ID: 1127613031

View in Genome Browser
Species Human (GRCh38)
Location 15:60655708-60655730
Sequence TACTCATACCTGCTGAAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127613026_1127613031 29 Left 1127613026 15:60655656-60655678 CCTACTACTTCTACCTTCTCTGT 0: 1
1: 0
2: 1
3: 31
4: 362
Right 1127613031 15:60655708-60655730 TACTCATACCTGCTGAAGAAGGG 0: 1
1: 0
2: 0
3: 15
4: 154
1127613028_1127613031 16 Left 1127613028 15:60655669-60655691 CCTTCTCTGTCTCTTTGGATGTT 0: 1
1: 1
2: 108
3: 6748
4: 3406
Right 1127613031 15:60655708-60655730 TACTCATACCTGCTGAAGAAGGG 0: 1
1: 0
2: 0
3: 15
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127613031 Original CRISPR TACTCATACCTGCTGAAGAA GGG Intronic
901158248 1:7155036-7155058 TACTCATCCTGGCTGGAGAAGGG - Intronic
901763518 1:11485765-11485787 TCCTCATACCTGCTCAGCAAGGG + Intronic
906825662 1:48976896-48976918 TTGTGATACATGCTGAAGAAAGG - Intronic
907739335 1:57149250-57149272 TATTCATAATAGCTGAAGAATGG - Intronic
910839738 1:91549335-91549357 TACTCAGACAAGATGAAGAAGGG - Intergenic
912318382 1:108687352-108687374 AATGCATACTTGCTGAAGAATGG - Intergenic
912508169 1:110170798-110170820 TGCACATACATGCTGAGGAATGG - Intronic
915664342 1:157431043-157431065 TACGCATTTCTGATGAAGAAAGG + Intergenic
919301181 1:195768344-195768366 TACTGATACATGCTGCAGCATGG - Intergenic
920108254 1:203569620-203569642 TTCTCCTTCCTGCAGAAGAACGG + Intergenic
924784723 1:247184385-247184407 TGGTGACACCTGCTGAAGAAGGG - Intergenic
1063612580 10:7575593-7575615 TACTCATCCCCGCAGCAGAATGG + Intronic
1067115830 10:43435022-43435044 TACTCATGCTAGCTGAAGAAGGG + Intergenic
1071120816 10:82276241-82276263 TACAAATACCTGTTCAAGAATGG + Intronic
1072318339 10:94224863-94224885 TACTCATAGCTGCAGGAGACGGG + Intronic
1080193598 11:29581170-29581192 TCCTAATAGCTGCTGAAGAGTGG - Intergenic
1080194370 11:29591466-29591488 TATCCAGACCTACTGAAGAAAGG + Intergenic
1080343121 11:31292449-31292471 TACTGATACTTGCTAAAAAATGG + Intronic
1081797449 11:45831058-45831080 TACTGATACATGCTGCAGCATGG + Intergenic
1085199779 11:74694882-74694904 CACTCATCCCTGCTCAATAAGGG + Intergenic
1087715506 11:101604141-101604163 TAATCCTACCTGTGGAAGAAAGG + Intronic
1090094134 11:123726980-123727002 TACTCCTATCTCCTGTAGAAAGG + Exonic
1090905526 11:131071237-131071259 TGCTCCTGCCTCCTGAAGAATGG + Intergenic
1091502728 12:1034905-1034927 AACCCATATGTGCTGAAGAATGG + Intronic
1092296975 12:7208591-7208613 TGGTGACACCTGCTGAAGAAGGG + Exonic
1094756873 12:33481503-33481525 TACTGATACATGCTGAAATATGG + Intergenic
1095659539 12:44714837-44714859 TAGTCATACATGTTGAAAAAAGG - Intronic
1096570134 12:52518155-52518177 TCCTCATACCTGGTGGTGAAAGG + Exonic
1096653264 12:53072700-53072722 TCCTCATACCTGCTTTAGTATGG - Intronic
1097098709 12:56570886-56570908 TACTCATAACAGCTTCAGAAAGG - Intronic
1097931264 12:65189492-65189514 CACTCATCCCTGCTGATGAATGG - Intronic
1098655335 12:73021662-73021684 TATTCATACCTGCTTCAGAAGGG - Intergenic
1099153161 12:79140706-79140728 TCCTCATACATGCTGAAGTTTGG + Intronic
1105010772 12:132755170-132755192 TACTAACACCTGCTGAAGCTGGG + Intronic
1106865424 13:33959275-33959297 TTCTCATACCTGCAGAATACAGG + Intronic
