ID: 1127622007

View in Genome Browser
Species Human (GRCh38)
Location 15:60743300-60743322
Sequence GCATTTACAGCCGGGTGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1704
Summary {0: 1, 1: 0, 2: 25, 3: 213, 4: 1465}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127622007_1127622011 -1 Left 1127622007 15:60743300-60743322 CCACCGCACCCGGCTGTAAATGC 0: 1
1: 0
2: 25
3: 213
4: 1465
Right 1127622011 15:60743322-60743344 CATTGACTCATGACTGATACTGG 0: 1
1: 0
2: 0
3: 8
4: 93
1127622007_1127622012 13 Left 1127622007 15:60743300-60743322 CCACCGCACCCGGCTGTAAATGC 0: 1
1: 0
2: 25
3: 213
4: 1465
Right 1127622012 15:60743336-60743358 TGATACTGGTTCTATGATGCTGG 0: 1
1: 0
2: 0
3: 6
4: 134
1127622007_1127622013 30 Left 1127622007 15:60743300-60743322 CCACCGCACCCGGCTGTAAATGC 0: 1
1: 0
2: 25
3: 213
4: 1465
Right 1127622013 15:60743353-60743375 TGCTGGCAAAAATTAAACTTAGG 0: 1
1: 0
2: 0
3: 22
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127622007 Original CRISPR GCATTTACAGCCGGGTGCGG TGG (reversed) Intronic
900248117 1:1648919-1648941 GCATGTCCGGCCGGGCGCGGTGG - Intronic
900268141 1:1770759-1770781 TAATTTACAGCTGGGTGTGGTGG + Intronic
900327692 1:2117235-2117257 GAATTTAAGGCCGGGTGCAGTGG - Intronic
900356128 1:2265097-2265119 GCATGTCCAGCCGGGCGCCGTGG - Intronic
901105854 1:6755896-6755918 AAATTGACAGCCGGGTGTGGTGG + Intergenic
901126113 1:6929992-6930014 GCATTTACAGCCTGGTGTAGGGG - Intronic
901126123 1:6930044-6930066 GCATTTACAGCCTGGTGCAAAGG - Intronic
901210603 1:7523589-7523611 TCATTTTTGGCCGGGTGCGGTGG + Intronic
901242151 1:7701706-7701728 GCAGATACAGCCGGGCACGGTGG - Intronic
901321230 1:8341245-8341267 CACTTCACAGCCGGGTGCGGTGG + Intronic
901717016 1:11163772-11163794 ACATTTAAAGCAGGGTGTGGAGG + Intronic
901752270 1:11417724-11417746 AAATATACAGCCGAGTGCGGTGG + Intergenic
901924936 1:12560246-12560268 GGCTTCATAGCCGGGTGCGGTGG - Intergenic
902040997 1:13492411-13492433 GGATTTTTGGCCGGGTGCGGTGG + Intronic
902050122 1:13557261-13557283 ACACTTATAGCCGGGTGCGGTGG + Intergenic
902523009 1:17032473-17032495 ATAATTACTGCCGGGTGCGGTGG - Intronic
902582251 1:17415423-17415445 ACACTAACAGCCGGGCGCGGTGG + Intronic
902833350 1:19032118-19032140 GCATTTCATGCTGGGTGCGGTGG - Intergenic
902898982 1:19500808-19500830 GGATTTCCAGCCAGGTGCGGTGG + Intergenic
902900660 1:19513496-19513518 GCACTTACGGCTGGGCGCGGTGG - Intergenic
902973704 1:20073593-20073615 GCATTAGGGGCCGGGTGCGGTGG + Intronic
903084404 1:20842651-20842673 CATTTTACAGCCGGGCGCGGTGG - Intronic
903097375 1:20990385-20990407 TAATTACCAGCCGGGTGCGGTGG + Intronic
903206631 1:21787251-21787273 GCACTTACGGCCGGGCGCGGTGG + Intergenic
903273450 1:22206471-22206493 TCATTCATGGCCGGGTGCGGTGG - Intergenic
903307183 1:22421167-22421189 GCATTCACAGCTGGGCGTGGTGG - Intergenic
903313700 1:22482782-22482804 GCATTTAAGGCCGGGTGCGGTGG + Intronic
903972852 1:27130387-27130409 GCAGTTTAGGCCGGGTGCGGTGG - Intronic
904059517 1:27697082-27697104 GTATTTACGGCTGGGCGCGGTGG + Intergenic
904144679 1:28380341-28380363 ACATTTAAGGCCGGGCGCGGTGG - Intronic
904220335 1:28962349-28962371 GCAATTATGGCCGGGAGCGGTGG - Intronic
904475974 1:30764792-30764814 ACATATATAGCCAGGTGCGGTGG - Intergenic
904722120 1:32518063-32518085 ACTTTTACGGCCGGGCGCGGTGG + Intronic
904800288 1:33087721-33087743 GCATTGCCAGTCGGGTGTGGTGG - Intronic
904819530 1:33232546-33232568 GCATTTCTGGCCGGGCGCGGTGG - Intergenic
904855180 1:33492485-33492507 GAATTTATGGCCAGGTGCGGTGG + Intronic
905083775 1:35350572-35350594 GTAATTTCAGCCGGGTGTGGTGG - Intronic
905098313 1:35495083-35495105 ACTTTTATAGCCAGGTGCGGTGG + Intronic
905612314 1:39364777-39364799 ACATTTACGGCCGGGCGCGGTGG - Intronic
905615050 1:39390818-39390840 GTTTTATCAGCCGGGTGCGGTGG + Intronic
906275072 1:44509261-44509283 GCATAGGCAGCCGGGTGTGGTGG + Intronic
906303894 1:44704011-44704033 GGATTCCCGGCCGGGTGCGGTGG - Intronic
906327278 1:44854873-44854895 GCAGTCTCAGCCGGATGCGGTGG - Intronic
906454506 1:45982134-45982156 AAAATTACAGCCGGGCGCGGTGG - Intronic
906466042 1:46080347-46080369 CCATTTAAGGCCGGGTGCAGTGG - Intronic
906643685 1:47457718-47457740 GCAGGTCCAGCCGGGCGCGGTGG - Intergenic
906796451 1:48700064-48700086 TCATTAACATCCGGGTGCAGTGG - Intronic
906838793 1:49113235-49113257 AAATTTAAGGCCGGGTGCGGTGG - Intronic
906995624 1:50790425-50790447 ACAAATAAAGCCGGGTGCGGTGG - Intronic
907166770 1:52419066-52419088 GCATTTTTGGCCAGGTGCGGTGG + Exonic
907434896 1:54439226-54439248 ACATTTCTGGCCGGGTGCGGTGG + Intergenic
907669599 1:56463059-56463081 GCATTCATGGCCGGGCGCGGTGG - Intergenic
907824438 1:58001545-58001567 GCCTTTTCAGCTGGGTGTGGTGG - Intronic
907829479 1:58050814-58050836 GCAATGAGGGCCGGGTGCGGTGG - Intronic
907835041 1:58101027-58101049 CCAGTCACAGCCGGGCGCGGTGG + Intronic
908330985 1:63070976-63070998 GCAGTTAAAGCTGGGTGTGGTGG - Intergenic
908615816 1:65921253-65921275 GCTTTTAGGGCCGGGCGCGGTGG - Intronic
908756460 1:67473355-67473377 GCTTTTCCGGCCGGGTGCGGTGG - Intergenic
908825487 1:68129035-68129057 CCGCATACAGCCGGGTGCGGTGG + Intronic
908923082 1:69219847-69219869 GCTTGTTCAGCCGGGTGCAGTGG - Intergenic
909108386 1:71442325-71442347 ACATTTTCAGCCGGGTGCGGTGG + Intronic
909252057 1:73371025-73371047 TCATTTCCGGCCGGGCGCGGTGG + Intergenic
909301798 1:74022073-74022095 TCTCTTACAGCCGGGTGCGGTGG + Intergenic
909647960 1:77938361-77938383 TAGTCTACAGCCGGGTGCGGTGG + Intronic
909802923 1:79835839-79835861 GAAATCTCAGCCGGGTGCGGTGG + Intergenic
910252348 1:85211088-85211110 TTATTTTCAGCCGGGCGCGGTGG + Intergenic
910650314 1:89559355-89559377 GTACTTCCTGCCGGGTGCGGTGG + Intronic
910940421 1:92527125-92527147 GTATTTAGGGCCAGGTGCGGTGG + Intronic
910963578 1:92785790-92785812 GAAGTGACAGCCGGGCGCGGTGG + Intronic
910993288 1:93078084-93078106 GCAGATGCAGCCGGGCGCGGTGG - Intergenic
911297600 1:96136583-96136605 GCATTTGAGGCCGGGTGCGGTGG + Intergenic
911601672 1:99854473-99854495 TAATTTGAAGCCGGGTGCGGTGG + Intronic
911933213 1:103931724-103931746 GAATTCACGGCCGGGCGCGGTGG - Intergenic
912056472 1:105605348-105605370 CATTTTACAGCCAGGTGCGGTGG + Intergenic
912599579 1:110915196-110915218 AAATTTACGGCCGGGCGCGGTGG + Intergenic
912806597 1:112761255-112761277 GTAGTTTCAGCCGGGTGCGGTGG - Intergenic
913089837 1:115469097-115469119 GTATTTTCAGCCGAGTGTGGTGG - Intergenic
913310672 1:117488481-117488503 CCATTTGCAGCCGGGTATGGTGG - Intronic
913557980 1:119988160-119988182 GCATTTACAGCCTTGTGAGTGGG + Intronic
913593953 1:120355429-120355451 TCAATTTCAGCCGGGCGCGGTGG + Intergenic
913712248 1:121496885-121496907 GCAGTTTAGGCCGGGTGCGGTGG - Intergenic
914093303 1:144523557-144523579 TCAATTTCAGCCGGGCGCGGTGG - Intergenic
914141868 1:144956733-144956755 GCATCTAGGGCCGGGCGCGGTGG - Intronic
914201370 1:145488213-145488235 GAATTTACCGCCGGGCGCGGTGG - Intergenic
914305226 1:146410343-146410365 TCAATTTCAGCCGGGCGCGGTGG + Intergenic
914480491 1:148061340-148061362 GAATTTACCGCCGGGCGCGGTGG - Intergenic
914518399 1:148393717-148393739 GCTTTTTTGGCCGGGTGCGGTGG + Intergenic
914596834 1:149162480-149162502 TCAATTTCAGCCGGGCGCGGTGG - Intergenic
914705775 1:150168760-150168782 ACATTTTCAGCTGGGTGTGGTGG - Intergenic
914709136 1:150196980-150197002 GCATTCACAGCCAGGCGCGGTGG + Intergenic
914720543 1:150285248-150285270 CTATTTTCAGCCGGGAGCGGTGG + Intronic
914761173 1:150599611-150599633 CTATTTACAGCCGGGTGCAGTGG - Intergenic
915183585 1:154084497-154084519 AAATTTAAGGCCGGGTGCGGTGG - Intronic
915197166 1:154198148-154198170 GCATTTACATCAGGGAGCGATGG + Intergenic
915264309 1:154705056-154705078 GTATATATAGCCAGGTGCGGTGG - Exonic
915436070 1:155907541-155907563 GCATACAAGGCCGGGTGCGGAGG - Intronic
916088556 1:161289197-161289219 GCTTATTAAGCCGGGTGCGGTGG + Intergenic
916230940 1:162540722-162540744 CCAATTACGGCCGGGCGCGGTGG - Intergenic
916238447 1:162614161-162614183 GCATAAATAGCCGGGCGCGGTGG + Intergenic
916241068 1:162640325-162640347 TCATTTTCAGCTGGGCGCGGTGG - Intronic
916375933 1:164153114-164153136 GAATTTAAGGCCGGGTGCAGTGG + Intergenic
916729059 1:167550274-167550296 GCATATAGAGGCGGGTGCGGAGG - Intronic
916744548 1:167674917-167674939 ACATATCCAGCCGGGTGCGGTGG + Intronic
917108818 1:171523746-171523768 ACATTTAGGGCTGGGTGCGGTGG + Intronic
917283745 1:173403614-173403636 GCGTTTTCAGCTGGGCGCGGTGG + Intergenic
917431502 1:174974275-174974297 AGCTGTACAGCCGGGTGCGGTGG - Intronic
917451266 1:175149755-175149777 GGAATTCCAGCCAGGTGCGGCGG - Intergenic
918044562 1:180933965-180933987 GACTTTAAGGCCGGGTGCGGTGG + Intronic
918077476 1:181181529-181181551 GCCTTTCCAGCCGGGTGCAGTGG - Intergenic
918138147 1:181695673-181695695 GAATCTACAGCTGGGTGTGGTGG + Intronic
918282525 1:183021071-183021093 TCATTATCAGCCGGGCGCGGTGG - Intergenic
918549570 1:185726789-185726811 GCACTTAAGGCTGGGTGCGGTGG + Intergenic
918983047 1:191588101-191588123 GCATTTAGGGCGGGGTGCAGTGG - Intergenic
918988234 1:191661162-191661184 CAATTTACAGCCGAGTGCTGTGG + Intergenic
919139884 1:193557254-193557276 ACATTTCCGGCCGGGCGCGGTGG + Intergenic
919556132 1:199056436-199056458 GCATTTACGGTCGGGCGCGGTGG + Intergenic
919617423 1:199825100-199825122 ACAATGACAGCCAGGTGCGGTGG + Intergenic
919725376 1:200879159-200879181 ACATTTGCAGCTGGGTGTGGTGG - Intergenic
919732153 1:200920248-200920270 AGATTTTCAGCCGGGTGCAGTGG - Intergenic
