ID: 1127614418

View in Genome Browser
Species Human (GRCh38)
Location 15:60669585-60669607
Sequence AACCTGCTCTCTGTTCTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127614416_1127614418 3 Left 1127614416 15:60669559-60669581 CCACATTGGTTATGAGAGAAAGC 0: 1
1: 0
2: 1
3: 16
4: 148
Right 1127614418 15:60669585-60669607 AACCTGCTCTCTGTTCTTACTGG 0: 1
1: 0
2: 2
3: 14
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127614418 Original CRISPR AACCTGCTCTCTGTTCTTAC TGG Intronic
901073784 1:6539306-6539328 ATCCTGCTTTCAGTTCTTTCAGG - Intronic
901339799 1:8486222-8486244 AACTTGCTCTCTGTAGTTACTGG - Intronic
906731354 1:48084133-48084155 AACCTGCTTCCTCTTCTTGCTGG - Intergenic
907764419 1:57394671-57394693 AAAATGCTCCCTGTTCTTATAGG - Intronic
910649154 1:89546124-89546146 AACATGCTCTCTATTCTGATAGG - Intronic
910813883 1:91267542-91267564 ACCTTGATCTCTGTTCTTAGGGG + Intronic
911340591 1:96632137-96632159 AACCTGCTCTCTGTTCCATAGGG - Intergenic
914976130 1:152364357-152364379 AACCTTCTCTCTGTCATCACAGG - Intergenic
915382017 1:155450704-155450726 ACCCTGCTTTCAGTTCTTTCTGG - Intronic
915747276 1:158173053-158173075 AATCTCTTCTCTTTTCTTACAGG + Intergenic
916611678 1:166397900-166397922 CACCTTCTTTATGTTCTTACAGG - Intergenic
922097160 1:222452214-222452236 AACCTGTTTTCTCTTCTTCCTGG - Intergenic
922645548 1:227282522-227282544 AACAGGCTCTCTGGTATTACCGG + Intronic
922989321 1:229892942-229892964 AACCTGCCCTTTGTTCTTGAAGG + Intergenic
1063494828 10:6497339-6497361 AAACTGCTCTGTGATCTTAGGGG - Intronic
1063659264 10:8022363-8022385 AACCTGCTGCCTGTTCACACTGG - Intergenic
1066028806 10:31395641-31395663 AACCTGCTCTCTGATGTTCAGGG - Intronic
1071107112 10:82111044-82111066 AGAATGCTCTCTTTTCTTACAGG - Intronic
1073278705 10:102335298-102335320 AATCTGCACTCTGTGTTTACTGG + Intronic
1073372962 10:103007189-103007211 GACCTACTCCCTGTTCGTACAGG - Intronic
1075025828 10:118982406-118982428 AAACTGCCCTCTGTGCTTACCGG - Intergenic
1076709320 10:132322952-132322974 AACCAGCTATCTGTTCTTTTTGG - Intronic
1079226896 11:18614721-18614743 AAGCTGCTCACTGGTCTTCCTGG + Exonic
1080213707 11:29817323-29817345 AACCTGCTTTCTTCTCCTACGGG - Intergenic
1080590179 11:33716574-33716596 GACATGCCCTCTGTTCTTGCTGG - Intronic
1081154255 11:39669481-39669503 AACCTGCACTCTTCTCTTTCAGG - Intergenic
1092651928 12:10644169-10644191 CACCTTCTCCCTGTTCCTACTGG - Intronic
1092720957 12:11440043-11440065 GACCTGCTCTCTGTTTGTGCAGG - Intronic
1093738450 12:22652340-22652362 ACCCTGCTTTCAGTTCTTTCGGG + Intronic
1095524948 12:43114431-43114453 CACATGCTCTTTGTTCTTTCTGG - Intergenic
1095967547 12:47879115-47879137 GGCCTGCTTGCTGTTCTTACAGG - Exonic
1097180069 12:57166775-57166797 AACCATCTCTCTGGTCTCACTGG - Intronic
1098442654 12:70534651-70534673 ATCCTGCTCTCTGCTCTTACAGG - Exonic
1098994618 12:77104639-77104661 AACATGGTCTCTGTTCCTACGGG + Intergenic
1100138436 12:91585466-91585488 GACCTGTTTTCTCTTCTTACAGG - Intergenic
1100400933 12:94228888-94228910 ACCCTGCTCTCAGTTCTTTTCGG + Intronic
1101200170 12:102427502-102427524 CACCTGCCCTCTGTTCTCAGGGG + Intronic
1102206031 12:111091436-111091458 GGCCTGATCTCTGTTCTTAGGGG - Intronic
