ID: 1127618049

View in Genome Browser
Species Human (GRCh38)
Location 15:60706848-60706870
Sequence GAGGCTTTTTCCTTTTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 380}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127618049 Original CRISPR GAGGCTTTTTCCTTTTTGGG AGG (reversed) Intronic
901019029 1:6246654-6246676 GAAGCTCTTCTCTTTTTGGGCGG + Intergenic
901474015 1:9476728-9476750 TAGGGAGTTTCCTTTTTGGGGGG - Intergenic
901893971 1:12292810-12292832 AGGGCTTTTTCATTTTTAGGGGG + Intronic
902402689 1:16166752-16166774 CATTCTTTTTCCTTTTTGGGGGG + Intergenic
903658638 1:24963861-24963883 GCAGCTTTTGCCTTTTTTGGTGG - Intronic
903763533 1:25716581-25716603 GTGGCTTATGCCTGTTTGGGAGG - Intronic
905126332 1:35718536-35718558 GAGGCTGCCTCCTGTTTGGGCGG - Intronic
905724000 1:40232864-40232886 CTGGCTTTTTCTTTTTTGGCGGG + Intronic
907140959 1:52184565-52184587 CAGCCTTTTCCATTTTTGGGTGG + Intronic
907469452 1:54663820-54663842 GAGCCTTGTTCCTTTTAGTGGGG + Intronic
907800775 1:57763188-57763210 GAGGCATTTTAAATTTTGGGTGG - Intronic
908189629 1:61688737-61688759 GAGGAGTTTTTTTTTTTGGGTGG - Intronic
908728627 1:67203368-67203390 GGGATTTTTTCCTTTGTGGGAGG - Intronic
909916822 1:81330066-81330088 GAGGCTTTTTCATTTCTAGCTGG + Intronic
910116928 1:83741680-83741702 GAAGCTTTTTCCTTTTCTGGGGG + Intergenic
910746055 1:90576093-90576115 GTTTCTTTTTCCTTTTTGGAGGG - Intergenic
910746077 1:90576279-90576301 TAGGGTTTTTCTTTCTTGGGAGG - Intergenic
910857494 1:91710272-91710294 AAGGCTTTTCTCTTTTTGAGGGG - Intronic
913375150 1:118143531-118143553 CTGGCTTTTTTCTTTTTGTGGGG - Intronic
914329995 1:146659226-146659248 GAGGCTTTTTCATTAATGTGAGG - Intergenic
915897584 1:159823804-159823826 GAGAGTTTTTCCCTTTGGGGAGG + Intergenic
916130670 1:161608362-161608384 AAGTCTTTTGACTTTTTGGGGGG + Intronic
916921250 1:169469857-169469879 GAGGCTATTTCAAATTTGGGAGG + Intronic
917494180 1:175525147-175525169 GGGGCTTTTCCCTTTTTGCTTGG + Intronic
919540701 1:198841524-198841546 GAGGCTTTTTCCATGTTGTGGGG - Intergenic
919883944 1:201919212-201919234 GAAACTTTTTTTTTTTTGGGGGG + Intronic
921583821 1:216925566-216925588 GAGGTTTTTCTGTTTTTGGGGGG + Intronic
921794431 1:219326279-219326301 GAGGGTTTTTTGTTTTTGGTGGG + Intergenic
924609262 1:245560257-245560279 GGGACTTTTTCCCTTTTGGAAGG + Intronic
924723548 1:246645721-246645743 GAAGCTTTAACCTTTTTGGCCGG - Intronic
924869019 1:248019976-248019998 CAGGATTTTTCCATTTTGGTTGG + Intronic
1063213015 10:3898547-3898569 TATGCTTTTTTTTTTTTGGGGGG + Intergenic
1064228891 10:13512116-13512138 GAGGCTATTTCCTTTTAAGTTGG + Intronic
1064739858 10:18421812-18421834 CAGCCTTTTTCCTTTTAGAGTGG + Intronic
1066278473 10:33891470-33891492 GGGGTTTTTTCCTTTTTTGAAGG + Intergenic
1066439345 10:35423502-35423524 GAGGCTTTTTTTTTTTGGTGGGG + Intronic
1066663233 10:37756692-37756714 GTGGCTTTTTTTTTTTTGGATGG - Intergenic
1067280403 10:44866744-44866766 GAGTCTTTTCTCTTTTTTGGGGG - Intergenic
1068805909 10:61193623-61193645 GGGGCTTTTCCCTTTTTGCTTGG - Intergenic
1069372427 10:67762378-67762400 AGGGCTTTTTTTTTTTTGGGGGG - Intergenic
1071099242 10:82015594-82015616 GGGGCTCTTTCCTTTTTGCTCGG + Intronic
1071277342 10:84067606-84067628 AAGGCTATTTTCTTCTTGGGAGG - Intergenic
1072074009 10:91950132-91950154 GAGACCTTGTCCTTTGTGGGGGG + Intronic
1073326502 10:102646438-102646460 GGGGCTGTTTCCTGTGTGGGGGG + Intronic
1074080113 10:110161741-110161763 GAGGGTTTTTCCTTTCTCGTTGG - Intergenic
1074762874 10:116680460-116680482 CATGCTGTTTCCCTTTTGGGAGG - Intronic
1075009376 10:118854509-118854531 GAAGCTTGTTCCTTGGTGGGTGG + Intergenic
1075044413 10:119134693-119134715 CAGGCTTTATTCCTTTTGGGTGG - Intronic
1076634573 10:131873970-131873992 GAGGCATTTTCCTTCTGGGGTGG - Intergenic