920321111 1:205123354-205123376 TCTTTTGCAGCCGGGTGCGGTGG + Intergenic
920330696 1:205205730-205205752 GCATTTTCGGCTGGGCGCGGTGG - Intronic
920357345 1:205383921-205383943 GGATATAAGGCCGGGTGCGGTGG - Intronic
920944516 1:210515778-210515800 GTATTTTCAGCCAGGTGCAGTGG + Intronic
921110651 1:212033792-212033814 ACATTTAAGGCCGGGCGCGGTGG + Intronic
921388917 1:214599869-214599891 AGATTTTCAGCCAGGTGCGGTGG + Intergenic
921536932 1:216362653-216362675 TTATTTACGGCAGGGTGCGGTGG + Intronic
921575436 1:216829839-216829861 GCATTTCAGGCCGGGCGCGGTGG - Intronic
921656440 1:217744173-217744195 GAATTTTCGGCCGGGCGCGGTGG + Intronic
922003111 1:221501377-221501399 GCAGCCCCAGCCGGGTGCGGTGG + Intergenic
922069625 1:222178784-222178806 CCATTTAAGGCCGGGTGTGGTGG + Intergenic
922176396 1:223201196-223201218 GCACTTTCGGCCGGGTGCGGTGG + Intergenic
922312035 1:224403335-224403357 GCATTTGTGGCCGGGCGCGGTGG - Intronic
922383943 1:225061769-225061791 GAATATACAGCCAGGTGTGGTGG - Intronic
922403018 1:225280310-225280332 TCAATCACAGCTGGGTGCGGTGG + Intronic
922419595 1:225450565-225450587 ACAGTTGCAGCCGGGTGTGGTGG - Intergenic
922466958 1:225850996-225851018 ACATACACTGCCGGGTGCGGTGG - Intronic
922487586 1:225987338-225987360 GCATCTTCAGCCAGGTGCGGTGG - Intronic
922650598 1:227334790-227334812 GCATTTAGGGCCGGGCGTGGTGG + Intergenic
923044538 1:230346006-230346028 GCATTTAAAGCTGGGTGCAGTGG - Intronic
923188235 1:231595121-231595143 GACTTTACAGCTGGGCGCGGTGG + Intronic
923229671 1:231973331-231973353 ACATTGGCGGCCGGGTGCGGTGG - Intronic
923349101 1:233086368-233086390 TCAGTTCCAGCCGGGTGCAGTGG + Intronic
923807012 1:237268648-237268670 GCAAATACAGCCGGGTGCGGTGG + Intronic
924120817 1:240796072-240796094 TCATTTAAGGCCGGGTGCAGTGG - Intronic
924226116 1:241923021-241923043 GAATTTTCAGCGGGGCGCGGTGG + Intergenic
924362780 1:243258689-243258711 GAATTATCAGCCGGGCGCGGTGG - Intronic
924503963 1:244663461-244663483 AAATTTGCAGCCAGGTGCGGTGG - Intronic
924578647 1:245303483-245303505 ACATTTAGGGCCGGGCGCGGTGG - Intronic
924826638 1:247546646-247546668 CCATTTTCAGCCGGGCGCGGTGG - Intronic
924845665 1:247767523-247767545 CAATTTCCAGCCGGGTGTGGTGG + Intergenic
1062887922 10:1033249-1033271 GAACTTACGACCGGGTGCGGCGG - Intergenic
1063085657 10:2815562-2815584 GGTTTTCCAGCCGGGTGCGATGG - Intergenic
1063460579 10:6212785-6212807 GAGTTTACAGCCAGGCGCGGTGG - Intronic
1063512728 10:6662178-6662200 GCAATCCAAGCCGGGTGCGGTGG + Intergenic
1063712820 10:8496047-8496069 AAATATACAGCCGGGTACGGTGG - Intergenic
1064036759 10:11919903-11919925 ACATTCTCGGCCGGGTGCGGCGG - Intergenic
1064044610 10:12001125-12001147 ATATTTAGGGCCGGGTGCGGTGG + Intronic
1064071658 10:12234504-12234526 GTAATTCCAGCCAGGTGCGGAGG - Intronic
1064208163 10:13342291-13342313 AAACATACAGCCGGGTGCGGTGG + Intronic
1064259266 10:13771790-13771812 GCATTGCCAGCTGGGTGCGGTGG + Intronic
1064386367 10:14895461-14895483 GCAGTTCCGGCTGGGTGCGGTGG - Intronic
1064456338 10:15490761-15490783 TCATGTAGGGCCGGGTGCGGTGG - Intergenic
1064673999 10:17743229-17743251 AAATTTCTAGCCGGGTGCGGTGG - Intergenic
1064905590 10:20342532-20342554 GCATTCCCAGCCAGGTGCAGTGG + Intergenic
1065069650 10:22009635-22009657 GCATTTGTTGCTGGGTGCGGTGG + Intergenic
1065271619 10:24039029-24039051 CAATTTTCAGCTGGGTGCGGTGG - Intronic
1065360794 10:24887255-24887277 GTATTAACGGCCGGGCGCGGTGG - Intronic
1065379412 10:25074632-25074654 GCATTCAAGGCCGGGTGCGGTGG - Intergenic
1065441518 10:25757049-25757071 AGCTTTCCAGCCGGGTGCGGTGG + Intergenic
1065826519 10:29577164-29577186 TCATTTGCAGTCAGGTGCGGTGG - Intronic
1065850283 10:29782071-29782093 GAAATTAAGGCCGGGTGCGGTGG + Intergenic
1065883183 10:30054954-30054976 GCATTTTCGGCCGGGCGCGGTGG - Intronic
1065884864 10:30068099-30068121 GGATGTACGGCCGGGTGCGGTGG + Intronic
1065892155 10:30130639-30130661 GCTTTCTCAGCCGGGCGCGGTGG + Intergenic
1065922096 10:30401904-30401926 GAATATTCGGCCGGGTGCGGCGG + Intergenic
1066127558 10:32356695-32356717 ACATTTACCGCCAGGCGCGGTGG + Intronic
1066799111 10:39164393-39164415 GCATTTAAAGCAGTGTGCAGAGG - Intergenic
1066973609 10:42342500-42342522 GGATGTGCAGCCGGGTGCGGTGG - Intergenic
1067001883 10:42622978-42623000 GTAGGTACGGCCGGGTGCGGTGG + Intronic
1067305655 10:45061602-45061624 GCTTTTAAGGCCAGGTGCGGTGG - Intergenic
1067628262 10:47941365-47941387 GCATTTTCAGCTGGGTGTGGTGG + Intergenic
1068260703 10:54577377-54577399 AAATTTTCAGCCGGGAGCGGTGG - Intronic
1068393908 10:56436277-56436299 GCCTTCTCAGCCGGGTGCAGTGG - Intergenic
1068526419 10:58135115-58135137 TGTTTAACAGCCGGGTGCGGTGG + Intergenic
1068912450 10:62392917-62392939 GCACATAGGGCCGGGTGCGGTGG - Intronic
1069017810 10:63450232-63450254 GCAATTAAAGCCAGGTGCAGAGG + Intronic
1069228639 10:65977491-65977513 ACTTTTGCAGCCAGGTGCGGTGG + Intronic
1069433165 10:68355625-68355647 GCATTTTCGGCTGGGTGCGGTGG + Intronic
1069574769 10:69518707-69518729 GAGTTTATGGCCGGGTGCGGTGG - Intergenic
1069670547 10:70198553-70198575 GTATTTGAAGCCGGGTGTGGTGG + Intergenic
1069701988 10:70433700-70433722 GTATTCACAGCCGGGCACGGTGG - Intronic
1069951119 10:72018864-72018886 GAATTAGCAGCTGGGTGCGGTGG + Intergenic
1069975343 10:72208470-72208492 ACATTTGTGGCCGGGTGCGGTGG + Intronic
1069990350 10:72311408-72311430 GCATTCAAGGCCGGGCGCGGTGG + Intergenic
1070146419 10:73776964-73776986 GTATTTGAGGCCGGGTGCGGTGG - Intronic
1070270275 10:74947277-74947299 GTTTTTTCAGCCGGGAGCGGTGG - Intronic
1070300623 10:75201196-75201218 GACTTTCCCGCCGGGTGCGGTGG - Intergenic
1070875502 10:79802909-79802931 CTTTTTACGGCCGGGTGCGGTGG - Intergenic
1071174750 10:82912936-82912958 GTACTTCCGGCCGGGTGCGGTGG + Intronic
1071297945 10:84236007-84236029 GTATTGCCGGCCGGGTGCGGTGG + Intronic
1071501570 10:86207915-86207937 GCATCTGCGGCCGGGCGCGGTGG - Intronic
1071642431 10:87325059-87325081 CTTTTTACGGCCGGGTGCGGTGG - Intergenic
1071682965 10:87726029-87726051 GTATTTTCAGCCAGGTGCAGTGG - Intronic
1072273552 10:93800753-93800775 CTATTCTCAGCCGGGTGCGGTGG - Intergenic
1072415634 10:95244610-95244632 GCATTTGGGGCCGGGTGCAGTGG + Intronic
1072595800 10:96870296-96870318 GGGTTTAGGGCCGGGTGCGGTGG - Intronic
1072754545 10:98010325-98010347 GCATTGAGGGCCGGGTGCAGTGG - Intronic
1073024662 10:100478868-100478890 TGATTTACAGCCAGGTGGGGTGG - Intronic
1073132374 10:101197907-101197929 CCTTTTAAAGCCGGGTGTGGTGG - Intergenic
1073273564 10:102288422-102288444 GAAATTACGGCCGGGCGCGGTGG + Intronic
1073343880 10:102767367-102767389 CCATTTAAAGCTGGGTGCAGTGG + Intronic
1073374228 10:103018978-103019000 ATATTTACGGCCGGGTGCAGTGG + Intronic
1073414523 10:103369648-103369670 AAAATTTCAGCCGGGTGCGGTGG - Intronic
1073422122 10:103433205-103433227 GTATTTACGGCCAGGTGTGGTGG + Intronic
1074326054 10:112452281-112452303 GCATTTAGGGCCGGGCGCGGTGG + Intronic
1074330019 10:112497028-112497050 TGATTTAGAGCTGGGTGCGGTGG + Intronic
1074552332 10:114456099-114456121 CAGTTTCCAGCCGGGTGCGGTGG - Intronic
1074764680 10:116691907-116691929 GCATTTTCAGCTTGGTGTGGAGG - Intronic
1075100525 10:119503088-119503110 GCAACTAAGGCCGGGTGCGGTGG + Intronic
1075384944 10:122048643-122048665 GCCTCCCCAGCCGGGTGCGGTGG - Intronic
1075416833 10:122270459-122270481 GCACTTAGGGCCAGGTGCGGTGG + Intergenic
1076123852 10:127959181-127959203 GCAATTTCAGCCGGGCGTGGTGG - Intronic
1076207641 10:128615875-128615897 TCATTTTCAGCCAGGTGCGGTGG + Intergenic
1076470632 10:130715786-130715808 GCACTAAAGGCCGGGTGCGGTGG - Intergenic
1076541496 10:131218009-131218031 CCAGCTACAGCCGGGTGCGTTGG - Intronic
1077040861 11:521625-521647 ACAATTACAGCCCGGTGAGGTGG + Intergenic
1077339564 11:2020094-2020116 GAATTTACAGCCAGGTGCGGTGG + Intergenic
1077925688 11:6680289-6680311 AATTTTACTGCCGGGTGCGGTGG - Intergenic
1078117462 11:8467657-8467679 TCACTTCCAGCCGGGTGCAGTGG + Intronic
1078208459 11:9250844-9250866 GGACTTCCGGCCGGGTGCGGTGG + Intronic
1078604078 11:12759573-12759595 GTATTTCCAGCTGGGCGCGGTGG + Intronic
1079223713 11:18587513-18587535 TTATTTAAGGCCGGGTGCGGTGG + Intronic
1080104820 11:28500808-28500830 GCATTCAAAGCCGGGTGCAGTGG - Intergenic
1080353520 11:31413617-31413639 GTATTTATGGCCGGGTGCAGTGG - Intronic
1080543083 11:33288163-33288185 AGATATACAGCCGGGTGCAGTGG + Intronic
1080722235 11:34861282-34861304 GCAGTTAATGCCGGGCGCGGTGG + Intronic
1081183616 11:40014978-40015000 ACACTTACGGCCGGGTGCAGTGG - Intergenic
1081305976 11:41512770-41512792 CCATTCCCAGCCAGGTGCGGTGG + Intergenic
1081528066 11:43940645-43940667 AGAATTTCAGCCGGGTGCGGTGG - Intronic
1081633641 11:44706056-44706078 CCATTTCCAGCCGGGCACGGTGG + Intergenic
1081953670 11:47069998-47070020 GCAACAACGGCCGGGTGCGGTGG - Intronic
1081962047 11:47145271-47145293 GGCAATACAGCCGGGTGCGGTGG - Intronic
1081965384 11:47166147-47166169 GCATTTTCGGCCGGGTGTGGTGG - Intronic
1082810174 11:57474818-57474840 GAATTAACAGCGGGGGGCGGCGG - Intronic
1083236207 11:61352372-61352394 GCAATGACGGCCGGGTGCAGTGG + Intronic
1083336589 11:61925343-61925365 CCATATAGAGCCGGGTGCAGTGG + Intergenic
1083569110 11:63746799-63746821 TCCTTAACAGCCGGGTGCGGTGG - Intronic
1083793563 11:65001535-65001557 TCACTTACGGCCGGGTGCAGTGG - Intergenic
1084081753 11:66831706-66831728 ACATTTTCGGCCGGGTGCGGTGG + Intronic
1084096384 11:66914222-66914244 GGCTTTGCAGCTGGGTGCGGTGG + Intronic
1084135722 11:67179565-67179587 GCATTCCAGGCCGGGTGCGGTGG - Intronic