1108331848 13:49394412-49394434 AACAGGCTCTCATTTCTTACTGG + Intronic
1109067742 13:57721474-57721496 AAACTGCTCTCTGTACTTTAAGG - Intronic
1111106137 13:83647984-83648006 AACCTGATCTCTGCTGTTCCAGG + Intergenic
1111896156 13:94144195-94144217 ACCCTGCCCTCTGTGGTTACAGG - Intronic
1112142656 13:96662961-96662983 GAGGTGCTCTCTGTTCTTTCAGG + Intronic
1113439871 13:110319978-110320000 AACCTGATGTCTGCACTTACCGG - Intronic
1114357777 14:21931633-21931655 AAACTGCACTCTTATCTTACAGG - Intergenic
1118370864 14:65136175-65136197 AACCTGCTGTTTATTCTTAGGGG - Intergenic
1119203220 14:72774288-72774310 AACCTGCTTTCAGTTCTTTTAGG + Intronic
1123175913 14:106418512-106418534 AAACTTCTGTCTGTTCTTAGTGG - Intergenic
1123899446 15:24862058-24862080 AACCCGCTGTCATTTCTTACAGG - Intronic
1123959821 15:25385689-25385711 CACCTGTTCTCTGCTCTCACAGG - Intronic
1125919953 15:43519440-43519462 ACCCAGCTCTCTCTTCTTTCTGG - Intronic
1127014297 15:54666048-54666070 AACCTGCATTCTGATTTTACGGG - Intergenic
1127614418 15:60669585-60669607 AACCTGCTCTCTGTTCTTACTGG + Intronic
1128449905 15:67799452-67799474 CACCTGCTCTCTCTTCCTCCCGG - Intronic
1131472462 15:92708937-92708959 GATCTGCTTTTTGTTCTTACAGG - Intronic
1133435153 16:5772880-5772902 AACCAGCTCCCTCATCTTACTGG - Intergenic
1135998555 16:27272055-27272077 AACCTTCTCTCATTTCTTCCTGG - Intronic
1138210504 16:55159224-55159246 AAACTTCTTTCTGTGCTTACAGG + Intergenic
1140153011 16:72391288-72391310 CACCTGCTCTCTGTCCCTCCTGG + Intergenic
1141257297 16:82414734-82414756 AACCTGCTCTTAGCTCCTACAGG + Intergenic
1144152021 17:12457395-12457417 AACATGATCTTTGCTCTTACTGG + Intergenic
1144649663 17:16999375-16999397 GACCTGCTCTCTATTCTTTTCGG + Intergenic
1145247915 17:21281908-21281930 AACCTGCTCTCTGTGGATGCAGG - Intergenic
1151504953 17:74521637-74521659 AACCTGCTCTTGGTTCTAATAGG - Exonic
1153850586 18:9090552-9090574 AACCTCCTCTCTTTTCTAACAGG + Intergenic
1155239947 18:23855408-23855430 CATCTGCTCTCTCTTCTTTCCGG + Intronic
1157671677 18:49535155-49535177 AACCTGCTTTCTTTTATTACAGG + Intergenic
1158339430 18:56449432-56449454 AACATGCTCTCTTTTCTTTCTGG - Intergenic
1159098224 18:63930023-63930045 AACCTGCCTTTTGTTCTTACAGG + Exonic
1159811491 18:73022840-73022862 ATCCTGATCTGTGTTCTCACTGG + Intergenic
1160266102 18:77341732-77341754 AAGCTCCTCTCTTTTCTGACAGG - Intergenic
1162668278 19:12233590-12233612 AATTTGCTATCTGTTCTCACAGG - Intronic
1166253453 19:41586442-41586464 GACCTCTTCTCTGTTTTTACAGG + Exonic
1166592751 19:44015505-44015527 AACCAGGTCTTTGTTCTAACTGG - Intergenic
1166604994 19:44133668-44133690 ATCCTGCTCTTTGTCCTAACTGG - Exonic
1166607882 19:44161639-44161661 AACCCACTCTTTGTCCTTACTGG - Intergenic
1168393820 19:56031896-56031918 ATCCTGATCTCAGTTCTTCCGGG + Intronic
926910531 2:17848660-17848682 AAACTGCTCTCAGTTCTCATGGG - Intergenic
927997756 2:27498004-27498026 AAGCTGCTTTCAGTTCTTTCTGG + Intronic
937032937 2:118755853-118755875 AAGCTGCTCATTGTTCTTTCTGG - Intergenic
939717761 2:145606291-145606313 AAATTGCTCTCTGGTCTTTCAGG + Intergenic
944472930 2:200074290-200074312 ACCCTGCTATCTTTTCTTCCTGG + Intergenic