1078013173 11:7589606-7589628 GAGGTTTTTTTTTTTTTGGGAGG - Intronic
1078397249 11:10992107-10992129 TTGGCTTTTTTTTTTTTGGGTGG + Intergenic
1080657151 11:34266987-34267009 AAAGCTTTTTCCTTTTTGTGGGG + Intronic
1081209822 11:40319044-40319066 GAGCATTTTTCCTTTTTGGTAGG + Intronic
1081336487 11:41873163-41873185 CAGGCTTTTTCCTTACTGGTTGG - Intergenic
1081706682 11:45186214-45186236 GAGGCTTTTATGTTTGTGGGGGG + Intronic
1081813105 11:45924142-45924164 GTGGATTTTTCCTTTTGGGTGGG - Exonic
1082562811 11:54639567-54639589 GAAGCTTTTTAATTTTGGGGGGG + Intergenic
1083610356 11:64001305-64001327 GCGGCGTTTTCCTCTGTGGGAGG - Intronic
1086077650 11:82871606-82871628 GTGGTTTTTGCCTTTTTTGGAGG - Intronic
1089202352 11:116732013-116732035 GAGGCTGGTGCCTTTCTGGGTGG - Intergenic
1089593938 11:119563618-119563640 TAGGCTTTTTTATTTTTGGTTGG - Intergenic
1089776247 11:120838441-120838463 GAGCTTTTCTCCTTTTTGGGTGG + Intronic
1090366336 11:126209719-126209741 TTGGCTTTTTCCTTCTTAGGTGG - Exonic
1090827410 11:130397507-130397529 GAGGCTTTATCCTTTTGCTGTGG - Intergenic
1091106615 11:132925800-132925822 GAGGGTTTTTTCTTGTTGTGAGG + Intronic
1091138048 11:133210533-133210555 GAACCTCTTTCCTTTTTGAGTGG + Intronic
1091412206 12:250875-250897 GTGGCTCATTTCTTTTTGGGAGG + Intronic
1091483572 12:860534-860556 GAGCTTTTTTGCTTTTTTGGAGG + Intronic
1092134097 12:6133832-6133854 GGGAGTTTTTCCTTTTTGGTGGG - Intergenic
1093078570 12:14783093-14783115 ATGGCTTTTTCATTTGTGGGTGG + Intergenic
1093083738 12:14843476-14843498 CATGCTTTTTCCTGTTTGGCTGG - Exonic
1094247127 12:28311373-28311395 GAGTCTTTTTCCTTTTGGATGGG + Intronic
1094858320 12:34430974-34430996 GAAGATATTTCTTTTTTGGGAGG + Intergenic
1097385182 12:58942700-58942722 CAGTCTTTTTCCTTTTTGGGGGG + Intergenic
1098264475 12:68704864-68704886 GTTTCTTTTTCTTTTTTGGGGGG + Intronic
1098490029 12:71064776-71064798 TCGGCTCTTTCCTTTCTGGGAGG - Intronic
1098996481 12:77126482-77126504 GGGGTTTGTTCTTTTTTGGGGGG + Intergenic
1099891480 12:88593622-88593644 GGGGCTTTTTCCCTTTTGCTGGG + Intergenic
1101980552 12:109402726-109402748 GATGTTTTTTTCTTTTTGGAGGG + Intronic
1102050798 12:109860658-109860680 GAGGCGTTTTCCTTTCTTGGTGG + Intronic
1102906237 12:116677473-116677495 GGGGTTTTTTTTTTTTTGGGAGG - Intergenic
1103335324 12:120185009-120185031 GTTGCTTTTTCCTCTTGGGGAGG - Intronic
1103404301 12:120664363-120664385 GTGGCTCTTCCCATTTTGGGGGG - Intronic
1105056109 12:133100625-133100647 GAGAGTTTTTCCTTATTGAGTGG + Intronic
1106454743 13:29917226-29917248 GAGCTGTGTTCCTTTTTGGGGGG - Intergenic
1107669365 13:42728251-42728273 GAGACTTTTTCCTCTTTTAGGGG + Intergenic
1108121619 13:47194072-47194094 TCGGCTTTTTCCTTGTTGTGAGG + Intergenic
1108319396 13:49273295-49273317 AAGGCATTTTCATTTTGGGGAGG - Intronic
1108393642 13:49972455-49972477 GAGCCTTTATTTTTTTTGGGGGG + Intergenic
1108456758 13:50623109-50623131 GTGGTTTTTTGCTTTTTCGGGGG - Intronic
1110214609 13:73012010-73012032 TAGTATTTCTCCTTTTTGGGGGG - Intronic
1110955452 13:81547512-81547534 GGGGCTTTTTCCTCTTTGTTTGG - Intergenic
1111640910 13:90968704-90968726 GAGGCTTTTTCACCTCTGGGTGG - Intergenic
1111678331 13:91414265-91414287 GGGGCTTTTTCCCCTTTGCGCGG + Intronic
1111960113 13:94801017-94801039 GAGGCTATTTCCTTATTGCCCGG + Intergenic
1112106324 13:96243879-96243901 GAAACTTTTTCTTTTTTGAGGGG + Intronic
1112318247 13:98384179-98384201 GAGGCTTTTTTTTTTGTAGGGGG + Intronic
1115139895 14:30158613-30158635 GAGTCTTTTCCCTTTATGGAAGG + Intronic
1115659352 14:35476586-35476608 GAAGCCTTTTCCATTTTGGTTGG + Intergenic
1116784333 14:49270420-49270442 GGGGCTTTTCCCTTTTTGCTTGG + Intergenic
1116860974 14:49995443-49995465 GAGGCTTTTGCATTTGTGTGGGG + Intronic
1117400521 14:55354970-55354992 GAGGTTTTCTCTTTTTTGGTGGG - Intronic