1084277450 11:68061391-68061413 GAATTGTCAGCCGGGTACGGTGG - Intronic
1084592084 11:70096571-70096593 ACAGTTTCAGCCGGGAGCGGTGG + Intronic
1084740843 11:71138527-71138549 GCATATCCGGCCGGGCGCGGTGG + Intronic
1084924173 11:72498636-72498658 ACAATTGCAGCCGGGTGCAGTGG - Intergenic
1084951236 11:72666816-72666838 ACAGTCACAGCCGGGTGCAGTGG + Intronic
1085137833 11:74109783-74109805 GAATTTGAGGCCGGGTGCGGTGG + Intronic
1085168429 11:74425759-74425781 GCGTTTGCAGCTGGGTGTGGTGG - Intergenic
1085183638 11:74557193-74557215 TAATTTTCAGCTGGGTGCGGTGG + Intronic
1085289773 11:75389549-75389571 GCAATGACGGCCGGGCGCGGTGG + Intergenic
1085494869 11:76959839-76959861 ACACTAACGGCCGGGTGCGGTGG - Intronic
1085593126 11:77783552-77783574 CCATTATCAGCCGGGTGCAGTGG + Intronic
1085598043 11:77828378-77828400 AAAATTATAGCCGGGTGCGGTGG + Intronic
1085648197 11:78242213-78242235 AAATTTAGAGCCGGGTGTGGTGG + Intronic
1085661159 11:78368101-78368123 GCACTGACAGCCGGGCGCAGTGG - Intronic
1085853951 11:80154457-80154479 ACGTTTTCAGCCAGGTGCGGTGG - Intergenic
1086328366 11:85727865-85727887 GCTTTTAGAGCCGGGAGAGGAGG + Intronic
1086447798 11:86886649-86886671 GGACTTGCAGCCAGGTGCGGTGG + Intronic
1086465154 11:87045315-87045337 ACAACTTCAGCCGGGTGCGGTGG - Intronic
1086479319 11:87217496-87217518 GGATTTGGGGCCGGGTGCGGTGG + Intronic
1086997029 11:93369642-93369664 GGATTTACGGCCGGGCGCGGTGG + Intronic
1087478215 11:98664779-98664801 GGAGTTGCAGCCGGGTACGGTGG - Intergenic
1087526836 11:99324926-99324948 GAATTTACAGCTGGGTGCAGTGG - Intronic
1087810240 11:102602253-102602275 GCATTTTTGGCCGGGCGCGGTGG - Intronic
1087851227 11:103032440-103032462 CCAGTTGCAGCCGGGCGCGGTGG + Intergenic
1087891211 11:103540393-103540415 AGAATTACAGCCGGGCGCGGTGG - Intergenic
1088473040 11:110207259-110207281 GCATTTATGGCCAGGTGCGGTGG - Intronic
1088625672 11:111728639-111728661 GCAGTATCAGCCGGGCGCGGTGG + Exonic
1088636450 11:111825758-111825780 ATATATACAGCCGGGCGCGGTGG + Intronic
1088891725 11:114049919-114049941 TCTTTTCCAGCCGGGTGCGGTGG + Intergenic
1089062392 11:115636362-115636384 GCATTTTCAGCCGGGCGCAGTGG + Intergenic
1089136662 11:116254679-116254701 TCATTTTCGGCCGGGCGCGGTGG - Intergenic
1089355156 11:117844776-117844798 GTATTTTCAGCCAGGCGCGGTGG - Intronic
1089531051 11:119129749-119129771 ACATTTTGGGCCGGGTGCGGTGG - Intronic
1089919560 11:122195563-122195585 GAATTTAAGGCCGGGCGCGGTGG - Intergenic
1090023697 11:123149893-123149915 TCATTTAAACCCGGGAGCGGAGG - Intronic
1090031382 11:123209518-123209540 GCAATCTCAGCTGGGTGCGGTGG + Intergenic
1090099761 11:123782075-123782097 TTATTAACAGCCGGGTGGGGTGG + Intergenic
1090122226 11:124042682-124042704 TCCTTTGCGGCCGGGTGCGGTGG + Intergenic
1090133015 11:124164809-124164831 GTATTAAGGGCCGGGTGCGGTGG - Intergenic
1090581067 11:128159667-128159689 GAAGCTGCAGCCGGGTGCGGTGG + Intergenic
1090652622 11:128821074-128821096 CCATTTCCTGCCGGGGGCGGTGG + Intergenic
1090820196 11:130335172-130335194 GCATTTGGGGCTGGGTGCGGTGG + Intergenic
1090927412 11:131260810-131260832 CTATTTACAGCCAAGTGCGGTGG - Intergenic
1202822549 11_KI270721v1_random:75283-75305 GAATTTACAGCCAGGTGCGGTGG + Intergenic
1091543792 12:1486710-1486732 GATTTCACAGCCGGGTGCGGTGG - Intronic
1091566470 12:1652392-1652414 TGACTTACAGCCGGGTGTGGTGG + Intergenic
1092212390 12:6655329-6655351 ACATTTGGGGCCGGGTGCGGTGG - Intronic
1092362002 12:7844821-7844843 CGATTTACAGCCCGGTGCGGTGG - Intronic
1093432995 12:19105115-19105137 ACATTTCCAGCCGGGAGCAGTGG - Intergenic
1093444957 12:19246335-19246357 ACATTTAAGGCTGGGTGCGGTGG + Intronic
1093519619 12:20033133-20033155 GCATAGACGGCCGGGTGTGGTGG + Intergenic
1093688514 12:22083711-22083733 GTATTCCCAGCCTGGTGCGGTGG + Intronic
1093863028 12:24191090-24191112 GAATTTAAAGCCAGGTGCGGTGG - Intergenic
1094199889 12:27784425-27784447 GCATACACAGCTGGGCGCGGTGG - Intronic
1094605503 12:31945577-31945599 GAAGGTACAGCCAGGTGCGGTGG - Intergenic
1094675797 12:32619339-32619361 CTGTTTCCAGCCGGGTGCGGTGG + Intronic
1094801322 12:34039090-34039112 GTATTTAGGGCCGGGCGCGGTGG + Intergenic
1095203746 12:39415542-39415564 GCATTCTCGGCCGGGCGCGGCGG - Intronic
1095303888 12:40618248-40618270 GAGTTCACAGCCGGGAGCGGTGG - Intergenic
1095565542 12:43619182-43619204 GTATTTAGGGCCGGGTGTGGTGG - Intergenic
1095643703 12:44516798-44516820 GCACTTACTGCTGGGTGCAGAGG - Intronic
1095960452 12:47831256-47831278 GATTTTAGGGCCGGGTGCGGTGG - Intronic
1096143148 12:49259044-49259066 TCATTTTTGGCCGGGTGCGGTGG - Intronic
1096279130 12:50236584-50236606 TCTTTTCCGGCCGGGTGCGGTGG - Intronic
1096426323 12:51506719-51506741 ACAGTTACGGCCGGGTGCAGTGG - Intronic
1096698950 12:53369648-53369670 TCATTTAAGGCCGGGCGCGGTGG + Intergenic
1096969771 12:55656291-55656313 GCACTAACGGCCGGGCGCGGCGG - Intergenic
1097064243 12:56309116-56309138 GAATTTTCTGCCAGGTGCGGTGG + Intronic
1097172497 12:57125100-57125122 GCATTCTCAGCAGGGTGAGGTGG + Intronic
1097390316 12:59003898-59003920 ACATTTTTAGCCGGGTGCTGTGG - Intergenic
1097714881 12:62955357-62955379 TCATTTATGGCAGGGTGCGGTGG - Intergenic
1097933182 12:65213510-65213532 TTATTTAAGGCCGGGTGCGGTGG - Intronic
1098062436 12:66577660-66577682 ACATTTTCAGCTGGGTGCAGTGG + Intronic
1098274119 12:68796532-68796554 GCACATACAGCCGGGCGCGGTGG - Intergenic
1098278806 12:68841386-68841408 ATTTTTACAGCCGGGTGTGGTGG - Exonic
1099157469 12:79196451-79196473 AAATGTACAGCCGGGTGCGATGG - Intronic
1099455637 12:82859351-82859373 GAAATCACAACCGGGTGCGGTGG - Intronic
1099515540 12:83592547-83592569 GCATTTAAAGCAGGGTGAAGAGG + Intergenic
1099542474 12:83929934-83929956 ATATTTCCAGCCGGGCGCGGTGG + Intergenic
1099963058 12:89415354-89415376 ACAATAATAGCCGGGTGCGGTGG + Intergenic
1100072428 12:90736856-90736878 GCCTTTGCGGCCGGGCGCGGTGG + Intergenic
1100187546 12:92153973-92153995 GAAGTCACAGCCGGGCGCGGTGG + Intergenic
1100264643 12:92963733-92963755 GCATTTCCGACCGGGTGCGGTGG - Intergenic
1100403683 12:94253964-94253986 GAAATTACAGCCAGGTGCGGGGG - Intronic
1100851882 12:98720676-98720698 AAGTTTCCAGCCGGGTGCGGTGG + Intronic
1101011638 12:100456945-100456967 GATTTGACAGCCGGGCGCGGTGG + Intergenic
1101043239 12:100778204-100778226 GCATTATCGGCCGGGTGCAGTGG - Intronic
1101153218 12:101903774-101903796 ACATCTACAGCCAGGTGTGGTGG + Intronic
1101346035 12:103886972-103886994 ACATTTGCAGCCGGGCGAGGTGG + Intergenic
1101601496 12:106213978-106214000 TCACTCTCAGCCGGGTGCGGTGG + Intergenic
1101655758 12:106718821-106718843 GCACTTCCAGCCGGGCGTGGTGG + Intronic
1101661575 12:106770511-106770533 GCAGTCTCAGCCGGGTGCGGTGG - Intronic
1101697577 12:107140915-107140937 GCATTCAGGGCCGGGTGCGGTGG + Intergenic
1101782837 12:107850682-107850704 CCTTTTCCGGCCGGGTGCGGTGG - Intergenic
1102336887 12:112088905-112088927 GCACTTTCAGCCGGGCGCAGTGG - Intronic
1102630399 12:114273837-114273859 ACATGTTCAGCCGGGCGCGGTGG + Intergenic
1102882416 12:116495912-116495934 GTATTTCCAGCCGGGCACGGTGG + Intergenic
1103116673 12:118339819-118339841 GCAACTAAAGCCGGGCGCGGTGG - Intronic
1103123754 12:118403043-118403065 TCGTTTTCAGCAGGGTGCGGTGG - Intronic
1103163117 12:118747383-118747405 GGATTTAAGGCCAGGTGCGGTGG + Intergenic
1103163401 12:118749833-118749855 GCATCAACAGCGGGGTGGGGAGG + Intergenic
1103225906 12:119287682-119287704 GCAATTACAGCAGGGCACGGTGG + Intergenic
1103268934 12:119655923-119655945 CAATTTACAGCCAGGTGCCGTGG - Intergenic
1103323832 12:120107272-120107294 TCAGGTTCAGCCGGGTGCGGTGG - Intronic
1103385263 12:120527366-120527388 TTATTTACAGCCAGGTGCGATGG - Intronic
1103585831 12:121955013-121955035 ACATTTACAGCTGGGAGCGGTGG + Intronic
1103594424 12:122015434-122015456 ACAGTTACAGCCAGGCGCGGTGG + Intergenic
1103606647 12:122091408-122091430 ACCTTTACGGCCGGGTGCAGTGG + Intronic
1103633918 12:122286709-122286731 ATTTTTAAAGCCGGGTGCGGTGG + Intronic
1103673910 12:122640872-122640894 GCAGTTCAGGCCGGGTGCGGAGG - Intergenic
1103793374 12:123487084-123487106 AGGTTTTCAGCCGGGTGCGGTGG - Intronic
1103828213 12:123757151-123757173 GTATTTTGGGCCGGGTGCGGTGG + Intronic
1103930441 12:124447969-124447991 GCTAATACAGCCGGGTGCAGTGG - Intronic
1104008150 12:124909794-124909816 GGATTTCAGGCCGGGTGCGGTGG - Intergenic
1104080714 12:125428279-125428301 TCATTTACAGCTGGGTGCAGTGG - Intronic
1105010351 12:132751828-132751850 GCATTCCCAGCCGGGTACAGTGG - Intronic
1105312322 13:19223350-19223372 ACATTTACGGCTGGGTGTGGTGG + Intergenic
1105324944 13:19362143-19362165 GCATTTTGGGCTGGGTGCGGTGG - Intergenic
1105363914 13:19746820-19746842 ACATTTACGGCTGGGTGTGGTGG + Intronic
1105473039 13:20708710-20708732 CCAGTGACGGCCGGGTGCGGTGG + Intronic
1105492310 13:20900897-20900919 GAAATTACAGCCGGGTGCGGTGG - Intronic
1105559277 13:21475138-21475160 GCAGAAACAGCCGGGCGCGGTGG - Intergenic
1105591217 13:21794669-21794691 TCATTTAAGGCCGGGCGCGGTGG - Intergenic
1105675256 13:22664457-22664479 GCATTTGAAGCCGGGCGCGGTGG - Intergenic
1105877055 13:24565718-24565740 AAATTTTCAGCCGGGTGAGGTGG - Intergenic
1105971785 13:25435404-25435426 AGATTTCCAGCCGGGCGCGGTGG - Intronic
1105978792 13:25497663-25497685 GGATTTTCAGCCGGGCACGGTGG + Intronic
1106014035 13:25851292-25851314 GCATTGTCAGCCGGATGCCGTGG + Intronic
1106047632 13:26159335-26159357 AAATTTATTGCCGGGTGCGGTGG + Intronic
1106188612 13:27430030-27430052 ACATTTTCAGCCAGGTGCGGTGG + Intronic