1106962572 13:35016566-35016588 TACACATACAAGCTGAAGGACGG - Intronic
1107239585 13:38215910-38215932 TACTCAAAACTGCTGTGGAATGG + Intergenic
1107613170 13:42136845-42136867 TACTCACATCTGCTGTGGAAAGG - Intronic
1109113763 13:58355069-58355091 TTCTCATACATTCTGCAGAATGG + Intergenic
1111200083 13:84924856-84924878 TACTCAAAACTTCAGAAGAAAGG - Intergenic
1112235857 13:97635980-97636002 TATTCTTAACTGCTGTAGAATGG + Intergenic
1115335664 14:32242317-32242339 TACTCATGCCTGCTGAGAATGGG + Intergenic
1115900389 14:38140749-38140771 GACCCAAACCTGCTGAAGAAGGG - Intergenic
1116691903 14:48118335-48118357 TAATCATACCTACTTAAGAAAGG - Intergenic
1116975683 14:51113428-51113450 TACTCTCTCCTGCTGAACAATGG + Intergenic
1119370294 14:74134685-74134707 CACTCATATCTGCTCAAGAGTGG + Intronic
1120449088 14:84643068-84643090 TACTCATCCCTCCTTAAAAAAGG + Intergenic
1121399075 14:93656156-93656178 AACTCACCCCTGCTGCAGAAGGG - Intronic
1121678886 14:95776433-95776455 TACTCACACCTTCCCAAGAAAGG + Intergenic
1122897366 14:104766721-104766743 TACCCACACCTGCTGAAACATGG + Intronic
1127254564 15:57278312-57278334 TACTATTAGCTGCAGAAGAAAGG + Intronic
1127613031 15:60655708-60655730 TACTCATACCTGCTGAAGAAGGG + Intronic
1128670414 15:69570588-69570610 TCCTCTTCCCTGATGAAGAAAGG + Intergenic
1129892308 15:79079278-79079300 TTCTCATACTTGCTGAATGAAGG + Intronic
1131049512 15:89337235-89337257 TACTGATTCCTGCTGAGGGAGGG + Intergenic
1131096492 15:89658068-89658090 TACTGATATCTGATGAACAATGG - Intergenic
1134182626 16:12059978-12060000 TAATCATACCTACTTAAGAAGGG - Intronic
1139624477 16:68175107-68175129 TACTCATACATGCTACAGCATGG + Intronic
1143120826 17:4605714-4605736 TACACACAGCTGCTGAAGGAAGG + Intronic
1147501379 17:40967210-40967232 TACTCACACCTGCTTAATAATGG - Intergenic
1147559796 17:41501710-41501732 TTCCCTTACCTGCTGAGGAAGGG + Exonic
1148519320 17:48255121-48255143 AGCTCATACTTGGTGAAGAAAGG + Intronic
1151143546 17:72017904-72017926 TACTCAACCCTCCTGAGGAAGGG + Intergenic
1152061039 17:78075265-78075287 TATTCATACCTTGTCAAGAAAGG - Exonic
1152182819 17:78835114-78835136 GAATCATGCCTGCTGCAGAATGG - Intronic
1152848748 17:82618792-82618814 TACTAATAAATGCTGAAGCAGGG + Intronic
1154236061 18:12606901-12606923 CTCTTATACCTGCTGAACAATGG + Intronic
1158451160 18:57566740-57566762 TTCACATACCAGCTGAAGAGTGG - Intronic
1165680663 19:37771945-37771967 AATTCAGACCTGCTGAGGAATGG + Intronic
1167832730 19:52039411-52039433 CACTGATACATGCTAAAGAATGG + Intronic
925650026 2:6080268-6080290 TACTGATAGGAGCTGAAGAATGG + Intergenic
928079823 2:28300942-28300964 TACTCAGTTCAGCTGAAGAATGG - Intronic
930126399 2:47801033-47801055 ATCTCATAAATGCTGAAGAACGG + Exonic
931622610 2:64226370-64226392 TACTCATAGGTACTCAAGAAAGG - Intergenic
932032111 2:68199560-68199582 TACTCATATCTCATGATGAAAGG - Intronic
932236681 2:70125943-70125965 TTCTCATACGTGCTGCAGCAGGG - Intergenic
934062590 2:88309201-88309223 TACTTATACCTGCTACAGCATGG + Intergenic
935028017 2:99296134-99296156 TCCTCAAACCTGAAGAAGAAGGG - Intronic
935475018 2:103508771-103508793 TACTCATACATACAGAAAAATGG - Intergenic
937823827 2:126342853-126342875 TACTTATACCTGCTAAAACATGG + Intergenic