1117756063 14:58975423-58975445 GATGCTCTTTCATTTTTGGCGGG + Intergenic
1118380047 14:65210193-65210215 GAGGTTTTTTTTTTTTTGAGAGG - Intergenic
1118561080 14:67083459-67083481 GTGGCTTTTTTCTTCTGGGGAGG - Intronic
1119108014 14:71942448-71942470 GAGCCTTTTTTCTTGGTGGGAGG - Intronic
1119278988 14:73387487-73387509 GAGGCTTTTCCCCTTTTGCTTGG + Intronic
1119863741 14:77956086-77956108 AGGGCTCTTTCCTTTTTGGCTGG - Intergenic
1119941745 14:78648693-78648715 TAAGTTTTTTCCTTTTTGGGAGG + Intronic
1120326904 14:83041122-83041144 GAGACTTTTTTATTTTTGAGGGG + Intergenic
1121183008 14:91943516-91943538 GAGGTTTTAGCTTTTTTGGGGGG - Intronic
1121734770 14:96210633-96210655 GAGGCCTTTTCCTTTCTGTGGGG + Intronic
1121977964 14:98423468-98423490 GAGGCATTATGCATTTTGGGTGG - Intergenic
1122675098 14:103406199-103406221 TAAGCTTTTTCTTTTTTGGGGGG + Intronic
1123962945 15:25425515-25425537 CAGCTTTTTTCCTTTTGGGGAGG - Intronic
1124095525 15:26645243-26645265 GTGGCTTTTTCTTTTCTTGGAGG - Intronic
1124691621 15:31827967-31827989 GAGGCTTTGTTCCTTTTGTGTGG + Intronic
1125006038 15:34819340-34819362 GGGGCTTTTTCCTTGCAGGGAGG - Intergenic
1125297693 15:38220978-38221000 CTGGCTTTTTCCTTTATGGATGG - Intergenic
1125438343 15:39672821-39672843 GAGGCTTCTAGCTTGTTGGGAGG - Intronic
1125682743 15:41542870-41542892 GAGACTTTTTCCTTGTTTGTTGG - Intronic
1126202572 15:46003970-46003992 AATACTTTTTCTTTTTTGGGGGG + Intergenic
1126622400 15:50653150-50653172 GTTTCTTTTTTCTTTTTGGGGGG - Intronic
1126634022 15:50764908-50764930 GAGGGTTTTTTTTTTTTGGAGGG - Intronic
1126960064 15:53982420-53982442 GTGGCTATTTCCTTTATAGGTGG + Intergenic
1127082213 15:55392077-55392099 GATGCTTTTTCCTTTTTCACTGG - Intronic
1127340227 15:58034353-58034375 GATGTTTTTTTCTTTTTTGGAGG + Intronic
1127618049 15:60706848-60706870 GAGGCTTTTTCCTTTTTGGGAGG - Intronic
1129782143 15:78279634-78279656 GAGGCTTCTTCCTGTCTGTGGGG + Intronic
1130299624 15:82670096-82670118 GTGGCTTTTTTTTTTTTGGCGGG + Intronic
1130755266 15:86756244-86756266 TAGTCTTTTTCTTTTTTTGGTGG - Intronic
1133012004 16:2918441-2918463 CAGGCTTTTTTTTTTTTGAGAGG + Intronic
1133623670 16:7550247-7550269 GAGTCTTTTTTTTTTTTGGCTGG + Intronic
1134688412 16:16174766-16174788 GAGGTTTTTTGTTTTTTGCGGGG - Intronic
1135174954 16:20219637-20219659 AGGGCTTTTTCCTTTTTGGTCGG + Intergenic
1135246230 16:20859675-20859697 TTGGTTATTTCCTTTTTGGGGGG - Exonic
1136368499 16:29821078-29821100 AAGGTTCTTTCCTTTTTGGGAGG + Intronic
1137537586 16:49339183-49339205 GAGGATTTTTTTTTTTTGCGGGG + Intergenic
1138268415 16:55677334-55677356 CATGCTTTTTCCTTTATGGGAGG - Intronic
1138820540 16:60254064-60254086 GTGGATTTTCCCTTTTAGGGGGG - Intergenic
1140003559 16:71051687-71051709 GAGGCTTTTTCATTAATGTGAGG + Intronic
1140588688 16:76325055-76325077 CATGATATTTCCTTTTTGGGGGG - Intronic
1140856441 16:78981882-78981904 GAGTCTTCTTGCTTTTCGGGGGG - Intronic
1141106563 16:81238735-81238757 TTTGCTTTTTCCTTTTTGGCTGG - Exonic
1142751269 17:1989339-1989361 GAGGCTTTTTTTTTTTTGGAAGG + Intronic
1144188045 17:12814857-12814879 GAGGGTTTTTGCTTTTTTGGGGG - Intronic
1144396322 17:14846884-14846906 TATGCTTTTTCCTTTCTGGAAGG - Intergenic
1146670409 17:34733623-34733645 GAGGCTGTTTCCCTTTAGAGGGG - Intergenic
1147162185 17:38574797-38574819 GAGGATTTTTTTTTTTTGGAGGG - Intronic
1147652084 17:42068509-42068531 GGGTCTTTTTTCTTTTTTGGGGG + Intergenic
1147859272 17:43508031-43508053 AAGCAATTTTCCTTTTTGGGAGG + Intronic
1148577785 17:48723549-48723571 GAGGCTTTTTCCTGCTTCGAGGG + Intronic
1149125374 17:53223953-53223975 GTGGCTTTTTCCTCTTTGCTCGG - Intergenic
1150135430 17:62692658-62692680 GTGGCGTTTCCCTTTCTGGGGGG + Exonic
1151103192 17:71579380-71579402 GAAGATTTTTCCTTTTTGCCTGG + Intergenic