1106219498 13:27733917-27733939 GAATTTGCTGCCGGGTGCAGTGG + Intergenic
1106262985 13:28084686-28084708 AAATTTACAGCCGGGCGCAGTGG + Intronic
1106323717 13:28667237-28667259 ACATTTACTGCTGGGTGTGGTGG + Intronic
1106476127 13:30099594-30099616 CCATTAATAGCCGGGCGCGGTGG - Intergenic
1106864787 13:33951517-33951539 TTATTTACAGCTGGGTGTGGTGG - Intronic
1107014620 13:35698007-35698029 GCATTTAAAGCTGGGTGCGGTGG + Intergenic
1107308200 13:39046040-39046062 CCATTTCCTGCCGGGTGCGGTGG + Intronic
1107465020 13:40641695-40641717 CCACTGACAGCTGGGTGCGGTGG + Intronic
1107497580 13:40942807-40942829 ACATTTTCAGTCAGGTGCGGTGG - Intronic
1107682221 13:42864117-42864139 GCAGTATCAGCCGGGCGCGGTGG + Intergenic
1107928313 13:45285694-45285716 GCAATTTAAGCCAGGTGCGGTGG - Intergenic
1107946227 13:45419604-45419626 GAGTTCACAGCCGGGTGCCGTGG - Intergenic
1108367366 13:49729495-49729517 ACATTTATGGCCGAGTGCGGTGG + Intronic
1108368800 13:49746325-49746347 GTATTCACAGCTGGGTGTGGTGG + Intronic
1108643350 13:52403763-52403785 CCTTTTCCAGCCGGGTGCGGTGG - Intronic
1108676167 13:52739433-52739455 GCATCCACAGGCGGGTGCGGAGG - Intronic
1108911356 13:55555808-55555830 GTATTTCTGGCCGGGTGCGGTGG - Intergenic
1109004592 13:56856228-56856250 GAATCACCAGCCGGGTGCGGTGG + Intergenic
1109088611 13:58009699-58009721 ACATTTATGGCCGGGCGCGGTGG - Intergenic
1109486426 13:63027451-63027473 GCTTTAACAGCCAGGCGCGGTGG - Intergenic
1109519915 13:63496477-63496499 AAATTTTCAGCCGGGCGCGGTGG + Intergenic
1109539181 13:63750361-63750383 TCATTGGCAGCCGGGCGCGGTGG + Intergenic
1109544663 13:63829473-63829495 TCATTGGCAGCCGGGCGCGGTGG - Intergenic
1109805474 13:67434966-67434988 TCATTTACGGCCAGGTGCGGTGG - Intergenic
1110018916 13:70443753-70443775 GCATTAACATCCTGGTGTGGAGG + Intergenic
1110196263 13:72791919-72791941 TTATTTTCAGCTGGGTGCGGTGG - Intronic
1110510455 13:76344142-76344164 GAATTTTCGGCCGGGTGCAGTGG + Intergenic
1110814757 13:79848963-79848985 GAATTAAGGGCCGGGTGCGGTGG - Intergenic
1111265564 13:85807853-85807875 GGCTGCACAGCCGGGTGCGGTGG + Intergenic
1111444239 13:88324406-88324428 GTATTCTCAGCTGGGTGCGGTGG - Intergenic
1111453617 13:88451606-88451628 GCATTTAAGGCCGGGTGCAGTGG + Intergenic
1111575444 13:90147883-90147905 ATATTTTCAGCCAGGTGCGGTGG + Intergenic
1111666340 13:91273405-91273427 GCATTTAAGGCCGGGCACGGTGG + Intergenic
1111741093 13:92206471-92206493 GGCATGACAGCCGGGTGCGGTGG - Intronic
1111770990 13:92595479-92595501 GTATTTACGGCCGGGCGCGGTGG + Intronic
1111884623 13:94004767-94004789 GAATAGACAGCTGGGTGCGGTGG + Intronic
1111984534 13:95052266-95052288 GCATTTAAGGCTGGGTGCAGCGG - Intronic
1112457676 13:99576900-99576922 GCTTTTTCAGCTGGGCGCGGTGG - Intergenic
1112892840 13:104260036-104260058 CCTTTTACGGCCGGGCGCGGTGG + Intergenic
1113316466 13:109185055-109185077 GTAGTCACAGCCAGGTGCGGTGG - Intronic
1113729860 13:112633518-112633540 ATATTTAAGGCCGGGTGCGGTGG - Intergenic
1113749925 13:112769865-112769887 CCATTTACAGCCGCGTGGGATGG - Intronic
1113834200 13:113318168-113318190 GCTTTTACACCGGGGTGCGGGGG + Intronic
1114007390 14:18329979-18330001 ACATTTGCAGCCAGGCGCGGTGG - Intergenic
1114286653 14:21250972-21250994 CCATTTCCGGCCGGGCGCGGTGG + Intronic
1114298788 14:21355205-21355227 CAATTTTCAGCCGGGTGCGGTGG + Intronic
1114572946 14:23687463-23687485 GCATTTAAAGCAGTGTGCAGAGG - Intergenic
1115221397 14:31061929-31061951 GATTTTACAGCCAGGTGTGGTGG - Intronic
1115254784 14:31387845-31387867 GCACTTCAGGCCGGGTGCGGTGG - Intronic
1115383310 14:32765218-32765240 TCACTTGAAGCCGGGTGCGGTGG - Intronic
1115557028 14:34552063-34552085 GCACTTGTGGCCGGGTGCGGTGG + Intergenic
1115606361 14:35006124-35006146 ACATTTAGGGCCGGGCGCGGTGG - Intronic
1115705542 14:35994411-35994433 GAAGTTAAAGCCAGGTGCGGTGG - Intergenic
1116015713 14:39404611-39404633 CCATTTAAAGCCGGGCACGGTGG - Intronic
1116815880 14:49583261-49583283 GGATTTCTTGCCGGGTGCGGTGG + Intronic
1116821401 14:49631336-49631358 AGATTTGCAGCCGGGCGCGGTGG + Intronic
1116977151 14:51129145-51129167 GCAGATCCAGCCGGGCGCGGTGG - Intergenic
1117201339 14:53393189-53393211 ACATTTCCGGCCGGGCGCGGTGG + Intergenic
1117322080 14:54634008-54634030 GTATATTCAGCTGGGTGCGGTGG + Intronic
1117769011 14:59113330-59113352 GCCTTCACGGCCGGGCGCGGTGG - Intergenic
1118181127 14:63494520-63494542 GGCTGTACAGCCGGGCGCGGTGG - Intronic
1118189669 14:63568997-63569019 GTTTTTACGGCCGGGTGCAGTGG - Intergenic
1118304179 14:64640735-64640757 GCTTTTACAGCTGGGTGCAGTGG - Intergenic
1118374509 14:65165099-65165121 GAAATTCCAGCCAGGTGCGGTGG + Intergenic
1118535326 14:66757675-66757697 GCAATTGCAGCCAGGTGTGGTGG - Intronic
1118868513 14:69722193-69722215 GTATTTTCAGCCAGGTGCGGTGG + Intergenic
1118916411 14:70110965-70110987 GTATCTGCAGCCGGGCGCGGTGG - Intronic
1118958752 14:70507987-70508009 CCAGTTTCAGCCGGGTGTGGTGG - Intergenic
1118999434 14:70868755-70868777 GCATTTTTGGCCAGGTGCGGTGG + Intergenic
1119349760 14:73954554-73954576 GGATTTGGGGCCGGGTGCGGTGG + Intronic
1119357197 14:74017595-74017617 AATTTTACAGCCGGGGGCGGTGG + Intronic
1119734159 14:76970630-76970652 GCATTTTAGGCAGGGTGCGGTGG - Intergenic
1119745067 14:77038238-77038260 GCATTTTCCGGCGGGTGGGGGGG + Intergenic
1119838961 14:77776571-77776593 ACACTCACAGCCGGGTGCAGGGG + Intergenic
1119857186 14:77909420-77909442 GCATTCACAGCCAGGCGCGGTGG - Intronic
1120047073 14:79819768-79819790 ACTTTTAGGGCCGGGTGCGGTGG - Intronic
1120196980 14:81495349-81495371 CCATTTGCGGCCAGGTGCGGTGG + Intronic
1120304151 14:82746681-82746703 GCATTATCGGGCGGGTGCGGTGG + Intergenic
1120597558 14:86460280-86460302 ACATATACAGCTGGGTGCGGTGG + Intergenic
1120816180 14:88861089-88861111 GAATTTTTAGCCGGGTGTGGTGG - Intronic
1120828675 14:88978526-88978548 GGATTTACGGCCGGGCGCGGTGG + Intergenic
1121140318 14:91536160-91536182 GCATTTGGGGCCGGGCGCGGTGG + Intergenic
1121193771 14:92052205-92052227 GCATCTCTCGCCGGGTGCGGTGG + Exonic
1121344872 14:93128249-93128271 TGATTTCCAGCCAGGTGCGGTGG + Intergenic
1121361535 14:93265632-93265654 GAATTTGGGGCCGGGTGCGGCGG + Intronic
1121427950 14:93866181-93866203 ACATTCCCAGCCGGGTGCGGTGG + Intergenic
1121634411 14:95443948-95443970 GCATTTTAGGCCGGGAGCGGTGG - Intronic
1122655223 14:103254266-103254288 GCACTCCCGGCCGGGTGCGGTGG + Intergenic
1122698431 14:103570142-103570164 ACATTTCTAGCCAGGTGCGGTGG - Intronic
1122984082 14:105204185-105204207 GCATCCCCAGCCAGGTGCGGTGG + Intergenic
1123508810 15:20973737-20973759 GCATTTGGGGCCGGGTGCAGTGG - Intergenic
1123566034 15:21547486-21547508 GCATTTGGGGCCGGGTGCAGTGG - Intergenic
1123602291 15:21984773-21984795 GCATTTGGGGCCGGGTGCAGTGG - Intergenic
1123668070 15:22625418-22625440 GCATTTAAGGCCGGATGCAGTGG + Intergenic
1123679380 15:22747812-22747834 ACATATACGGCCGGGCGCGGTGG + Intergenic
1123766244 15:23481251-23481273 TCTTTTTCAGCCGGGCGCGGTGG - Intergenic
1123815227 15:23971355-23971377 ACATTTTAGGCCGGGTGCGGTGG + Intergenic
1123822248 15:24042611-24042633 GCCTTTAAGGCCAGGTGCGGTGG - Intergenic
1123857970 15:24433847-24433869 GCAGTTTCAGCCAGGTGCAGAGG - Intergenic
1124358121 15:29013566-29013588 TCATTTTCGGCCGGGGGCGGTGG - Intronic
1124422172 15:29531951-29531973 GCCTTTCAAGCTGGGTGCGGTGG - Intronic
1124433275 15:29625680-29625702 GCATGTACAACCAGGTGTGGAGG - Intergenic
1124501262 15:30228377-30228399 CAATTTTCAGCCGGGCGCGGTGG + Intergenic
1124524045 15:30431855-30431877 GCATTTAAGGCCGGGTGCAGTGG + Intergenic
1124533666 15:30526020-30526042 GCAGTTCCAGCCAGGTCCGGAGG - Intergenic
1124534621 15:30534361-30534383 GCATTTAAGGCCGGGTGCAGTGG - Intergenic
1124574264 15:30894214-30894236 GCATTTAACGCCGGGTGCAGTGG - Intergenic
1124742306 15:32310290-32310312 CAATTTTCAGCCGGGTGCGGTGG - Intergenic
1124764028 15:32473238-32473260 GCATTTAAGGCCGGGTGCAGTGG + Intergenic
1124764989 15:32481625-32481647 GCAGTTCCAGCCAGGTCCGGAGG + Intergenic
1124774600 15:32575810-32575832 GCATTTAAGGCCGGGTGCAGTGG - Intergenic
1125092159 15:35806424-35806446 TTATTTACGGCCGGATGCGGTGG - Intergenic
1125457443 15:39874754-39874776 GCAATTCCAGCTGGGTGCGGTGG + Intronic
1125575999 15:40755724-40755746 AGATTTATGGCCGGGTGCGGCGG - Exonic
1125587919 15:40834560-40834582 GCATAGAGGGCCGGGTGCGGTGG - Intergenic
1125634337 15:41174614-41174636 GAATTTGGAGCCGGGTGCAGTGG + Intergenic
1125706827 15:41745166-41745188 ACATTTACAGCCAGGCGCTGTGG - Intronic
1125712455 15:41797961-41797983 ACAGGTTCAGCCGGGTGCGGTGG + Intronic
1126049430 15:44673045-44673067 TTATTTAAAGCCGGGTGCTGTGG - Intronic
1126399902 15:48258072-48258094 ACCTTTACGGCCGGGCGCGGTGG + Intronic
1126619516 15:50623124-50623146 GCATTTTTGGCCGGGTGCAGTGG + Intronic
1126727095 15:51643109-51643131 GCCATTATAGCCGGGTGCGGTGG + Intergenic
1126932789 15:53673700-53673722 GCATATAGGGCCGGGTGCAGTGG + Intronic
1127089834 15:55456367-55456389 GCATTTTCCGCCGGATGCAGTGG - Intronic
1127108906 15:55646607-55646629 GGAGTGACAGCCGGGTGCAGTGG - Intronic
1127210602 15:56770914-56770936 AAAGTTACAGCCGGGGGCGGTGG + Intronic
1127622007 15:60743300-60743322 GCATTTACAGCCGGGTGCGGTGG - Intronic
1127652747 15:61024877-61024899 AAATTTCCAGCTGGGTGCGGTGG - Intronic
1127729274 15:61783670-61783692 ACTTTTACGGCCGGGCGCGGTGG + Intergenic
1127753874 15:62071273-62071295 TCATTTTGTGCCGGGTGCGGTGG + Intergenic
1127778718 15:62292043-62292065 ACATTTAAAGCAGGGTGTGGAGG - Intergenic