944730729 2:202514866-202514888 AACCTGTTTCCTGTTCTTATAGG + Exonic
947121588 2:226820973-226820995 AACCTTCCCTCTGTTCCTCCAGG + Intergenic
1173646180 20:44634471-44634493 AACCTCCGCCCTGTGCTTACTGG + Intronic
1174120627 20:48262565-48262587 AACCTGGGCTCTGTTCCCACTGG + Intergenic
1174743872 20:53041967-53041989 ATGCTCCTCTCTGTTCTTGCTGG - Intronic
1175181114 20:57148348-57148370 AGCCTGCTCTCTGCACTTCCAGG + Intergenic
1175332283 20:58173699-58173721 AATCTGCTTTCTGTTCCTAAGGG - Intergenic
1175519131 20:59588487-59588509 AATCTGCTCTCAGCTCTTCCTGG + Intronic
1178007814 21:28242645-28242667 ACCCTGCCCTGTGTTCCTACAGG + Intergenic
1184066140 22:42122669-42122691 GACCTCTTCTCTGTTCTTTCTGG + Intergenic
951447343 3:22798227-22798249 ACCCTGCTCTCTTTTCACACTGG + Intergenic
953015851 3:39075460-39075482 AGCCTGCTCCCTCTTCTTTCAGG - Intronic
954136531 3:48584556-48584578 CCACTGCTCTCTGTCCTTACAGG - Exonic
956037046 3:65105026-65105048 ACTCTGCTCTCTGTTGTTTCAGG - Intergenic
958043388 3:88252990-88253012 TAACTGCTCTCTGTTCCCACTGG - Intergenic
958898191 3:99853910-99853932 CTCCTGCTCTCAGTTCTCACTGG - Intronic
959146787 3:102556540-102556562 TACATGCTATCTGTTATTACTGG - Intergenic
959443640 3:106410548-106410570 ATACTGCTCTCTGTTCTTTTGGG + Intergenic
960067201 3:113386928-113386950 AAGCTGCTTTCTGTTGTGACAGG - Intronic
961179784 3:124867476-124867498 ACCCTGCTTTCTGTTCTCACAGG + Intronic
961581654 3:127888217-127888239 AGCCAGCCCTCAGTTCTTACTGG + Intergenic
963182828 3:142378169-142378191 AACCTTCCCTCTGTTTTAACAGG + Intronic
963502633 3:146147365-146147387 AATTTGCACTCTGTTCATACTGG - Intronic
963934052 3:151034414-151034436 AACCTGCTCTATGTTCTTCCTGG + Intergenic
969594018 4:8137822-8137844 AGCCTGCTTTCTGTTCTTTGGGG - Intronic
970919643 4:21378424-21378446 AATCTGCTCTCTATTTTTAGAGG + Intronic
977369373 4:96115675-96115697 TACCTGCTCACTGTGCCTACTGG + Intergenic
978126618 4:105144182-105144204 AAACTGCTCTCTGTTGTAACAGG - Intergenic
982042224 4:151408265-151408287 CACCTGCTCTCTCATCTTGCGGG + Intergenic
982121583 4:152148451-152148473 TTCCTCCTCTCTGTTCTTGCTGG + Intergenic
984772415 4:183448417-183448439 ACACGGCTCTCTGTTCTTTCCGG - Intergenic
986710028 5:10481853-10481875 AACCTGCTCTCTGCTCTGTAGGG + Intergenic
989076846 5:37572990-37573012 CACCTGCTCTTTCTTCTTCCTGG + Intronic
989239020 5:39182229-39182251 CACCTGCACTCTGTTCACACTGG - Intronic
992391480 5:76335224-76335246 AACCAGCTCTCACTTCTTCCAGG + Intronic
999013144 5:148065353-148065375 AACCTGATCTTCATTCTTACTGG - Exonic
1000537402 5:162495767-162495789 ATCATGCTCTCTGCTCCTACAGG + Intergenic
1000743404 5:164998542-164998564 AAGGTGCTCTCTGTTGTTATTGG - Intergenic
1001115252 5:168934011-168934033 AGCCTGCACTCTGCTCTAACAGG + Intronic
1005060262 6:21770359-21770381 AACCTGCACTGTGTTCTTTTAGG + Intergenic
1005789894 6:29288364-29288386 TTCCTGCTCTCCTTTCTTACTGG - Intergenic
1006008076 6:31019053-31019075 AACCTGCACTTAGTTCTTAGAGG - Intronic
1007041281 6:38724805-38724827 CACCTGCTCACTGGTCTTTCTGG - Intronic
1008204343 6:48635304-48635326 CACCTGTTCTGTGTTCTTATAGG + Intergenic
1010558815 6:77321754-77321776 AACCTTCTCTCTCTTTTTAAGGG + Intergenic