1151216908 17:72583235-72583257 GAGGCTTTCTTCTCTCTGGGAGG - Intergenic
1151877518 17:76875366-76875388 GGGGCTTTTTCCCTTTTGCTCGG + Intronic
1155527246 18:26729911-26729933 GAGGCTTCTTTCTTTGTGAGGGG + Intergenic
1155785580 18:29895685-29895707 CAGGGTTATTGCTTTTTGGGAGG - Intergenic
1156509219 18:37621458-37621480 AAGTATTTTTCTTTTTTGGGTGG + Intergenic
1157441605 18:47715960-47715982 GGGGCTTTTTGCTTTTGGGTAGG + Intergenic
1158013505 18:52756613-52756635 CATGCTTTTTCCTTTTTAAGTGG - Intronic
1158345127 18:56508579-56508601 GGGGCTTTTTCCCTTTTGCTTGG + Intergenic
1159569618 18:70097286-70097308 AAAGCTGTTTCCTTTTTGGAAGG - Intronic
1160164547 18:76498267-76498289 GAGGCCTTTTTTTTTGTGGGGGG - Intergenic
1160248538 18:77180685-77180707 AAAGCTTTTTCCATTTTTGGAGG + Intergenic
1160301701 18:77687494-77687516 GAGGCTTTTGCTGTTTTTGGAGG - Intergenic
1164320422 19:24139308-24139330 CATTCTTTTTCTTTTTTGGGGGG - Intergenic
1164554398 19:29239865-29239887 GAATCTTTTTTCTTTTTGAGGGG + Intergenic
1166974844 19:46600071-46600093 GAAGCCTTTTCCTTTTGGGTGGG - Intronic
1167287171 19:48604723-48604745 CTGGCTTTTTTTTTTTTGGGAGG - Intronic
1167566139 19:50258332-50258354 CAGTCTTTTTCCTTTCTTGGTGG + Intronic
924973749 2:154785-154807 GAGTATTTTTCCTTCTTTGGTGG + Intergenic
926636585 2:15186546-15186568 GAGGCTGCTTTCTTTTTGTGGGG - Intronic
927806602 2:26152710-26152732 CAGGGCTTTTCTTTTTTGGGAGG - Intergenic
931039329 2:58279617-58279639 GAGGCCCCATCCTTTTTGGGGGG + Intergenic
931225085 2:60322512-60322534 AAGGCTTTGTCCTTTATGGGAGG - Intergenic
932365842 2:71152943-71152965 AGGGCTTTTTTTTTTTTGGGGGG + Intergenic
935174205 2:100634076-100634098 GTGTTTTTTTCTTTTTTGGGGGG + Intergenic
935688159 2:105704596-105704618 GAGGTTTTTTTCTTTTTTGGTGG - Intergenic
936041247 2:109151241-109151263 GAGGCTTTTTCATGTTTGTGGGG + Intronic
936415788 2:112309559-112309581 AAGGCCTTTTCATTTTTTGGAGG + Intronic
936474805 2:112830797-112830819 GAGAATTTTTTTTTTTTGGGGGG + Intronic
936774425 2:115955621-115955643 CAGCATTTTTCCATTTTGGGAGG - Intergenic
937125185 2:119470700-119470722 GATGTTTTTTCCTATTTTGGGGG + Intronic
937626160 2:124046206-124046228 AAGACTTTTTCCCTTTTGGGGGG - Intronic
939201714 2:139044084-139044106 CAGGTTTTTTCCTTTTTGAATGG + Intergenic
939493277 2:142901274-142901296 AAGTATTTTTCCTTTTTCGGTGG + Intronic
939680639 2:145127922-145127944 GTGGTTTTTTTTTTTTTGGGGGG + Intergenic
939957427 2:148538721-148538743 GAGGCTTTTTTTTTTTTTAGAGG - Intergenic
940456657 2:153910063-153910085 TAGGCTTTTTTTTTTTTGGTTGG + Intronic
941320675 2:164050221-164050243 CAGGCTTTTTGCTTTTTGGGGGG + Intergenic
941793857 2:169579133-169579155 GATTTTTTTTCCTTTTTGCGGGG - Intergenic
942124141 2:172806192-172806214 AAGCCTTTTTACTTTTTGAGAGG - Intronic
942426884 2:175869443-175869465 GAGGCTCTTTCCTTACTGGTGGG - Intergenic
942518516 2:176778597-176778619 GAGGCTTTTTCCTCTCTTGTGGG - Intergenic
945102254 2:206273044-206273066 GAAGTTATTTCATTTTTGGGGGG + Intergenic
945193035 2:207209815-207209837 GGGGCTTTTTTTTTTTTGGTTGG - Intergenic
945349094 2:208755509-208755531 GTGGCTTCTTTATTTTTGGGTGG + Intronic
945489986 2:210443234-210443256 GAGAATGTTCCCTTTTTGGGGGG + Intronic
946076584 2:217078595-217078617 GAAGCTTTTGCCCTTTAGGGTGG + Intergenic
947611848 2:231529760-231529782 GAGGCTGTTTCCCTATTAGGAGG + Intronic
947983076 2:234426377-234426399 GTGGCTTTTTTTTTTTGGGGGGG - Intergenic
948047594 2:234955518-234955540 GAGACTTTTTCCCTTTAGCGAGG - Intronic
1169703949 20:8481118-8481140 GTTTCTTTTTCTTTTTTGGGAGG - Intronic
1171014941 20:21531763-21531785 CTGGATTTTTCCTTTTGGGGTGG + Intergenic
1171972057 20:31570713-31570735 AAGGCTTCTTCCTTTCAGGGAGG + Exonic
1172039467 20:32033869-32033891 TTTGCTTTTTCTTTTTTGGGGGG + Intergenic