1127895719 15:63296927-63296949 ACATTTACAGCCGGGCGGGGTGG - Intronic
1128015930 15:64346743-64346765 TCATTTCCAGCCAGGTGTGGTGG - Intronic
1128018084 15:64365287-64365309 CAATTTTTAGCCGGGTGCGGTGG - Exonic
1128100216 15:64992444-64992466 GCATTCACAGCTGGGCGCAGTGG - Intergenic
1128186598 15:65647971-65647993 GCCTTCAGGGCCGGGTGCGGTGG + Intronic
1128267797 15:66281764-66281786 ACTTTCACAGCTGGGTGCGGTGG - Intergenic
1128269902 15:66299766-66299788 TCATACACAGCCGGGCGCGGTGG + Intronic
1128839635 15:70839733-70839755 GCAATTAAAGCCGGGCGTGGTGG - Intronic
1128965009 15:72050319-72050341 ACATTACCAGCCGGGTGCGGTGG + Intronic
1129015690 15:72466653-72466675 GCATATGCAGCCGGGGGCGGTGG + Intergenic
1129119128 15:73384612-73384634 TTTTTTACAGCCGGGCGCGGTGG - Intergenic
1129349040 15:74943600-74943622 GCTTTTCTAGCCTGGTGCGGTGG - Intergenic
1129383318 15:75181545-75181567 TCATTTAAGGCTGGGTGCGGTGG + Intergenic
1129422416 15:75439630-75439652 GCATTGATGGCCGGGTGCGGTGG - Intronic
1129622593 15:77162204-77162226 GAATTTAAGGCTGGGTGCGGTGG + Intronic
1129994841 15:79995769-79995791 GCATCCCCAGCCGGGTGTGGTGG + Intergenic
1130165629 15:81454808-81454830 ATATTAACAGCTGGGTGCGGTGG - Intergenic
1130512683 15:84602236-84602258 GAACTCACAGCCGGGCGCGGTGG - Intronic
1130540086 15:84816281-84816303 GCACTTCCGGCCGGGCGCGGTGG + Intergenic
1131189005 15:90299337-90299359 ACACTTGCAGCCGGGCGCGGTGG - Intronic
1131415911 15:92257694-92257716 ACATTTACAGCCAGGCGCAGTGG + Intergenic
1131762521 15:95639766-95639788 CCATTTACAGCCCTGTGTGGTGG - Intergenic
1131991915 15:98101269-98101291 GCATTTCTGGCCGGGCGCGGTGG + Intergenic
1132101014 15:99023608-99023630 GAATTTAAGGCCAGGTGCGGTGG - Intergenic
1202974397 15_KI270727v1_random:274579-274601 GCATTTGGGGCCGGGTGCAGTGG - Intergenic
1132460076 16:48522-48544 GCATTAAGGGCCGGGCGCGGTGG + Intronic
1132926461 16:2432115-2432137 GTACTTTCAGCCGGGTGCAGTGG - Intronic
1132944019 16:2522393-2522415 GCTTTTTCGGCCGGGCGCGGTGG + Intronic
1133086980 16:3372623-3372645 GCATTCAAGGCCAGGTGCGGTGG - Exonic
1133218045 16:4305375-4305397 CCTTTAGCAGCCGGGTGCGGTGG - Intergenic
1133866688 16:9650806-9650828 GGTTCGACAGCCGGGTGCGGTGG + Intergenic
1133899575 16:9960911-9960933 AAAATTACAGCTGGGTGCGGTGG - Intronic
1134163085 16:11908333-11908355 ACAGAAACAGCCGGGTGCGGTGG + Intronic
1134449005 16:14352187-14352209 GAGTTTTCGGCCGGGTGCGGTGG + Intergenic
1134459362 16:14418274-14418296 GAAGTTCCAGCCAGGTGCGGTGG + Intergenic
1134486651 16:14663952-14663974 TTAATTACGGCCGGGTGCGGTGG + Intronic
1134490511 16:14692581-14692603 GCATTTGGGGCCGGGCGCGGTGG + Intronic
1134495892 16:14731698-14731720 GCATTTGGGGCCGGGCGCGGTGG + Intronic
1134623728 16:15709233-15709255 GCTTTTAATGCCAGGTGCGGTGG - Intronic
1134675571 16:16087744-16087766 GCAGAAACAGCCGGGTGTGGTGG - Intronic
1135048762 16:19175364-19175386 TAATTCACAGCCGGGTGCCGTGG + Intronic
1135357850 16:21784800-21784822 GGATTTTCAGCCAGGTGCAGTGG - Intergenic
1135456354 16:22600918-22600940 GGATTTTCAGCCAGGTGCAGTGG - Intergenic
1135594208 16:23729033-23729055 ATATTTTCGGCCGGGTGCGGTGG - Intergenic
1135695280 16:24580965-24580987 CCACTAGCAGCCGGGTGCGGTGG + Intergenic
1135756595 16:25103933-25103955 ACTGATACAGCCGGGTGCGGTGG + Intergenic
1135900029 16:26449346-26449368 GTATTTCTGGCCGGGTGCGGTGG + Intergenic
1136039733 16:27568748-27568770 TTATTTCCGGCCGGGTGCGGTGG - Intronic
1136477683 16:30523845-30523867 GCACTTCCAGCCAGGTGCGGTGG + Intergenic
1136587570 16:31197360-31197382 GCATTTCAGGCCAGGTGCGGTGG + Intergenic
1136592517 16:31225934-31225956 GCATTTTCAGCCAGGTGCAGTGG - Intronic
1137230479 16:46561316-46561338 GAATTTATGGCCGAGTGCGGTGG + Intergenic
1137302750 16:47168673-47168695 ACATTTTCAGCCAGGTGCAGTGG - Intronic
1137469864 16:48744598-48744620 GCTTGTACAGCCTGGTGAGGTGG - Intergenic
1137630497 16:49940289-49940311 GCTATTACAGCTGGGTGCGGTGG + Intergenic
1137774305 16:51042699-51042721 GAATTCCCAGCCGGGTGCAGTGG + Intergenic
1138014450 16:53416028-53416050 GCATTTAAGGCTGGGTGCAGTGG + Intergenic
1138468312 16:57210413-57210435 GCATTTAAGGCTGGGCGCGGTGG + Intronic
1138648079 16:58439626-58439648 TCATTTACAGCCAGGCACGGTGG - Intergenic
1138686057 16:58726773-58726795 AAATTCACAGCCGGGTGCAGTGG - Intronic
1138701622 16:58869328-58869350 GCACATTCTGCCGGGTGCGGTGG + Intergenic
1139126051 16:64079179-64079201 GAAATTATAGCCGGGTGCAGTGG + Intergenic
1139381020 16:66531008-66531030 ACATTTTCAGCTGGGTGTGGTGG - Intronic
1139487402 16:67265708-67265730 GGCTTTGCAGCCAGGTGCGGTGG - Intronic
1139553359 16:67689381-67689403 ACATTTACAGCTGGGCGTGGTGG + Intronic
1140214435 16:72995978-72996000 TCTTTTACTGCCAGGTGCGGTGG + Intronic
1140291928 16:73667275-73667297 GCATATCCAGCTGGGTGTGGTGG - Intergenic
1140426186 16:74863705-74863727 GCAGCCACAGCCGGGCGCGGTGG - Intergenic
1140435147 16:74940989-74941011 GCATTTTCGGCTGGGCGCGGTGG - Intronic
1140446372 16:75031787-75031809 GTATATATAGCCGGGTGTGGTGG - Intronic
1140493429 16:75361327-75361349 AAATTTAAAGCCGGGCGCGGTGG + Intronic
1140530812 16:75664336-75664358 GTATCTTCAGCCGGGTGCAGTGG + Intronic
1140603126 16:76501781-76501803 GAATTTACGGCCGGGCGCGGTGG + Intronic
1141382844 16:83591194-83591216 GCTTGTCCAGCTGGGTGCGGTGG - Intronic
1141513710 16:84529003-84529025 GAAATGACAGCCAGGTGCGGTGG - Intronic
1142250207 16:88988505-88988527 GGACTTACAGCCGGGTGCGGTGG - Intergenic
1142576224 17:909823-909845 TCATTTCCGGCCGGGCGCGGTGG - Exonic
1142586382 17:977051-977073 GGAATTATTGCCGGGTGCGGTGG - Intronic
1142594186 17:1021516-1021538 GCTTCTTCAGCCAGGTGCGGTGG + Intronic
1142788875 17:2247498-2247520 ACTTGTACAGCCGGGTGCAGTGG + Intronic
1142798965 17:2332547-2332569 CCATACACGGCCGGGTGCGGTGG + Intronic
1142826420 17:2514626-2514648 GTATATCCAGCTGGGTGCGGTGG - Intergenic
1142871933 17:2826718-2826740 GGATTTCCGGCCGGGCGCGGTGG + Intronic
1142902967 17:3025087-3025109 ACATTGACGGCCAGGTGCGGTGG + Intronic
1142951652 17:3486219-3486241 AGGTTCACAGCCGGGTGCGGTGG - Intronic
1143024118 17:3930858-3930880 CCATTTACAGCTGGGCGTGGTGG + Intronic
1143081489 17:4384783-4384805 GGATTTAAGGCCGGGTGCGCTGG + Intergenic
1143143761 17:4759615-4759637 GGCTATTCAGCCGGGTGCGGTGG - Intergenic
1143170292 17:4925544-4925566 GAATTTGTAGCCGGGTGCGGTGG - Intergenic
1143250540 17:5520141-5520163 TGATTTACAGCCAGGCGCGGTGG - Intronic
1143456325 17:7070205-7070227 GCATTGTCGGCCGGGCGCGGTGG + Intergenic
1143560798 17:7693429-7693451 GCACTTAAGGCCGGGTGCGGTGG + Intronic
1143683619 17:8495994-8496016 GAACTTCCAGCCGGGTGTGGTGG - Intronic
1143715445 17:8764889-8764911 ACATTTTCAGCCGGGTGCAGTGG + Intergenic
1143753462 17:9048941-9048963 GCATTTTCCGCCGGGCGCGGTGG - Intronic
1143810942 17:9471436-9471458 GCAGTTAGGGCCGGGCGCGGTGG - Intronic
1143909902 17:10239339-10239361 GGATTTACAGCTGGGTGCAGTGG + Intergenic
1143963060 17:10736462-10736484 GAATTTCCAGCCAAGTGCGGTGG - Intergenic
1144171226 17:12661805-12661827 ACATTCTCAGCCAGGTGCGGTGG + Intergenic
1144361920 17:14503779-14503801 TCATTTACGGCCGGGCACGGTGG + Intergenic
1144477358 17:15599927-15599949 GTACTTACAGCCGGGCACGGTGG + Intronic
1144482306 17:15638283-15638305 GTGTAGACAGCCGGGTGCGGTGG + Intronic
1144502757 17:15803749-15803771 GCATTTTAAACCGGGCGCGGTGG + Intergenic
1144547615 17:16212782-16212804 GCTTTTAAGGCCGGGTGCAGTGG + Intronic
1144594882 17:16560633-16560655 GCCCTTTCAGCCGGGTACGGTGG - Intronic
1144855839 17:18267374-18267396 ACATTTCTGGCCGGGTGCGGTGG - Intergenic
1145088716 17:19967911-19967933 CTACTTACGGCCGGGTGCGGTGG + Intronic
1145164938 17:20606408-20606430 GCATTTTAAGCCGGGAGCGGTGG + Intergenic
1145892713 17:28428792-28428814 GTATTTAAGGCCGGGTGTGGTGG + Intergenic
1146025380 17:29316099-29316121 GCTATAAGAGCCGGGTGCGGTGG + Intergenic
1146070760 17:29679001-29679023 GCATTTTAGGCCGGGTGCAGTGG - Intronic
1146113397 17:30112199-30112221 GAAATTAAGGCCGGGTGCGGTGG + Intergenic
1146204582 17:30891658-30891680 GTAATTTCAGCCGGGTGCAGTGG - Intronic
1146217447 17:30989045-30989067 ACATTTACAGCCAGGTGCAGTGG - Intronic
1146424921 17:32728491-32728513 TAATTTGCAGCCGGGCGCGGTGG - Intronic
1146773472 17:35590203-35590225 GAAGTTACAGCCGGTCGCGGTGG - Intronic
1146971746 17:37078524-37078546 TTATTTTCAGCTGGGTGCGGTGG + Intergenic
1146993522 17:37297152-37297174 ACATTTAAGGCCGGGCGCGGTGG + Intronic
1147004876 17:37394587-37394609 GCATTCTCGGCCGGGCGCGGTGG + Intronic
1147005426 17:37399266-37399288 GAATTTAGGGCCTGGTGCGGTGG - Intronic
1147061116 17:37879309-37879331 CTATTGACAGCCGGGTGCGGTGG + Intergenic
1147089762 17:38088303-38088325 GCATACACGGCCGGGCGCGGCGG - Intergenic
1147182249 17:38693726-38693748 GCAATTCCAGCAGGGTGAGGAGG + Intergenic
1147225854 17:38976458-38976480 GCATTTAAGGCCGGGTGTGATGG + Intergenic
1147287348 17:39412820-39412842 AAATTTGCGGCCGGGTGCGGGGG - Intronic
1147642574 17:42013092-42013114 ACATTTAAGGCTGGGTGCGGTGG - Intronic
1147772085 17:42874740-42874762 ACAATTTCAGCCGGGTGCAGTGG + Intergenic
1147790129 17:43008940-43008962 GTATATAAAGCCGGGTGCTGTGG - Intronic
1147916434 17:43890097-43890119 GAAAATACGGCCGGGTGCGGTGG - Intronic
1147991287 17:44335134-44335156 GCATTTGTGGCCGGGCGCGGTGG + Intergenic
1148184147 17:45629345-45629367 ATATTTACAGCCGGGCGCAGTGG - Intergenic
1148223897 17:45884630-45884652 GCCTTTCCAGCTGGGTGTGGTGG - Intergenic
1148410400 17:47461744-47461766 CCATTGACGGCCAGGTGCGGTGG + Intergenic