939189662 2:138901734-138901756 GACCCGTACCGGCTGAAGAATGG - Intergenic
939862563 2:147437226-147437248 CACTCAAACATGCTGAGGAAGGG - Intergenic
940558610 2:155264619-155264641 CACTCATACAGGCTGAATAATGG - Intergenic
943197704 2:184776556-184776578 TATTCATACCTTTTGAAGTAAGG + Intronic
943743987 2:191441873-191441895 AACTCAGACCTGCTGAAGGCTGG + Intergenic
945357446 2:208856888-208856910 GGCTCCTACCTGCTGAAGACTGG + Intergenic
946031604 2:216709421-216709443 TACTGATACATGCTGAAACATGG - Intergenic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1169340545 20:4793185-4793207 TCCTCATCCAAGCTGAAGAAAGG + Intronic
1169670644 20:8097111-8097133 TACTGATACCTGCTGTAGCATGG - Intergenic
1169851381 20:10055462-10055484 TACTCATACCTGCTGGGGTATGG + Intronic
1173347358 20:42213252-42213274 AATTCAGACCTGCTGAAGAGTGG - Intronic
1173938559 20:46890399-46890421 TACACATACCTACAGGAGAAAGG + Intergenic
1175183039 20:57161833-57161855 TATTCATACCTTTTGAACAAGGG - Intergenic
1179587658 21:42383815-42383837 TACCCCTACCTGCTGGAGGAGGG - Intronic
1182412473 22:30198915-30198937 TACACAGACCTGCTGAGGAAGGG - Intergenic
950642293 3:14356206-14356228 TACTCTTACCTGCTGAACCTGGG + Intergenic
954749178 3:52804101-52804123 GACCCAGACCTGCTGAAGTAGGG + Intronic
954938947 3:54353415-54353437 TACCCATATCTGCTGAACCAGGG - Intronic
955096825 3:55806907-55806929 TAGGCATACCTGCTGAATGAAGG - Intronic
955651176 3:61195525-61195547 TTCTCAAACCTGCTGATCAATGG + Intronic
956201976 3:66715990-66716012 TACTCATTTGTGATGAAGAAAGG + Intergenic
956837669 3:73108805-73108827 TACTCATACATGCTACAAAATGG - Intergenic
957197817 3:77093150-77093172 TACAAATACCTGATGAAGAGAGG + Intronic
957771433 3:84697138-84697160 TACATATACATGGTGAAGAATGG + Intergenic
961721742 3:128901601-128901623 TTCTCATACCCACTGCAGAAGGG - Intronic
963928689 3:150979064-150979086 TATTCATCCCTGATGAAGGAAGG - Intergenic
966030388 3:175339116-175339138 TCCTCAAGTCTGCTGAAGAATGG - Intronic
966177731 3:177157358-177157380 GACTAATGACTGCTGAAGAATGG - Intronic
966496186 3:180583999-180584021 TACTCAAACCTGGAGAGGAAAGG + Intergenic
966621766 3:181972358-181972380 TGTTCACACTTGCTGAAGAAGGG + Intergenic
967764647 3:193265320-193265342 TACTCATACATGCTACAGTATGG + Intronic
971240759 4:24886807-24886829 CACACCTACCAGCTGAAGAAAGG + Intronic
971293077 4:25361953-25361975 TAATCCTTCCTACTGAAGAAGGG + Exonic
972876508 4:43367804-43367826 TACTCATACATGGCAAAGAATGG + Intergenic
975523322 4:75323489-75323511 TACTCCTCCCGGCTGAATAATGG - Intergenic
975723768 4:77272538-77272560 GACTCAAAGCTGCTGAAGAGTGG + Intronic
979568505 4:122184958-122184980 TACTCTTCCCTGATGAAGACTGG - Intronic
980411102 4:132420119-132420141 TACTCATACCTGCTAAGCTATGG - Intergenic
982374404 4:154673835-154673857 TTCTCAGACCTGCAGAATAATGG - Intronic
983287694 4:165760530-165760552 TACTCAGCCCTGCGGAAGCAGGG - Intergenic
991270967 5:64780211-64780233 TACTCATACATGCTACAAAATGG - Intronic
997040220 5:130244026-130244048 TACACATACCTGTTCAAGAAGGG + Intergenic
999517550 5:152316329-152316351 TATTCATAGCAGCTGGAGAATGG - Intergenic
1000051738 5:157569037-157569059 TATTCATACCCCCTGAGGAATGG - Intronic