1172570046 20:35962979-35963001 GCTGCTTTTTTCTTTTTAGGTGG + Intronic
1173846696 20:46193006-46193028 GAAGCTTTGACCTTATTGGGGGG + Intronic
1174094792 20:48079429-48079451 GAGACTCTTTCCTTTTGGGTGGG + Intergenic
1174637156 20:52010901-52010923 GGGGATTTTTCTTTTTTGGACGG + Intergenic
1174753106 20:53131828-53131850 GTGGCTTTTTTTTTTTGGGGGGG - Intronic
1175024223 20:55884556-55884578 TAGGTTTTTTCTTTTTTGGAAGG + Intergenic
1176015892 20:62932044-62932066 GAGGTTTTTTCCCTTCAGGGAGG + Intronic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1176517656 21:7798171-7798193 GAGGCTTTTTCCTCTCCTGGAGG + Intergenic
1177303615 21:19283513-19283535 TATACTTTTTCTTTTTTGGGGGG - Intergenic
1177578361 21:22987707-22987729 GAATCTTTTTCCTTTTTTTGGGG - Intergenic
1177607788 21:23404401-23404423 TAGCCCTTTTCCTTTTTGGAGGG - Intergenic
1177929469 21:27263010-27263032 GACTCTTTTCCCTTTTAGGGAGG + Intergenic
1178651684 21:34428183-34428205 GAGGCTTTTTCCTCTCCTGGAGG + Intergenic
1178815718 21:35927619-35927641 AAGGCATTTTCCTTTTTGGTTGG - Intronic
1178892372 21:36530820-36530842 GAGCCTTCTTTCTTTTTGGGGGG - Intronic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
1179802684 21:43818646-43818668 GAGGCTTTATGCTTGGTGGGTGG + Intergenic
1180968877 22:19804588-19804610 GAGGGTTTTCTTTTTTTGGGGGG - Intronic
1181092079 22:20480721-20480743 GAGTCTTTATACTTTTTTGGGGG - Intronic
1182031416 22:27162227-27162249 GAGGCTTTTTGCTTTTTGCCTGG + Intergenic
1182091433 22:27597779-27597801 GAGACTCTTTCCTTTGGGGGTGG - Intergenic
1183197969 22:36366526-36366548 GAGGCTCTCTCCTTTTTTAGGGG - Intronic
1184331367 22:43829873-43829895 GAGGCTGTTTCCTCTCTGGAAGG + Intronic
949849006 3:8402929-8402951 GAGGATTTTTCCTGTTAGAGTGG + Intergenic
950728316 3:14934123-14934145 AAGGCTTTTTATTTTTTGAGAGG + Exonic
950915416 3:16639973-16639995 CAGGCTTTTCCCTTTTTAGAAGG + Intronic
951907313 3:27717873-27717895 AAGCCTTTTTCATTTCTGGGAGG - Intronic
952219405 3:31309621-31309643 ATGACTTTTTCCTTTTTTGGAGG + Intergenic
952498647 3:33938261-33938283 CAGGCTTTTCTCTTTTTGGATGG + Intergenic
953352293 3:42224259-42224281 GAGGGCTTTTCTTTTATGGGTGG + Exonic
954361176 3:50123684-50123706 GAGGCTTTCCCCTTTTCAGGTGG + Intergenic
954664157 3:52242445-52242467 GAGGCTTTTTGCCTTTTTGTGGG + Intergenic
955243345 3:57201120-57201142 GAGGCTATTTCCTCTATGAGTGG - Intronic
956325648 3:68049757-68049779 GAAGCTCTGTCCTTTTTAGGTGG + Intronic
957505231 3:81111963-81111985 GAGTATTTTCTCTTTTTGGGGGG - Intergenic
958121330 3:89293164-89293186 AAGGTTTTGTCCTTTTTGAGCGG + Intronic
958551129 3:95614585-95614607 TAGGCTTTTTACTTTCTGTGTGG - Intergenic
958884457 3:99710279-99710301 GATGCCATTTCCTTTGTGGGTGG - Intronic
959582895 3:108000113-108000135 GTGGCTCTAACCTTTTTGGGTGG + Intergenic
960577264 3:119241532-119241554 ATGGTTTGTTCCTTTTTGGGTGG - Intergenic
961966891 3:130914547-130914569 GTGTCTTTGTCTTTTTTGGGGGG + Intronic
962145291 3:132833820-132833842 GTGGCTGTTTACATTTTGGGAGG + Intergenic
962718250 3:138147379-138147401 GAGCTTTTTTGTTTTTTGGGGGG - Intergenic
962791080 3:138812236-138812258 GAGGTTTTTTTTTTTTTGGGGGG + Intronic
963085124 3:141429267-141429289 GAGGCATATTGCTTTTTGCGGGG + Intronic
963975156 3:151472358-151472380 AAATCTTTTTCCTTTTTTGGGGG + Intergenic
965394366 3:168143879-168143901 AAGCCTCTTTCCTTTTTTGGGGG - Intergenic
966222930 3:177568421-177568443 AATACTTTTTCCTTTTTTGGAGG + Intergenic
966441228 3:179946825-179946847 GCAGCTTTTTCCAGTTTGGGTGG + Intronic
966481815 3:180417979-180418001 GAGGGTTTTGCCTGCTTGGGTGG - Intergenic
967530692 3:190546279-190546301 GAGGCTTTCTCCCTTATGCGTGG + Intronic
967821785 3:193845376-193845398 GGGGCTTTTCCCCTTTTGGTAGG + Intergenic
968769548 4:2495623-2495645 GAAGCTCTTTTTTTTTTGGGGGG + Intronic