1148421111 17:47547737-47547759 TAATTTACGGCCGGGCGCGGTGG + Intronic
1148582015 17:48750707-48750729 TCATTTATGGCCTGGTGCGGTGG + Intergenic
1148603955 17:48914735-48914757 AAAATTTCAGCCGGGTGCGGTGG + Intronic
1148659131 17:49313683-49313705 GCATTTGGAGCCAGGTGCAGTGG + Intronic
1148708883 17:49661724-49661746 ATATTTAAGGCCGGGTGCGGTGG + Intronic
1148926013 17:51086265-51086287 GGATTTTCAGCCGGGTGTGGTGG - Intronic
1149162712 17:53713770-53713792 AAACTTACAGCCGGGCGCGGTGG - Intergenic
1149281469 17:55109924-55109946 ACATTGACAGCTGGGTGCAGTGG - Intronic
1149407482 17:56368565-56368587 CCATTTTCAGCCGGGCGCGGTGG - Intronic
1149692866 17:58592619-58592641 GCTTGAACAGCTGGGTGCGGTGG - Intronic
1149818214 17:59747907-59747929 GCCTTTCCAGCCAGGCGCGGTGG + Intronic
1149836205 17:59915274-59915296 ACATTTTTTGCCGGGTGCGGTGG - Intronic
1150035333 17:61790255-61790277 TCATCTAGAGCCAGGTGCGGTGG + Intronic
1150044224 17:61895952-61895974 ACATTTACAGCCAGGTGCAGTGG + Intronic
1150149365 17:62796699-62796721 CAATGTGCAGCCGGGTGCGGTGG + Intronic
1150152212 17:62819403-62819425 GGATATGCGGCCGGGTGCGGTGG - Intergenic
1150421255 17:65038115-65038137 ACATTTATGGCCGGGTGCAGTGG + Intronic
1150751843 17:67871056-67871078 GCATTTTCGGCCGGGCGCGGTGG - Intronic
1150929693 17:69571355-69571377 GCATTCACAGCCAGGTGCGGTGG - Intergenic
1151595382 17:75075233-75075255 ACACACACAGCCGGGTGCGGTGG + Intergenic
1151596285 17:75079752-75079774 ACATTTCCGGCCGGGTGCGGTGG - Intergenic
1151601986 17:75111454-75111476 GCAATTTCAGGCGGGTGAGGTGG + Intronic
1151632859 17:75322830-75322852 GCATTCTCGGCCGGATGCGGTGG + Intronic
1151765030 17:76129041-76129063 ATATTTATGGCCGGGTGCGGTGG + Intergenic
1151794945 17:76337890-76337912 ACATTTACAGCTGGGCACGGTGG - Intronic
1152098104 17:78284505-78284527 CCAGATACAGCCAGGTGCGGTGG + Intergenic
1152118755 17:78405281-78405303 GCATTGCCAGCCGGGCGCAGTGG - Intronic
1152167655 17:78721039-78721061 GAATTTACAACTGGGTGTGGTGG + Intronic
1152316291 17:79582513-79582535 GCAATTCCAACCGGGTGCGGTGG + Intergenic
1152369779 17:79879389-79879411 GCTTTTCCAGCTGGGTGCGGTGG + Intergenic
1152594263 17:81230594-81230616 GCAGCCACGGCCGGGTGCGGAGG + Exonic
1152653239 17:81506362-81506384 GCTGTTGCAGCCGGGCGCGGTGG + Intergenic
1152675383 17:81637509-81637531 GCATTTCAGGCCGGGCGCGGTGG + Intronic
1152701209 17:81820682-81820704 AAAGTTAGAGCCGGGTGCGGTGG - Intergenic
1152731859 17:81976552-81976574 GCAATGACTGCCGGGTGCGGTGG + Intergenic
1152853498 17:82650399-82650421 GGCTGTACAGCCGGGGGCGGGGG + Intergenic
1153034622 18:749204-749226 GCATTTCTGGCCGGGCGCGGTGG + Intronic
1153094966 18:1390408-1390430 CCATTTGCGGCCGGGCGCGGTGG + Intergenic
1153426084 18:4965728-4965750 GAATTTAAAGCTGGGTGTGGTGG + Intergenic
1153631769 18:7077490-7077512 GCATAGACAGCCAGGTGCAGTGG - Intronic
1153773150 18:8431477-8431499 TCAATTACAGCCGGGCGCGGTGG + Intergenic
1153809646 18:8740768-8740790 GTTATTTCAGCCGGGTGCGGTGG - Intronic
1153901816 18:9623850-9623872 GAGTTAACAGCCGGGCGCGGTGG - Intergenic
1154207268 18:12347834-12347856 TCTGTAACAGCCGGGTGCGGTGG - Intronic
1154443231 18:14411626-14411648 TCAGTTGCAGCCGGGTGTGGTGG - Intergenic
1154928237 18:20961914-20961936 GCAATTAAAGCCAGGTGCTGTGG - Intronic
1154946347 18:21165737-21165759 GGATTCTCAGCCGGGTGGGGTGG + Intergenic
1154976621 18:21463430-21463452 TCAACTACTGCCGGGTGCGGTGG - Intronic
1155311297 18:24526561-24526583 GCATTTCAGGCCGGGTGTGGTGG - Intergenic
1155442145 18:25873565-25873587 TAATTTACGGCTGGGTGCGGTGG + Intergenic
1155512321 18:26590374-26590396 GCATTCACAGCCGGGCACGGTGG - Intronic
1155647535 18:28097393-28097415 GAACTCACAGCCGGGTGCAGTGG + Intronic
1155868974 18:31002411-31002433 AAAATTACAGCCGGGTGCAGTGG + Intronic
1155908767 18:31485102-31485124 ACATTTTCAGCCAGGGGCGGTGG + Intergenic
1155943194 18:31820545-31820567 CCATTTTCAGCCGGGCGCAGTGG + Intergenic
1155966662 18:32041915-32041937 GCATATACGGCCGGGCGCGGTGG - Intronic
1156067085 18:33156373-33156395 ACGTTTTCAGCAGGGTGCGGTGG - Intronic
1156142690 18:34135409-34135431 CTATTCACAGCGGGGTGCGGTGG + Intronic
1156748938 18:40426518-40426540 GCTTTTATGGCCGGATGCGGTGG - Intergenic
1157726661 18:49969667-49969689 GCCTTTAAGGCCGGGCGCGGTGG - Intronic
1157962722 18:52174762-52174784 AAATTTGCAGCCGGGCGCGGTGG + Intergenic
1158182543 18:54733333-54733355 TCATTTACAGCTGGGTATGGTGG - Intronic
1158240106 18:55368096-55368118 GTGTTTTCAGCCGGGCGCGGTGG + Intronic
1158492680 18:57924392-57924414 GTATTTGCAGCTGGGCGCGGTGG - Intergenic
1158528414 18:58235878-58235900 GTCTTTATAGCCGGGTGTGGTGG + Intronic
1158590020 18:58771466-58771488 GCAGTCCCAGCCGGGTGCGGTGG + Intergenic
1158895931 18:61912879-61912901 ACATTTACAGCAGGGCACGGTGG + Intergenic
1159200135 18:65173199-65173221 ACTTTTGCAGCTGGGTGCGGTGG + Intergenic
1159518708 18:69490977-69490999 GCATTTGCTGCCGGCAGCGGAGG + Intronic
1159551120 18:69896466-69896488 TCATTCACAACTGGGTGCGGTGG - Intronic
1160709803 19:545928-545950 GAAATTAAGGCCGGGTGCGGTGG - Intronic
1160801260 19:970758-970780 TCATTTACCGCCGGGTGTGGTGG - Intronic
1160881698 19:1323709-1323731 GCCTTTGCGGCCGGGCGCGGTGG + Intergenic
1160882340 19:1326852-1326874 GCAGATTCGGCCGGGTGCGGTGG + Intergenic
1160915564 19:1494969-1494991 GTGTTTGCAGCCGGGCGCGGTGG - Intronic
1160962301 19:1728219-1728241 ACATTTACGGCCAGGCGCGGTGG - Intergenic
1160998468 19:1896312-1896334 GCAATTACAGCCAGGCGCGGTGG - Intergenic
1161346914 19:3772742-3772764 CCATTCACAGCCGGGCGCAGTGG + Intergenic
1161387791 19:4005988-4006010 GTATTTCAGGCCGGGTGCGGTGG + Intergenic
1161437127 19:4270377-4270399 GGAATTCCAGCCGGGTGTGGTGG + Intergenic
1161621784 19:5301601-5301623 GCATTTACAGCCAGGTGTGGAGG - Intronic
1161787040 19:6333169-6333191 GCATTTGCAACCGGGAGCGATGG - Intronic
1161833129 19:6624512-6624534 TCATTTATGGCCGGGTGCAGTGG + Intergenic
1161862664 19:6809881-6809903 CCATTTCCAGCCAGGTGCAGTGG + Intronic
1161867210 19:6841936-6841958 GCACTTTCGGCCGGGCGCGGTGG + Intronic
1161889179 19:7021749-7021771 GAATTGTCGGCCGGGTGCGGTGG + Intergenic
1161889573 19:7024887-7024909 ACAATTAGGGCCGGGTGCGGTGG - Intergenic
1161891879 19:7045859-7045881 ACAATTAGGGCCGGGTGCGGTGG + Intergenic
1161892273 19:7049000-7049022 GAATTGTCGGCCGGGTGCGGTGG - Intergenic
1161922276 19:7275493-7275515 TCAGTTTCAGCCAGGTGCGGTGG + Intronic
1161987531 19:7664751-7664773 ACATTGTCAGCTGGGTGCGGTGG - Intergenic
1162017643 19:7853992-7854014 GCATTTATTGCCGGGCGCGATGG + Intronic
1162063825 19:8112357-8112379 GACTGTCCAGCCGGGTGCGGTGG + Intronic
1162290621 19:9777383-9777405 GAGTTTGGAGCCGGGTGCGGTGG + Intronic
1162298541 19:9829886-9829908 CCATTCACAGCCGGGTCAGGTGG - Intronic
1162324025 19:9987945-9987967 ACATTTAGGGCCGGGTGTGGTGG + Intronic
1162365459 19:10246162-10246184 GCATTTTTAGCCAGGTGCAGTGG + Intergenic
1162406093 19:10474777-10474799 GCAGTGATGGCCGGGTGCGGTGG + Intergenic
1162637887 19:11984729-11984751 GCATTTTCGGCCGGGCGCAGTGG - Intergenic
1162654691 19:12119621-12119643 AAATTAGCAGCCGGGTGCGGTGG + Intronic
1162854275 19:13456383-13456405 ACATTTACGGCCAGGTGTGGTGG + Intronic
1162984856 19:14263178-14263200 AAATTTAAGGCCGGGTGCGGTGG + Intergenic
1163080689 19:14939699-14939721 ACATTTCCGGCCGGGCGCGGTGG - Intergenic
1163131888 19:15279126-15279148 GCATGCTTAGCCGGGTGCGGTGG - Intronic
1163271432 19:16256571-16256593 GGTTTTTCAGCCGGGTGCAGTGG - Intergenic
1163335744 19:16670649-16670671 CCATGTCCAGCCGGGTGCGGGGG + Intronic
1163391197 19:17031146-17031168 GCATTATCGGCCGGGTGCAGTGG + Intergenic
1163414917 19:17180635-17180657 TCATTTCCAGCTGGGTGCGGTGG - Intronic
1163731521 19:18952312-18952334 ATATTTGCAGCCGGGTGCGATGG + Intergenic
1163961759 19:20703169-20703191 TAACTTCCAGCCGGGTGCGGTGG + Intronic
1164076219 19:21821120-21821142 AAAATTACAGCCGGGTGTGGTGG - Intronic
1164100649 19:22051884-22051906 GCAATCATGGCCGGGTGCGGTGG - Intergenic
1164151346 19:22554944-22554966 GAATTTTCGGCAGGGTGCGGTGG - Intergenic
1164215106 19:23137994-23138016 GCTTTCACGGCCGGGCGCGGTGG + Intronic
1164284705 19:23803600-23803622 TCAGTGACAGCCGGGCGCGGTGG + Intronic
1164306959 19:24012109-24012131 TCATTTATGGCCGGGCGCGGTGG - Intergenic
1164335340 19:24312310-24312332 GTATTTCCGGCCGGGCGCGGTGG - Intergenic
1164997156 19:32730075-32730097 GCAGTTTTAGCCGGGTGCTGTGG - Intronic
1165049364 19:33131956-33131978 GGCTTTGCAGCCGGGCGCGGTGG - Intergenic
1165107099 19:33476948-33476970 TCATTTCGAGCCGGGTGAGGTGG - Intronic
1165187032 19:34031271-34031293 GTACATATAGCCGGGTGCGGTGG + Intergenic
1165459378 19:35935639-35935661 ACACTGACAGCCGGGGGCGGTGG - Exonic
1165612183 19:37165072-37165094 TCCTTTTCAGCTGGGTGCGGTGG + Intronic
1165613338 19:37176319-37176341 GCATGCATAGCTGGGTGCGGTGG - Intronic
1165704756 19:37967537-37967559 AAATTTCCAGCCGGGTGCGGTGG - Intronic
1165856593 19:38882345-38882367 GCATTTCTGGCCGGGTGTGGTGG + Intronic
1166013417 19:39960829-39960851 GTAATTAGAGCCGGGTGCAGTGG - Intergenic
1166533760 19:43558847-43558869 GTATTTTCAGCCAGGTGCAGTGG + Intronic
1166599192 19:44079304-44079326 ACATTACCAGCCAGGTGCGGTGG + Intronic
1166733666 19:45072100-45072122 GCATGGACAGCCGGCTCCGGAGG + Exonic
1166788117 19:45381641-45381663 GCGCTTCCAGCCAGGTGCGGTGG + Intronic
1166826409 19:45612349-45612371 GCATATGTGGCCGGGTGCGGTGG - Intronic
1166851823 19:45764995-45765017 GCATTTCCTGCCAGGGGCGGGGG - Exonic
