1_random:75488-75510 AACCACTGGAACCCGGGAGGCGG + Intergenic
1092757815 12:11780591-11780613 GTCCACTGGCAGCCGAGCTGTGG - Intronic
1097021582 12:56024771-56024793 GTCCACAGGAAGCAGGGCTGAGG - Intronic
1101151395 12:101885816-101885838 GGCCACTGGGAGGCCGGACGCGG - Intronic
1111256732 13:85679378-85679400 CTCCACTTGAACCCGGGAGGCGG - Intergenic
1114166640 14:20225478-20225500 GATCACTTGAAGCCGGGAGGCGG - Intergenic
1115243448 14:31271777-31271799 GGCCACTCGAAGCAGGGAGGGGG - Intergenic
1117048724 14:51839286-51839308 GTCAACTTGAAGCAGGGAGGAGG + Intronic
1118252207 14:64172460-64172482 GGCCACTGGAAGCCCTCACGTGG - Intronic
1119169502 14:72523508-72523530 ATTCACTGGAAGCAGGGACTGGG + Intronic
1120845614 14:89122476-89122498 GTCCCTGGGAAGCCGGGAAGAGG + Intergenic
1121221364 14:92288132-92288154 GTCCCCTGGAAGCCGGGCTGGGG + Intergenic
1121249288 14:92487846-92487868 GACCACTGGAAGCTAGGAAGGGG - Intronic
1122122280 14:99560971-99560993 GTCCACTAGAAGCCTGGGCCGGG + Intronic
1122667283 14:103339943-103339965 AATCACTTGAAGCCGGGACGTGG - Intronic
1126425708 15:48525171-48525193 AATCACTGGAAGCCAGGACGTGG - Intronic
1127611219 15:60639477-60639499 GTCCACTGGAAGCCGGGACGTGG - Intronic
1131552054 15:93365601-93365623 GTCCAGGGGAAGCCAGGATGGGG + Intergenic
1131746931 15:95458827-95458849 GTCCACTGGAAACTGGAAAGAGG - Intergenic
1132843721 16:1990524-1990546 GTGACCTGGAAGCAGGGACGGGG + Intronic
1132886566 16:2184840-2184862 GGCCACTGGAGGCTGGGACCGGG + Exonic
1132889538 16:2196899-2196921 GTGCACTGGGAGCCCCGACGCGG + Intergenic
1133356315 16:5139603-5139625 GACCACAGGAAGCTAGGACGAGG + Intergenic
1134257059 16:12621256-12621278 CTCCACTTGTAGCCGGGACCTGG - Intergenic
1134411541 16:14006254-14006276 AACCACTTGAAGCCGGGAGGCGG + Intergenic
1136122170 16:28144920-28144942 GTCGAGTGGAAGCCATGACGGGG - Intronic
1139917680 16:70438608-70438630 GTGGACTGGAAGTCGGGACCAGG + Intronic
1140325070 16:73993645-73993667 ATCCACTTGAATCCGGGAGGTGG - Intergenic
1141660873 16:85440863-85440885 GTCCTCGGGAAGCCAGGCCGGGG - Intergenic
1142695130 17:1629154-1629176 GTCCGCTGGGGGCCGGGACGCGG - Intergenic
1145738989 17:27256162-27256184 GTCCTCTGGAAGCTGGAAGGAGG + Intergenic
1149425222 17:56548358-56548380 AATCACTGGAACCCGGGACGTGG + Intergenic
1149744482 17:59082182-59082204 AACCACTTGAAGCCGGGAGGCGG + Intronic
1150056826 17:62024685-62024707 GTCCAGTGGAGGCTGGGAGGAGG - Intronic
1152796358 17:82309512-82309534 GACCACTTGAACCCGGGAGGTGG - Intergenic
1158427256 18:57351831-57351853 ATCCACTGGAAGACGGAAAGGGG + Exonic
1159962006 18:74562728-74562750 GTCCTCTGGAGGCCGGAAAGAGG - Intronic
1161027513 19:2043298-2043320 GTCCACCGGAAGCTGGGACTGGG + Intronic
1161617274 19:5278561-5278583 GTCCACTTGAACCCAGGAGGCGG - Intronic
1162455286 19:10780336-10780358 GTCCAAGGGCAGCCGGGTCGGGG - Intronic
1164166687 19:22684396-22684418 GACCACTTGAACCCGGGAGGTGG - Intergenic
1164469644 19:28519274-28519296 GTTCACTGGAAGCAGCAACGTGG + Intergenic
1167230532 19:48280029-48280051 GCCCACTGGCAGCCAGGATGAGG - Intronic
1168431309 19:56283192-56283214 GTGCAGTGGGAGCAGGGACGTGG - Intronic
927164260 2:20301037-20301059 GACAACTGGAAGCTGGGAGGGGG - Intronic
927275311 2:21257477-21257499 GTCCTCTGCAAACCGGGAAGAGG - Intergenic
930510572 2:52338872-52338894 GACAACTGGAAGCAGGGAGGGGG + Intergenic
931867226 2:66426080-66426102 GGCCGCTGGAAGCCGGGAGAAGG + Intergenic
933284206 2:80366947-80366969 GACAACTGGAAGCAGGGAGGGGG + Intronic
934886835 2:98032355-98032377 GACCCCTGGAAGCCAGGAAGAGG - Intergenic
936572088 2:113625940-113625962 GACAACTGGAAGCAGGGAGGGGG - Intergenic
937925624 2:127165469-127165491 GGCCACAGGAAGCCGTGACTGGG + Intergenic
937940622 2:127282887-127282909 GTCCCCTGGAACCTGGGACCTGG + Intronic
938899920 2:135791219-135791241 GTCCATTGGAAGCCTGGAGCTGG - Intronic