970568753 4:17358537-17358559 GAGGATTTTTTTTTTTTTGGAGG + Intergenic
971172399 4:24247200-24247222 CAGACTTTTTTCTTTTTGGGGGG - Intergenic
971733367 4:30415381-30415403 CTGGATTTTTCGTTTTTGGGAGG - Intergenic
971980240 4:33742053-33742075 AAGGATTTTTCCTTCTTTGGTGG - Intergenic
973331747 4:48916245-48916267 GAGGCTTTATCGTTTTAGGTGGG - Intergenic
973841204 4:54862677-54862699 GTTGCTTTTGCCTTTTTTGGTGG + Intergenic
974646093 4:64694672-64694694 GAGTCTTTTTCCTCTTTTGAGGG + Intergenic
975096063 4:70457852-70457874 GAAGATTTTTCCTTTGTGAGAGG - Intronic
975383954 4:73733409-73733431 GAGCCCTTTTCATTTTTAGGTGG - Intergenic
975626465 4:76354078-76354100 TAGGCTTTCTCCTTTTTGTTTGG + Intronic
975833227 4:78391974-78391996 GAGGGTTTCACCTTTTGGGGGGG + Intronic
976226483 4:82798615-82798637 GGGGCTTCTGCCTTTTAGGGGGG + Exonic
976248711 4:83029041-83029063 AAGCCTTTTTCCTTTTAGTGGGG - Intergenic
976366390 4:84237550-84237572 GAGGCTTTTCCCCTTTTGCTTGG + Intergenic
976421441 4:84849151-84849173 GATGCCTTTTCATTTTTTGGGGG - Intronic
977369415 4:96116124-96116146 GAGACTTTCTCCTTCTTAGGTGG - Intergenic
977375444 4:96197316-96197338 AAGGCTGTTTCCTCTCTGGGTGG - Intergenic
977485855 4:97645236-97645258 GAGGCTTTTTGCCTTGTGAGTGG - Intronic
977617839 4:99105572-99105594 AAGTATTTTTCCTTTTTCGGTGG + Intergenic
978787169 4:112622762-112622784 CATGCTTTTTCCTCTTTGAGAGG + Intronic
979463497 4:121009547-121009569 CAGAGTTTTTCCTATTTGGGAGG + Intergenic
979764067 4:124444555-124444577 GTCACTTTTTCCATTTTGGGGGG + Intergenic
981289451 4:143057056-143057078 GAATTTTTTTCCTTCTTGGGTGG - Intergenic
981577841 4:146223420-146223442 TAGGATTTTTCCTCTTTGGAAGG + Intergenic
981781950 4:148441205-148441227 GGAGCTTTTTCCTTTAAGGGAGG - Intronic
982541151 4:156673313-156673335 GATTTTTTTTTCTTTTTGGGCGG - Intergenic
983011113 4:162548979-162549001 GCTGCTTTCTCCTTTTTGGTGGG - Intergenic
983155318 4:164340100-164340122 CTGGCTTTTTCTTTTTTGGGAGG - Intronic
983224204 4:165071286-165071308 GAGGATTTTTTTTTTTTGGGGGG + Intergenic
983285857 4:165738240-165738262 GAGGATTTTACCTTTGAGGGAGG - Intergenic
983543155 4:168934689-168934711 CTGGTTTTTTCCTTGTTGGGAGG - Intronic
983978916 4:173970285-173970307 CTGGGTTTTTCATTTTTGGGAGG + Intergenic
984354817 4:178644321-178644343 GAGGCTTTTTCCTTGTGGAGAGG - Intergenic
984368289 4:178827460-178827482 GAGGCTTGCTTCTTTTTTGGGGG - Intergenic
984516529 4:180748085-180748107 GAGGCTTTTGGCTGTTTGGAAGG - Intergenic
986517981 5:8583070-8583092 GAGGTTCTTCCCTTTTTGGTTGG + Intergenic
988080791 5:26411714-26411736 GAGGCTTTTCCCATTTTGCTTGG + Intergenic
991482237 5:67093255-67093277 GAGTCTTTTTCCTTGTGGGTGGG - Intronic
992502484 5:77356273-77356295 GAGGCTTTTTCCTTTTCACAAGG + Intronic
992548605 5:77840280-77840302 GAGGCATTTGCATTTTTGTGGGG - Intronic
992814089 5:80419061-80419083 GTGGGTTTTTTTTTTTTGGGGGG + Intronic
993005310 5:82423110-82423132 GAGGGGCTTTCCTTTGTGGGAGG + Intergenic
993520427 5:88892661-88892683 GATATTTTTTCTTTTTTGGGGGG + Intronic
994125109 5:96160225-96160247 GAGGGGGTTTCATTTTTGGGCGG - Intergenic
994273396 5:97808220-97808242 GAGGCTTTTTTCTTTTTGAAAGG - Intergenic
994335691 5:98563065-98563087 GAGCCTTTATCCTTTTTAGAAGG - Intergenic
995524265 5:113038233-113038255 GAGGCTTTAGCATATTTGGGTGG + Intronic
995645925 5:114311457-114311479 GAGTCTTTTTCCTTTATAGTTGG + Intergenic
995661691 5:114490875-114490897 GTTTCTTTTTCTTTTTTGGGGGG + Intronic
995924025 5:117347591-117347613 GACTCTTTTTCCTTTGTGTGAGG - Intergenic
997021123 5:130002817-130002839 GATTTTTTTCCCTTTTTGGGAGG + Intronic
997733319 5:136195945-136195967 GAGGTGTCTTGCTTTTTGGGGGG + Intergenic
998031142 5:138869054-138869076 GAGCCATTTTTCTTTTTGGGTGG - Exonic
998294628 5:140955449-140955471 AGGGCTTTTTCCTTTTTGCTTGG + Intronic