1166967604 19:46539282-46539304 ACATGCACAGCCGGGTGTGGTGG + Intronic
1167026518 19:46923399-46923421 TCATCTGCAGCCGGGCGCGGTGG - Intronic
1167047711 19:47060439-47060461 ACATTTGTGGCCGGGTGCGGTGG + Intergenic
1167134263 19:47608122-47608144 GCGTTTACGGCCTGGTGGGGCGG + Intergenic
1167199709 19:48055909-48055931 ACCTTTACGGCCGGGCGCGGTGG - Intronic
1167307637 19:48718538-48718560 GCAAGTATAGCCGGGTGTGGTGG - Intronic
1167372725 19:49093371-49093393 GCATTTCTGGCCGGGTGTGGTGG - Intronic
1167444717 19:49530781-49530803 GCAGCTCCAGCCGGGTGCGGTGG - Intronic
1167448429 19:49553132-49553154 GCCTAGATAGCCGGGTGCGGTGG + Intergenic
1167448664 19:49554586-49554608 GCCTAGATAGCCGGGTGCGGTGG - Intergenic
1167488469 19:49777346-49777368 AGATTTCCAGCCGGGCGCGGTGG + Intronic
1167859010 19:52268174-52268196 GGATATAAGGCCGGGTGCGGTGG + Intergenic
1167877654 19:52427696-52427718 GTATTTCTAGCCGGGCGCGGTGG + Intergenic
1167993332 19:53379401-53379423 TCACTAACAGCCGGGTGCAGTGG - Intronic
1168210166 19:54884342-54884364 CCAGTTGCAGCCAGGTGCGGTGG + Intronic
1168380349 19:55915308-55915330 GTAATTACAGCCATGTGCGGTGG + Intronic
1168397009 19:56056850-56056872 AGAATTCCAGCCGGGTGCGGTGG + Intronic
1168485219 19:56755753-56755775 GCATCTGCAGCCGGGCGCGGTGG - Intergenic
926074085 2:9926549-9926571 GCAGTTATGGCCAGGTGCGGTGG + Intronic
926193662 2:10746979-10747001 GAATTCTCAGCCAGGTGCGGTGG + Intronic
926298375 2:11584764-11584786 ACATTTACAGCCGGGCGCGGTGG + Intronic
926573893 2:14559357-14559379 GGAGTCACGGCCGGGTGCGGTGG + Intergenic
926872663 2:17440477-17440499 TCATTCAAGGCCGGGTGCGGTGG + Intergenic
926878227 2:17509770-17509792 GTATATCCAGCCGGGCGCGGTGG + Intergenic
927418584 2:22905696-22905718 AGATTTTCAGCCAGGTGCGGTGG + Intergenic
927628677 2:24751293-24751315 TAATTTACAGCCGGGCGCGGTGG + Intronic
927662625 2:25005757-25005779 GTATTTTGGGCCGGGTGCGGTGG + Intergenic
927822490 2:26280563-26280585 GCATTTCAGGCCGGGTGCGGTGG + Intronic
927831267 2:26352495-26352517 GTATCTCTAGCCGGGTGCGGTGG + Intronic
928024266 2:27727327-27727349 CCATAGGCAGCCGGGTGCGGTGG - Intergenic
928077995 2:28282710-28282732 GTATTTATAGCCGGGCACGGTGG + Intronic
928191655 2:29176046-29176068 TTATTCTCAGCCGGGTGCGGTGG - Intronic
928290107 2:30029435-30029457 GAATTTCTGGCCGGGTGCGGTGG + Intergenic
928298643 2:30106818-30106840 ACAGTTAGGGCCGGGTGCGGTGG + Intergenic
928519757 2:32077159-32077181 TCAATTAAAGCCGGGCGCGGTGG - Intronic
928526261 2:32144596-32144618 GCTGTTTCAGCTGGGTGCGGTGG + Intronic
928695611 2:33846686-33846708 GCTTTTCCAGCTGGGTGCAGAGG + Intergenic
928705491 2:33945478-33945500 TATTTTACAGCTGGGTGCGGTGG + Intergenic
928892496 2:36219976-36219998 GAATGTATATCCGGGTGCGGTGG - Intergenic
928968915 2:37006357-37006379 GCATCTATAGCTGGGTGCAGTGG + Intronic
929137804 2:38641901-38641923 GAAATTATGGCCGGGTGCGGTGG + Intergenic
929154437 2:38776818-38776840 ACGTTTACCGCCGGGCGCGGTGG + Intronic
929159092 2:38813657-38813679 ACATTTTCGGCCGGGTGCGGTGG - Intronic
929708188 2:44238188-44238210 GCATTTCAGGCTGGGTGCGGTGG - Intronic
929784108 2:44976711-44976733 GCATTGGAAGCTGGGTGCGGTGG + Intergenic
929790615 2:45019916-45019938 GCATGTGGAGCCAGGTGCGGTGG - Intergenic
929805135 2:45138442-45138464 ACATTTCCAGCCGGGGGTGGTGG - Intergenic
929987077 2:46744813-46744835 TCGATTACAGCCGGGCGCGGTGG - Intronic
930210214 2:48628954-48628976 GACTTTGCAGCCAGGTGCGGTGG + Intronic
930361358 2:50384217-50384239 GCATTCTCAGCCGGGTGCGGTGG + Intronic
930719964 2:54629290-54629312 TCATTTACATCCGGGAGCAGTGG + Exonic
930820396 2:55640936-55640958 GCTTTTAGAGCCAGGTGCGGTGG + Intronic
931384721 2:61787737-61787759 CCTTTTACAGCTGGGTGCGGTGG - Intergenic
931386140 2:61799222-61799244 GAATTCTCAGCTGGGTGCGGTGG + Intergenic
931409928 2:62019460-62019482 GCTTTTAGGGCCGGGTGCAGTGG - Intronic
931732862 2:65168475-65168497 GTCTTTGCAGCTGGGTGCGGTGG + Intergenic
932054017 2:68426385-68426407 GCATTTAAGGCCGGGTGTAGTGG - Intergenic
932109448 2:68982412-68982434 ACATTTACGGCCGGGCGCGGTGG + Intergenic
932236287 2:70123680-70123702 GTATTTACCGCGGGGCGCGGTGG + Intergenic
932242538 2:70168573-70168595 CTATTAGCAGCCGGGTGCGGTGG - Intronic
932254019 2:70268094-70268116 AAATTTACGGCCGGGTGCAGTGG - Intronic
932733557 2:74237812-74237834 GCAGTTAGGGCTGGGTGCGGTGG + Intronic
932808493 2:74804243-74804265 ACATATGCAGCCGGGCGCGGTGG + Intergenic
933228431 2:79778052-79778074 TCCTTTTCAGCTGGGTGCGGTGG + Intronic
933456207 2:82522971-82522993 GCCTTTGCAGCCGGGCGCGGGGG - Intergenic
933656370 2:84890486-84890508 GCTTTCACAGCTGGGTGCGGTGG - Intronic
933664997 2:84957692-84957714 ACATTCCCAGCCGGGCGCGGTGG - Intergenic
933744399 2:85560297-85560319 GCATTTCTAGCTGGGTACGGTGG + Intronic
933746490 2:85575575-85575597 GCATTTGTGGCCGGGCGCGGTGG + Intronic
933822824 2:86130012-86130034 ACATTTTTAGCCGGGTGCAGTGG + Intronic
933835835 2:86244855-86244877 GCTAGTACAGCCAGGTGCGGTGG + Intronic
934551306 2:95264105-95264127 GCAATTGTGGCCGGGTGCGGTGG - Intergenic
934960207 2:98666403-98666425 GAATTTAAGGCCGGGTGTGGTGG + Intronic
934961354 2:98677941-98677963 TCTTTTTCAGCCGGGTGCAGTGG + Intronic
935755434 2:106272967-106272989 TAATTTCCAGCCAGGTGCGGTGG + Intergenic
935780463 2:106505841-106505863 CCATTCAAGGCCGGGTGCGGTGG + Intergenic
935883405 2:107590057-107590079 AAATTTTCAGCCGGGCGCGGTGG + Intergenic
935993011 2:108738510-108738532 CCACATACAGCCGGGTGCAGTGG - Intronic
936058267 2:109277885-109277907 GCATTTCAGGCCGGGTGTGGTGG + Intronic
936068347 2:109348823-109348845 TCATTTACATCTGGGGGCGGCGG - Intronic
936102599 2:109596182-109596204 TGATTTTCAGCCGGGTGTGGTGG - Intronic
936365016 2:111845685-111845707 CCTTTTAGAGCCGGGCGCGGTGG + Intronic
936402116 2:112172919-112172941 GAACTTACAGCCAGGTGTGGTGG - Intronic
936444976 2:112588000-112588022 GGAATTAGGGCCGGGTGCGGTGG + Intronic
936861825 2:117028786-117028808 ACAGTAACAGCCGGGCGCGGTGG + Intergenic
936976614 2:118227182-118227204 GCATTTAAGGCTGGGCGCGGTGG + Intergenic
937121672 2:119443832-119443854 GTATTTATGGCCGGGCGCGGGGG - Intronic
937270666 2:120649514-120649536 GGATTCCCAGCCGGGTGTGGTGG + Intergenic
937281294 2:120719194-120719216 TCATTTACAGCTGGGTGCAGCGG - Intergenic
937355999 2:121198618-121198640 AAATTTACAGCTGGGTGTGGTGG + Intergenic
937425072 2:121792107-121792129 GCATTTATGGCCAGGTGCGGTGG + Intergenic
937458428 2:122064376-122064398 GCATTTACGGCAGGGCTCGGTGG - Intergenic
937939238 2:127272310-127272332 GATTTTACAACCGGGCGCGGTGG - Intronic
938153022 2:128902841-128902863 ACTTTTTCAGCCGGGTGCGGTGG + Intergenic
938153761 2:128909991-128910013 GTTTTGTCAGCCGGGTGCGGTGG + Intergenic
938302295 2:130225347-130225369 GAATTTACGGTCGGGTGTGGTGG + Intergenic
938323896 2:130384458-130384480 ACATTTAGGGCCGGGTGCGGTGG + Intergenic
938325275 2:130394269-130394291 ACACTTAGGGCCGGGTGCGGTGG - Intergenic
938450282 2:131412621-131412643 AGACTTACAGCCGGGTGCAGTGG + Intergenic
938454386 2:131448925-131448947 GAATTTACGGTCGGGTGTGGTGG - Intergenic
938529178 2:132165404-132165426 ACATTTGCAGCCAGGCGCGGTGG + Intronic
938908176 2:135859178-135859200 GCATTCTCAGCTGGGCGCGGTGG - Intronic
939020640 2:136954427-136954449 GAAATTACGGCCGGGCGCGGTGG + Intronic
939191552 2:138922104-138922126 GAAATTATTGCCGGGTGCGGTGG - Intergenic
939282187 2:140078630-140078652 CCATTCACAGCTGGGTGCAGTGG + Intergenic
939440639 2:142245064-142245086 GAAGTTCCCGCCGGGTGCGGTGG + Intergenic
939848830 2:147279789-147279811 TCTTTTATGGCCGGGTGCGGTGG - Intergenic
940077686 2:149761568-149761590 AGATTTGCGGCCGGGTGCGGTGG - Intergenic
940125238 2:150315250-150315272 GCTTTTGGGGCCGGGTGCGGTGG - Intergenic
940294932 2:152112558-152112580 GCATTTCCGGCCAGGCGCGGTGG - Intergenic
940415093 2:153410381-153410403 GCATTTCCAGCTGGGTGTGGTGG - Intergenic
940521416 2:154754560-154754582 ATGTTTACAGCCGGGTGCGGTGG - Intronic
940762562 2:157753240-157753262 GCCTTGACAGCCGGGTGTGGTGG + Intronic
940947842 2:159637847-159637869 AAATTTACAGCCAGGTGTGGTGG - Intergenic
941390142 2:164902306-164902328 ACATGAACAGCTGGGTGCGGTGG - Intronic
941472547 2:165906655-165906677 GAATTAGCAGCCGGGTGCGGTGG + Intronic
941783322 2:169473109-169473131 ACATTTGCGGCCGGGCGCGGTGG + Intergenic
941898454 2:170654348-170654370 GCAAGAAAAGCCGGGTGCGGTGG + Exonic
941912444 2:170776663-170776685 GCTTTTAAGGCCGGGCGCGGTGG - Intergenic
941955615 2:171201169-171201191 GGATTTGAGGCCGGGTGCGGTGG - Intronic
942582672 2:177436435-177436457 GCATTTCTGGCCGGGTGCAGTGG - Intronic
942623639 2:177875665-177875687 GCATATACGGCCAGGCGCGGTGG - Intronic
942666845 2:178328773-178328795 AGTTTTACAGCCGGGTGTGGTGG - Intronic
942809203 2:179976865-179976887 GAATTACCAGCCAGGTGCGGTGG + Intronic
942898255 2:181084333-181084355 GCAAACACAACCGGGTGCGGTGG + Intergenic
942913789 2:181277928-181277950 GCAATTGAGGCCGGGTGCGGTGG - Intergenic
943030452 2:182679486-182679508 GTAATTAGAGCCCGGTGCGGTGG - Intergenic
943152614 2:184133483-184133505 GCTTTTCCCGCCGGGTGTGGTGG + Intergenic
943592181 2:189812011-189812033 AAAATTACAGGCGGGTGCGGTGG + Intronic
943656004 2:190509750-190509772 GATTTTCCAGCTGGGTGCGGTGG + Intronic
943752535 2:191524767-191524789 GCAATGATGGCCGGGTGCGGTGG - Intergenic
944059098 2:195553305-195553327 CCAGTTATAGCCGGGTGCAGTGG - Intergenic
944111729 2:196139249-196139271 GATTTTACGGCCGGGCGCGGTGG - Intronic