942302537 2:174575465-174575487 GTCCACTGGAGGCCGAGAGCCGG - Intronic
946835013 2:223764003-223764025 AACCACTGGAACCCGGGAGGCGG - Intronic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1179248756 21:39655829-39655851 CTCCACTGGAAACTGGGATGGGG - Intronic
1179981841 21:44899916-44899938 GTACAGTGGAGGCCGGGAGGGGG + Intronic
1184398274 22:44258468-44258490 GCCCACTGGAGGCCGGAAGGTGG - Intronic
1185095061 22:48801814-48801836 GACAACTGGAAGCAGGGAGGGGG - Intronic
1185222197 22:49634685-49634707 GACCACTGGAAGTCGTGACGGGG + Intronic
1185406194 22:50652902-50652924 GACAACTGGAAGCGGGGAGGGGG - Intergenic
1185428103 22:50784940-50784962 GACAACTGGAAGCAGGGAGGGGG + Intergenic
950228490 3:11255692-11255714 GACAACTGGAAGCCGGGAGGAGG + Intronic
954174703 3:48835056-48835078 GACCACTTGAACCCGGGAGGCGG - Intronic
956692958 3:71894480-71894502 TTGCACTGGGACCCGGGACGGGG - Intergenic
959094193 3:101935272-101935294 TGCCACTGGAAGCCATGACGTGG + Intergenic
961013046 3:123448576-123448598 CTCCCCCGGAAGCCGGGCCGGGG + Exonic
962308238 3:134307608-134307630 GTCCATTTGAAGCCAGGACAAGG - Intergenic
966891985 3:184413786-184413808 GTCCTCTGAAAGCAGGGAAGAGG - Intronic
967059270 3:185857678-185857700 GTTCACTTGAACCCGGGAGGTGG + Intergenic
968699217 4:2046886-2046908 CTCCACAGGAGGCCGGGAGGTGG - Intergenic
969809029 4:9633575-9633597 GACCACAGGAAGCTAGGACGAGG - Intergenic
973774911 4:54233595-54233617 GTCCACTGGCTGCCCGGAGGAGG - Intronic
978834871 4:113136841-113136863 ATCCACTTGAACCCGGGAGGCGG - Intronic
982105610 4:152009371-152009393 GCCCACAGGAAGCCTGGAGGAGG - Intergenic
985790139 5:1922194-1922216 GGCCACTGGAAGGCCAGACGCGG + Intergenic
986249693 5:6044844-6044866 GTCCTCTGCAAGCCTGGAAGTGG + Intergenic
996817762 5:127592672-127592694 GACCACTTGAACCCGGGAGGTGG + Intergenic
1001607312 5:172970855-172970877 GTTCACTTGAACCCGGGAGGCGG - Intergenic
1002526176 5:179817183-179817205 GGTCACTGGAAGACGGGGCGCGG - Intronic
1002542814 5:179917346-179917368 GTCCACTGGAGGCAGGGGGGTGG + Intronic
1004155293 6:13162184-13162206 ATCCACTGGAACCCAGGAGGCGG - Intronic
1005746637 6:28844208-28844230 GTTCACTTGAACCCGGGAGGTGG + Intergenic
1017351012 6:153442238-153442260 GAAGACTGGAAGCAGGGACGGGG + Intergenic
1017941921 6:159060831-159060853 GACCACTGGAAGCCAGGAGAAGG + Intergenic
1018345781 6:162897918-162897940 GTCCCATGGAAGCCAGAACGAGG + Intronic
1019917737 7:4144318-4144340 GTCCACTGGAGGCAGGGCAGCGG + Intronic
1025875390 7:65476499-65476521 GTCTCCTGGAGGCTGGGACGAGG - Intergenic
1033052586 7:138019947-138019969 ATTCACTTGAAGCCGGGAGGTGG - Intronic
1034237111 7:149580533-149580555 GACAACTGGAAGCTGGGAGGGGG + Intergenic
1038956684 8:32475376-32475398 ATTCACTTGAAGCCGGGAGGTGG + Intronic
1039244769 8:35596697-35596719 CTCCCCTGGAAGCAGGGAGGGGG + Intronic
1045583165 8:103500594-103500616 GGGAACTGGAGGCCGGGACGCGG - Intergenic
1047558721 8:125963384-125963406 GACAACTGGAAGCAGGGAAGGGG - Intergenic
1048981080 8:139703653-139703675 GTCCCCTGCAAGCGGGGAGGGGG + Intergenic
1054452502 9:65410686-65410708 GACCACTGGAAGGAGGGAGGGGG + Intergenic
1058308854 9:103475696-103475718 ATCCACTTGAACCCGGGAAGTGG - Intergenic
1060733985 9:126054819-126054841 GTCCACTGGTAGCCAGGACTCGG - Intergenic
1203512490 Un_KI270741v1:134483-134505 GCCCACTGGAAGCCCTGGCGGGG - Intergenic
1185702974 X:2245269-2245291 GACAACTGGAAGCAGGGAGGGGG - Intronic
1186037622 X:5441731-5441753 GACCACTTGAACCCGGGAGGTGG + Intergenic
1186748655 X:12598174-12598196 TTTCACTGGAAGCCAGGAAGAGG + Intronic
1190264668 X:48820922-48820944 GATCACTTGAAGCCGGGAGGTGG - Intronic
1190732624 X:53235180-53235202 GACCCCTGGAAGCGGGGAGGGGG + Exonic
1195220187 X:102738970-102738992 GGCAACTGGAAGCAGGGAGGGGG + Intronic
1196813280 X:119645323-119645345 GATCACTTGAACCCGGGACGCGG - Intronic
1200074136 X:153542936-153542958 GTCTCCCGGAAGCAGGGACGCGG - Intronic