998442671 5:142175404-142175426 GAGGCTTTATCCTGATTTGGGGG + Intergenic
998744024 5:145236416-145236438 GAGGCTTTTACCTTTTCATGAGG - Intergenic
999225294 5:150017691-150017713 GAAGCTTTTTGCGTTTTGGCTGG + Intronic
999566048 5:152863037-152863059 GAAGATTTTTTTTTTTTGGGGGG - Intergenic
999942897 5:156563680-156563702 GAAGCTGTTTCCCCTTTGGGGGG + Intronic
1000049597 5:157550533-157550555 GATGTTTTTTCCTTTTGGAGTGG + Intronic
1000514279 5:162220491-162220513 AAGGCCTTTTTCTTTTTGGAGGG - Intergenic
1001782209 5:174379467-174379489 CAGGCTTTTTGATTTGTGGGTGG - Intergenic
1001811047 5:174628487-174628509 GGGGTTGTTTCCTCTTTGGGAGG + Intergenic
1002079909 5:176731591-176731613 GAGCCCATTTCCTTGTTGGGAGG + Intergenic
1002212211 5:177605736-177605758 GAGTCTTTTTCCTTTGAGAGAGG - Intronic
1004098974 6:12588812-12588834 CATATTTTTTCCTTTTTGGGGGG - Intergenic
1004463638 6:15862727-15862749 GTAGATTTTTCTTTTTTGGGTGG - Intergenic
1004511795 6:16289199-16289221 GAGGCTTTTTCCTTCTGGTGGGG - Intronic
1005926661 6:30450895-30450917 GAGGCTTCTTCCTCTTTTGGGGG - Intergenic
1010209106 6:73348875-73348897 GAGACTTTTTACCCTTTGGGTGG - Intergenic
1010242423 6:73628582-73628604 TATGTATTTTCCTTTTTGGGGGG - Intronic
1011990655 6:93511829-93511851 GAAAATTTTTTCTTTTTGGGAGG + Intergenic
1012133112 6:95520308-95520330 GACTCTTTTTATTTTTTGGGGGG + Intergenic
1012321196 6:97848432-97848454 CATTCTTTTTCTTTTTTGGGGGG - Intergenic
1013537665 6:111077965-111077987 TGGGTTTTTTCTTTTTTGGGGGG - Intergenic
1013605191 6:111740850-111740872 AAAGGTTTTTCCTCTTTGGGAGG + Intronic
1014766933 6:125417580-125417602 GAGTCTTGTTCCTTGTTGAGTGG - Intergenic
1017567190 6:155699941-155699963 CAGGCTTTTGCCTTTTGGGAGGG + Intergenic
1017845789 6:158257202-158257224 CTGGCTTTTTGTTTTTTGGGAGG - Intronic
1018409769 6:163532431-163532453 CAGACTTTTACCTTGTTGGGTGG + Intronic
1018449044 6:163889053-163889075 GAGGCTTTTTTTTTTTTTGCTGG - Intergenic
1018715734 6:166531221-166531243 GAAGCTCTTACCTTTTAGGGTGG + Exonic
1018837748 6:167497983-167498005 GAGGCTTTTTCCCCTTTGCTCGG + Intergenic
1020378345 7:7513852-7513874 AAGGCGTTTTCCTTTTTGGTGGG + Intronic
1020843699 7:13255816-13255838 AAGATTTTTGCCTTTTTGGGGGG + Intergenic
1021827072 7:24565160-24565182 GAAACTTTGTCCTTTTTGGGAGG + Intergenic
1022519826 7:30998989-30999011 GGGGCTTTTTCCTTTTTGCTGGG - Intergenic
1022548700 7:31214728-31214750 GATGCTTTTTGCTTTGGGGGTGG - Intergenic
1022711897 7:32858816-32858838 GATGCTTCTTTCATTTTGGGGGG + Intergenic
1022925442 7:35051892-35051914 AAGGCTTTTCCCTTTTCTGGGGG - Intergenic
1026453335 7:70548929-70548951 CAGACTTTTTTTTTTTTGGGGGG - Intronic
1027554311 7:79644193-79644215 TAGGTATTTTCCTTTTTAGGTGG + Intergenic
1028071381 7:86455234-86455256 GAGGCATTTTCATTTTTAGAAGG - Intergenic
1028158087 7:87454990-87455012 GAGGCATTTTTTTTTTTTGGTGG + Intronic
1028289437 7:89046111-89046133 GGGGCTTTTTCCTTTTTGCTTGG + Intronic
1029754456 7:102564689-102564711 TTGTCTTTTTTCTTTTTGGGGGG + Intronic
1029772405 7:102663771-102663793 TTGTCTTTTTTCTTTTTGGGGGG + Intronic
1029823456 7:103166590-103166612 AAGGCTTTTCCCTTTTCTGGGGG - Intergenic
1032428522 7:131841666-131841688 GAGGCTTTGACCAATTTGGGAGG + Intergenic
1032958849 7:137006249-137006271 CAGGCCTCTTCCTTTTTGGCAGG + Intronic
1034413829 7:150954939-150954961 GAGGCTTGTGCTGTTTTGGGGGG - Intronic
1036461315 8:8955451-8955473 GAGGCTTTGTCATTTTTCTGTGG + Intergenic
1037625051 8:20599372-20599394 GAGGAATTTTCCATTTGGGGTGG + Intergenic
1038499270 8:28029952-28029974 CAGGCTCTTTCCTGTTTTGGTGG - Intronic
1039565069 8:38545526-38545548 GAGACTTTTTTTTTTTTGAGCGG + Intergenic
1040276179 8:46015211-46015233 AAGGCATTTTCCTCTGTGGGAGG + Intergenic
1041961309 8:63619602-63619624 AATGCATTTTCTTTTTTGGGGGG + Intergenic