1012226751 6:96712970-96712992 AGACTGCTCTCTGTACTTACTGG + Intergenic
1016317110 6:142802390-142802412 AACCTGTGTCCTGTTCTTACTGG - Intronic
1016413593 6:143809619-143809641 AACCTCATTTCTGTTCTCACAGG + Intronic
1016864640 6:148753661-148753683 CACCTGTTTTCTGTTCTTATGGG + Intronic
1019254837 7:42814-42836 CACCTTTTCTCTGTTTTTACTGG - Intergenic
1020905426 7:14058287-14058309 TACCTGCTCTCTGTGCTTCCTGG - Intergenic
1021401249 7:20212327-20212349 AACCTGATGTCTGTTCTGGCTGG + Intronic
1022894034 7:34731396-34731418 AACCTACTTTCTTTTCTTATTGG - Intronic
1023023625 7:36032355-36032377 GCCCTGCTCTCTCTTCTTACAGG + Intergenic
1023441574 7:40190149-40190171 ATCCTGCCTTCTGTGCTTACTGG + Intronic
1028718880 7:94006173-94006195 AACCTCTTCTCTATTCTCACAGG + Intergenic
1030014823 7:105208525-105208547 AACCTGCGGTCTTTTCTGACTGG - Intronic
1030937448 7:115602742-115602764 TACCTGTTCTCTATTCTCACTGG + Intergenic
1031486631 7:122334562-122334584 CTCTTGCTCTCTGTTCTTCCTGG - Intronic
1031831289 7:126629248-126629270 AACCTTCTGTCTGTTATTTCCGG + Intronic
1032177402 7:129642420-129642442 AAACTACTGTATGTTCTTACAGG + Intronic
1034760514 7:153667951-153667973 AAAATGGACTCTGTTCTTACAGG + Intergenic
1036689031 8:10929765-10929787 AACCTCCTGTCTGTGCTCACAGG - Intronic
1037908532 8:22729468-22729490 AACCAGCTCCCTGATCTGACTGG - Intronic
1039846130 8:41326811-41326833 AACCTGGGCTCTGTGGTTACAGG - Intergenic
1041742632 8:61173013-61173035 AACCTGTTCACTATTCTTACTGG - Intronic
1043497142 8:80814206-80814228 AAACTGAGTTCTGTTCTTACAGG + Intronic
1044596061 8:93959831-93959853 AACCTGCTTTGTCATCTTACTGG + Intergenic
1048155193 8:131940913-131940935 AACCTTCTCTCTGTTCACAGTGG - Intronic
1048281162 8:133106499-133106521 ACCCAGCCCTCTGTTCTTTCTGG + Intronic
1048826619 8:138433771-138433793 AACCCATTCTCTCTTCTTACTGG - Intronic
1049022397 8:139966386-139966408 ACCCTGCTCTCTGCTCCCACAGG + Intronic
1049613341 8:143565979-143566001 AAGCTGCGCTCTGGTCTAACAGG - Intergenic
1051835632 9:21334939-21334961 AACGAGCTTTCTGTTCTTTCTGG - Exonic
1052318926 9:27146356-27146378 ATCCTGATCGCTGTTCTTAGTGG - Intronic
1052367286 9:27627048-27627070 AACGTGCTCTCTGTACTTTGAGG - Intergenic
1053275596 9:36781002-36781024 AACCTGGGCTGTGTTCTTTCAGG + Intergenic
1056677703 9:88689932-88689954 AATCTGCTTTCTTTTCTAACAGG + Intergenic
1057508799 9:95660531-95660553 AACCTGCTTGCTGTTCTCCCAGG - Intergenic
1058215545 9:102229014-102229036 AACCTGCTCACTGGTCTCAAAGG + Intergenic
1059535785 9:115079449-115079471 TGCCTGCTCTGTGTTCTTATAGG + Intronic
1059962501 9:119579058-119579080 CTCCTGTTCTCTGTTCATACTGG + Intergenic
1060695364 9:125704967-125704989 TTCCTGGTCCCTGTTCTTACAGG - Intronic
1061933613 9:133845819-133845841 AACCTGCTCTCTGCTGGGACTGG - Intronic
1187289071 X:17934602-17934624 TATCTGCTCTCTGTTCTGAAAGG - Intergenic
1196088817 X:111716527-111716549 AATCTGCTCACTGTTCTTATGGG + Intronic
1196688792 X:118536457-118536479 TACCTAGTCTCTGATCTTACAGG + Intronic
1197548421 X:127856798-127856820 CACCTTCTCTTTGTCCTTACAGG + Intergenic
1199482435 X:148312129-148312151 AATCACCTCTCTGTTCCTACTGG + Intergenic
1201231638 Y:11870623-11870645 CACCTTCTCTCTATTCTTTCTGG + Intergenic