1001229646 5:169975099-169975121 TGCCCACACCTGCTGAAGGAGGG + Intronic
1005958626 6:30681452-30681474 TACTCATGTCTGCTGTTGAAAGG + Intronic
1007041095 6:38722997-38723019 ATCTCATTCCTTCTGAAGAAGGG + Exonic
1007528450 6:42518649-42518671 TACTGATACCTGCTGCAACATGG - Intergenic
1011553373 6:88549742-88549764 TCCACATAACTGCTGAAGAATGG - Intergenic
1013142846 6:107356302-107356324 TACTTAGACATTCTGAAGAACGG + Intronic
1017401644 6:154071202-154071224 TAGTCATAGCTGCTGAAGGAAGG + Intronic
1020412214 7:7905168-7905190 TACTGATACATGCTGCAGCATGG + Intronic
1020684874 7:11282038-11282060 TACTCATAATAGCTGAAGACTGG - Intergenic
1020926013 7:14325566-14325588 TAATCATCCTTTCTGAAGAAAGG - Intronic
1023110635 7:36807540-36807562 TACTCATACTTGAGAAAGAAAGG - Intergenic
1023379463 7:39592105-39592127 TACTCATAATTGCTGAAAACTGG - Intronic
1024178058 7:46861320-46861342 ATCTAATTCCTGCTGAAGAATGG - Intergenic
1024857353 7:53796883-53796905 TACACATCCCTGCTGAAGCATGG - Intergenic
1027867478 7:83665839-83665861 AACACATTTCTGCTGAAGAAAGG - Intergenic
1033017297 7:137684825-137684847 CACTCAGACCTGATGAAGAGGGG + Intronic
1033279931 7:139998918-139998940 TATTTATACCTGCTTTAGAAGGG - Intronic
1036021152 8:4848128-4848150 TACTAATACATGCTGCAGCATGG - Intronic
1036141470 8:6212958-6212980 TACTCATTCCTGCTGGGGCAGGG + Intergenic
1038580250 8:28742330-28742352 CACTCACACCTGCTCATGAATGG - Intronic
1040441789 8:47450903-47450925 GAATCTTACCTGCTGAAGACTGG - Intronic
1040557856 8:48496868-48496890 TACTCAAACCTCCTGTAGACTGG + Intergenic
1045819968 8:106324850-106324872 TACTCATCTCTGCTGAGGAGGGG + Intronic
1045993881 8:108340766-108340788 TACTTAAACATTCTGAAGAATGG + Intronic
1047035359 8:120932406-120932428 TACTCATACTTGAAGAAGAATGG - Intergenic
1051007218 9:12360254-12360276 AACTCAAATCTGCTGAAAAAGGG - Intergenic
1051064597 9:13087625-13087647 TACTTTTACTTACTGAAGAATGG - Intergenic
1051231741 9:14962436-14962458 TAGTCATACCTGCTCCATAATGG - Intergenic
1051745844 9:20293851-20293873 GACTGATCTCTGCTGAAGAAAGG - Intergenic
1053554973 9:39127390-39127412 AACTCATACAAGCTGAAGGAAGG + Intronic
1053819094 9:41947646-41947668 AACTCATACAAGCTGAAGGAAGG + Intronic
1054109360 9:61091298-61091320 AACTCATACAAGCTGAAGGAAGG + Intergenic
1054611497 9:67239827-67239849 AACTCATACAAGCTGAAGGAAGG - Intergenic
1057425313 9:94944417-94944439 TACTGATACTTGCTGCAGCAAGG + Intronic
1059079061 9:111228067-111228089 TACTCATCCCTGAAGAACAAGGG - Intergenic
1060134551 9:121140056-121140078 TACTCACACTAGCTCAAGAAAGG + Intronic
1186490269 X:9966838-9966860 TTCTCATACCTGCTGCAACATGG + Intergenic
1188245678 X:27833372-27833394 TACTCAAACCTTCTGATAAAAGG - Intergenic
1192123683 X:68480733-68480755 TACTCATAATAGCTGAAAAATGG + Intergenic
1193481794 X:82036142-82036164 TACTCCTTCCTGCTGAAGGGGGG - Intergenic
1195800598 X:108704860-108704882 TACTCATACATGCTGTAACATGG - Intergenic
1196354395 X:114773075-114773097 TGCATATACCTGCTTAAGAAAGG - Intronic
1197185682 X:123584569-123584591 TACTAATACTTGCTGCAGCATGG + Intergenic
1197316947 X:124978705-124978727 AACACATACCTGCTCAAGATGGG - Intergenic
1198649166 X:138842077-138842099 TCATCAGCCCTGCTGAAGAAAGG + Intronic