1041985047 8:63911274-63911296 GATAGTCTTTCCTTTTTGGGAGG + Intergenic
1042301233 8:67284835-67284857 GAGTCTTTGTCCTTTTTAGTGGG - Intronic
1044025393 8:87164418-87164440 GATGTTTTTTCCTTTTTGTTGGG + Intronic
1045092979 8:98766243-98766265 GATACTTTTTTCTTTTTGAGGGG - Intronic
1045692630 8:104775175-104775197 CAGCATTTTTGCTTTTTGGGTGG + Intronic
1046653248 8:116863711-116863733 GAGGCGTTGTTCTTTTGGGGGGG - Intronic
1047878252 8:129164624-129164646 GAGAATGTTTCCTTTTTGGCAGG - Intergenic
1048124510 8:131618090-131618112 GATTTTTTTTTCTTTTTGGGGGG - Intergenic
1048960318 8:139571272-139571294 GATGATGTTTCCTTTTGGGGTGG + Intergenic
1049298478 8:141856372-141856394 TGAGCATTTTCCTTTTTGGGAGG + Intergenic
1050189466 9:3009840-3009862 GAGGCTTTTCCCCTTTTGCTCGG - Intergenic
1050599107 9:7233125-7233147 AAAACTTTCTCCTTTTTGGGTGG - Intergenic
1050986396 9:12088586-12088608 AGGGCTTTTTTTTTTTTGGGGGG + Intergenic
1052528328 9:29650375-29650397 CAGGCTTTTTCCTTTTCCAGTGG + Intergenic
1053326012 9:37151958-37151980 GAGACTTTTTACTTTGTGTGAGG - Intronic
1053837054 9:42149891-42149913 GAGGTTTCTTCCTTTCTTGGAGG - Intergenic
1055711643 9:79068958-79068980 CAGTCTTCTTCCTGTTTGGGAGG + Intergenic
1055919413 9:81442459-81442481 AAGGTTTTTTTTTTTTTGGGGGG - Intergenic
1056597237 9:88017693-88017715 CAGGGTTTTTTCTTTTTTGGGGG + Intergenic
1058805630 9:108588506-108588528 GATGCTTATCCCTTTTTGGAAGG - Intergenic
1058940388 9:109807910-109807932 GGGGCTTTTTCCTGTTTTGCTGG + Intronic
1060056426 9:120417856-120417878 GAAGCTTTTCCCTTATTTGGGGG - Intronic
1061733199 9:132632859-132632881 GAGAATTTTTGCTCTTTGGGTGG - Intronic
1062051211 9:134448015-134448037 GAAGATTTTTCCTTTGTTGGAGG + Intergenic
1186662803 X:11686068-11686090 TAGGCCTTTTCCTCTTTTGGGGG + Intergenic
1187698959 X:21946506-21946528 GAGGTTTTTTACTTTTTGAGTGG + Intronic
1187984909 X:24799690-24799712 AAGGCTATTTCCTTTGTGTGTGG + Intronic
1187986672 X:24820709-24820731 GAGGTTTTTTTTTTTTTTGGAGG + Intronic
1188051090 X:25487324-25487346 GAAGCTTTTTTTTTTTTGGATGG - Intergenic
1188702946 X:33287981-33288003 GAGGCTCTTTCACTTTTGCGGGG - Intronic
1188783101 X:34309341-34309363 GAGGCATTTTTTATTTTGGGGGG + Intergenic
1189255744 X:39637549-39637571 GAGGTTTTTTTGTTTTTTGGGGG + Intergenic
1189349855 X:40268022-40268044 GAGGACTTATCCTTTTTGGCAGG + Intergenic
1189635544 X:43004650-43004672 GAAGCTTTTCCCTCTTTGGCCGG + Intergenic
1192700029 X:73459041-73459063 GGGGTTTATTCCTATTTGGGGGG - Intergenic
1193219441 X:78905769-78905791 AAGACTTTTTAATTTTTGGGGGG + Intergenic
1193379977 X:80808073-80808095 CAGGCTTGGTCTTTTTTGGGGGG - Intronic
1194688574 X:96955243-96955265 GAGGCTTTTCCCCTTTTGCTTGG - Intronic
1195111573 X:101656243-101656265 AAGGCTTTTTCCTTAATGTGTGG + Exonic
1196071146 X:111523596-111523618 GAGGTGTTTTCATTTCTGGGAGG - Intergenic
1196231360 X:113226488-113226510 GAGGCTTTTACACTGTTGGGAGG - Intergenic
1196429860 X:115612515-115612537 GACAGTTTTTCCTTTTTGTGGGG + Intronic
1197075937 X:122352048-122352070 TAAGCTTTTTCCTTTTTAGCAGG - Intergenic
1197587452 X:128365859-128365881 GAGGCTTTGTGCTTATTTGGTGG - Intergenic
1198692914 X:139303558-139303580 GTGCCTTTTTCCATTTGGGGTGG + Intergenic
1199163117 X:144637827-144637849 GAGGCTTTTCCCTTTTTGCTTGG - Intergenic
1199220183 X:145308666-145308688 GAGGCTTTTTCCCCTTTGCTAGG - Intergenic
1200375982 X:155780755-155780777 GGGGCCTTCTCCTCTTTGGGAGG - Exonic
1200797920 Y:7358700-7358722 TAGGGCTTTGCCTTTTTGGGGGG + Intergenic
1200892146 Y:8335554-8335576 GAGGCTTATTCTTTTTTGCCTGG + Intergenic
1200921680 Y:8618888-8618910 GTGGCTTTTTTTTTTTTGGCAGG - Intergenic
1202016797 Y:20416963-20416985 GAGGTATGTTCTTTTTTGGGGGG + Intergenic
1202098174 Y:21276194-21276216 GATTGTTTTTCTTTTTTGGGGGG + Intergenic