944213300 2:197228746-197228768 GCAGTTACAGCCTGGCGCGGAGG + Intronic
944617543 2:201477349-201477371 GAACTGATAGCCGGGTGCGGTGG - Intronic
944679764 2:202066287-202066309 ATATTTTCAGCCGGGTGTGGTGG + Intergenic
944700802 2:202244398-202244420 CCATTTACGGCTGGGTGCAGTGG - Intergenic
944720868 2:202422192-202422214 GCTTTAACGGCCGGGTGCAGTGG - Intronic
944764694 2:202852381-202852403 CCCATTTCAGCCGGGTGCGGTGG + Intronic
944838433 2:203602373-203602395 TCACTTACGGCCAGGTGCGGTGG - Intergenic
945228036 2:207552901-207552923 ACATTCACAGCCGGGCGCGGTGG - Intronic
945244453 2:207705478-207705500 GCATTCATGGCCGGGTGCGGTGG + Intergenic
946205624 2:218105708-218105730 ACATTTAAAGCCGTGTGCAGAGG - Intergenic
946233723 2:218309191-218309213 GGTTTCACAGCCGGGTGTGGTGG + Intronic
946629080 2:221646826-221646848 GCCTTTGCAGCCAGGCGCGGTGG + Intergenic
946962412 2:224998897-224998919 TCATTTATAGCCGGGTGTGGTGG + Intronic
946971460 2:225096580-225096602 TCACTCACTGCCGGGTGCGGTGG - Intergenic
947273719 2:228368261-228368283 GCACTTGGGGCCGGGTGCGGTGG - Intergenic
947281653 2:228461785-228461807 ACTATTCCAGCCGGGTGCGGTGG - Intergenic
947547753 2:231023111-231023133 GTATTTAAGGCCGGGTGTGGTGG + Intronic
947554526 2:231079080-231079102 GGATTTTAGGCCGGGTGCGGTGG - Intronic
947973797 2:234346641-234346663 GCTTTTTCAGCCGGGTGCGGTGG + Intergenic
948152093 2:235752464-235752486 CTATTTACAGCCAGGCGCGGTGG - Intronic
948402249 2:237692418-237692440 GCATTTCCCGCCGGGTGGAGCGG + Exonic
949016611 2:241716086-241716108 GCAATGAAGGCCGGGTGCGGTGG - Intronic
1169010839 20:2248941-2248963 GGGTTTGCAGCCAGGTGCGGTGG - Intergenic
1169379131 20:5091496-5091518 GCAATACCAGCTGGGTGCGGTGG - Intronic
1169476793 20:5939088-5939110 CCATTTAAAGCCTGGTGCCGTGG - Intronic
1169727447 20:8751229-8751251 GCAGTTCCGGCCGGGCGCGGTGG - Intronic
1169734266 20:8821191-8821213 ATATTTAAGGCCGGGTGCGGTGG + Intronic
1169761714 20:9102130-9102152 TGATTTACAGCCAGGTGCGGTGG - Intronic
1170228580 20:14020183-14020205 CCATTGTCAGCCGGGCGCGGTGG + Intronic
1170234493 20:14087105-14087127 TCAGTTACAGCTGGGTGCGGTGG + Intronic
1170296413 20:14831489-14831511 GCAACAACAGCCGGGTGCTGTGG + Intronic
1170317761 20:15061228-15061250 GCATTTACAGGTGAGTACGGAGG - Intronic
1170611748 20:17919875-17919897 GCCTTTTCAGCCGGGCGCAGTGG + Intergenic
1170843996 20:19946741-19946763 GCAAATTCAGCTGGGTGCGGTGG + Intronic
1170926906 20:20733169-20733191 CCATTCTCAGCCAGGTGCGGCGG + Intergenic
1171985024 20:31654182-31654204 GTACTTACAGCCGGGCACGGTGG + Intergenic
1172101574 20:32486979-32487001 GAAATAACAGCCGGGTGCAGTGG + Intronic
1172293830 20:33793985-33794007 ACATCTTCAGCCGGGTGTGGTGG + Intergenic
1172345639 20:34196458-34196480 TCCTTTTCAGCCGGGCGCGGTGG - Intronic
1172366917 20:34357043-34357065 GCATCTCCAGCTGGGCGCGGTGG - Intergenic
1172373225 20:34413171-34413193 GCATTTAAAGCTGGATGTGGTGG - Intronic
1172405307 20:34684073-34684095 GGAGTTTCAGCTGGGTGCGGTGG + Intergenic
1172544419 20:35748358-35748380 TAATTTACGGCCGGGCGCGGTGG + Intergenic
1172568119 20:35946993-35947015 GCTTTCCCAGCCGGGCGCGGTGG - Intronic
1172652857 20:36516964-36516986 AAAAATACAGCCGGGTGCGGTGG + Intronic
1172710439 20:36918509-36918531 GAATTTATGGCCGGGCGCGGTGG + Intronic
1172927764 20:38554788-38554810 AATTTTACAGCCAGGTGCGGTGG + Intronic
1173019806 20:39257690-39257712 CCATACACAGCCGGGTGTGGTGG - Intergenic
1173207962 20:41009135-41009157 GATTTTACGGCCGGGCGCGGTGG - Intergenic
1173441747 20:43083644-43083666 ACATTTAAGGCTGGGTGCGGTGG - Intronic
1173475525 20:43356440-43356462 GCAATTCTAGCCGGGCGCGGTGG + Intergenic
1173525742 20:43731256-43731278 GCACAAACAGCCGGGCGCGGTGG - Intergenic
1173642180 20:44611339-44611361 GCATTCTAGGCCGGGTGCGGTGG - Intronic
1173795972 20:45860225-45860247 CCATTTCCCGCCGGGTGCAGTGG + Intronic
1173980778 20:47222246-47222268 GCGTTTGGGGCCGGGTGCGGCGG + Intronic
1174007558 20:47422504-47422526 GCAGTCACAGCCGGGCACGGTGG - Intergenic
1174313063 20:49674452-49674474 GCATTTAGGGTCGGGTGTGGTGG + Intronic
1174315564 20:49698032-49698054 AAATTTCCAGCCGGGCGCGGTGG + Intronic
1174642011 20:52052770-52052792 GCATTTCAGGCCGGGCGCGGTGG - Intronic
1174811758 20:53651486-53651508 ACATTTTCGGCCGGGCGCGGTGG + Intergenic
1174856004 20:54046240-54046262 GAATTCAGGGCCGGGTGCGGTGG + Intronic
1175106424 20:56618233-56618255 GTAGTGCCAGCCGGGTGCGGTGG - Intergenic
1175349346 20:58307871-58307893 GCAGTTTCGGCTGGGTGCGGTGG - Intergenic
1175467858 20:59204715-59204737 ACCCTCACAGCCGGGTGCGGAGG + Intronic
1175502197 20:59458523-59458545 GCATTTTGGGCTGGGTGCGGTGG - Intergenic
1175720468 20:61283531-61283553 GCATTTACACGCGTGTGCTGTGG + Intronic
1176011982 20:62902508-62902530 GAATTTAAAGCCGGGAGAGGAGG - Intronic
1176165525 20:63671344-63671366 GTAGGTCCAGCCGGGTGCGGTGG - Intronic
1176296084 21:5074012-5074034 GCATATAGGGCCAGGTGCGGTGG + Intergenic
1177059512 21:16353419-16353441 GAAATTACGGCCGGGCGCGGTGG - Intergenic
1177625638 21:23656129-23656151 GCATTTGGGGCCGGGCGCGGTGG - Intergenic
1177649830 21:23946186-23946208 GTATTTACGGCCGGGCGCGGTGG - Intergenic
1178141130 21:29684795-29684817 GTTTTTGCAGCCGGGTGTGGTGG - Intronic
1178278585 21:31261422-31261444 GGATTTTTGGCCGGGTGCGGTGG + Intronic
1178542401 21:33464485-33464507 ACATTTACGGCCGGGCGCAGTGG - Intronic
1178586264 21:33873871-33873893 ACATTTATGGCTGGGTGCGGTGG + Intronic
1178819838 21:35965105-35965127 TCAGTTGCAGCCGGGTGCAGTGG + Intronic
1178926137 21:36776698-36776720 GCCATATCAGCCGGGTGCGGTGG - Intronic
1179780757 21:43699361-43699383 CCATTCCCGGCCGGGTGCGGTGG + Intergenic
1179781114 21:43701679-43701701 GTGTCTACAGCCGGGTGCAGTGG - Intergenic
1179833915 21:44015899-44015921 ACATTTAGGGCCAGGTGCGGGGG - Intronic
1179860965 21:44188109-44188131 GCATATAGGGCCAGGTGCGGTGG - Intergenic
1179876382 21:44270790-44270812 GTACTTACAGCAGGGTGCAGTGG + Intergenic
1179919737 21:44501160-44501182 GCATTTATGGCCGGGCGGGGTGG + Intronic
1180431897 22:15260787-15260809 ACATTTGCAGCCAGGCGCGGTGG - Intergenic
1180713620 22:17856906-17856928 ACATTTTCGGCCGGGCGCGGTGG - Intronic
1181010780 22:20039339-20039361 CTGTTTACAGCCGGGTGCGGTGG + Intronic
1181110251 22:20598440-20598462 ACATTAGCGGCCGGGTGCGGTGG - Intergenic
1181160206 22:20955636-20955658 ACCTTTAGAGCCTGGTGCGGTGG + Intergenic
1181641119 22:24199350-24199372 GCATTTTCAGCTGGGCACGGTGG - Intergenic
1181686917 22:24535654-24535676 TCCTTTCCAGCTGGGTGCGGTGG + Intergenic
1181715765 22:24726570-24726592 GCCAATACCGCCGGGTGCGGCGG - Intronic
1181848987 22:25736307-25736329 GTATTTGCAGCCGGGCACGGTGG - Intergenic
1182291869 22:29286302-29286324 TCATTTTCAGCTGGGAGCGGAGG - Intronic
1182328736 22:29534979-29535001 GCATTTTAGGCCGGGTGTGGGGG + Intronic
1182531305 22:30960776-30960798 TCTTTTCCAGCCGGGTGTGGCGG - Intronic
1182843004 22:33407078-33407100 GCATTTTCAGCCAGGCGTGGTGG - Intronic
1182910856 22:33982930-33982952 TCAATTTCAGCCGGGTGCAGTGG - Intergenic
1183073700 22:35413329-35413351 GCCTGTGCGGCCGGGTGCGGTGG - Intronic
1183126364 22:35785148-35785170 GCATATTCAGCCGGGTGTGATGG - Intronic
1183219822 22:36505479-36505501 GAATTGAAGGCCGGGTGCGGTGG + Intronic
1183372228 22:37439869-37439891 GCACTTACAGCTGGGCGTGGTGG + Intergenic
1183519466 22:38288290-38288312 GCATCATCAGCCGGGCGCGGTGG + Intergenic
1183571027 22:38653660-38653682 GCATTACAGGCCGGGTGCGGTGG - Intronic
1183572018 22:38660480-38660502 GCATTTTCGGCCTGGTGTGGTGG - Intronic
1183711628 22:39507530-39507552 GCCTTTTCGGCCGGGTACGGTGG - Intronic
1183758425 22:39792587-39792609 CCATTACCAGCTGGGTGCGGTGG + Intronic
1183801696 22:40171446-40171468 GCATTTATGGCCGGGTGCGGTGG - Intronic
1183925702 22:41204505-41204527 CCAGTTTCAGCCGGGCGCGGTGG + Intergenic
1184052255 22:42016266-42016288 ACATTTCCGGCCGGGTCCGGTGG - Intronic
1184226889 22:43134051-43134073 TCATTGAGATCCGGGTGCGGCGG - Intronic
1184446908 22:44553424-44553446 GCTATACCAGCCGGGTGCGGTGG + Intergenic
1184494541 22:44830309-44830331 ACAGTAACAGCCGGGTGCAGTGG - Intronic
1184494781 22:44832511-44832533 ACATTGACAACCGGGTGTGGTGG - Intronic
1184511672 22:44937151-44937173 GAATGTTCAGCCGGGTGCGGTGG - Intronic
1184517900 22:44974124-44974146 GCATATGCGGCCAGGTGCGGTGG + Intronic
1184611400 22:45606292-45606314 ACATTTCCGGCCGGGCGCGGTGG - Intergenic
1184796109 22:46733752-46733774 GAATTTACAGCCAGGTGCAGTGG + Intronic
1184990597 22:48166558-48166580 GTATTCACGGCCGGGCGCGGTGG - Intergenic
949343860 3:3058568-3058590 GCCTTAAGGGCCGGGTGCGGTGG - Intergenic
949366115 3:3282475-3282497 GAATTTACAGCCAGGTGCAGTGG - Intergenic
949531717 3:4962413-4962435 GGACTTCCAGCCGGGTGCGGTGG + Intergenic
949635437 3:5976836-5976858 GCATTTTCGGCCGGGCGTGGTGG - Intergenic
950101734 3:10361303-10361325 GCAGTTACAGCCGGGCATGGTGG - Intronic
950372207 3:12540584-12540606 GCACTTCAGGCCGGGTGCGGTGG + Intronic
950498795 3:13350983-13351005 GAATTTCTGGCCGGGTGCGGTGG - Intronic
950720627 3:14880057-14880079 GCATTTACAGCTGGGCTCGGTGG + Intronic
950840816 3:15966655-15966677 GCAGTTGGGGCCGGGTGCGGTGG - Intergenic
951075380 3:18385333-18385355 ACATTTGCAGCCGGGCGCGGTGG + Intronic
951286941 3:20824677-20824699 GCATTTTCTGCTGGGCGCGGTGG + Intergenic
951651063 3:24952086-24952108 ACATTTGCAGCTGGGTGCAGTGG + Intergenic
952335582 3:32400676-32400698 GCATTTACAGCCAGGCATGGTGG - Intronic
952776053 3:37047726-37047748 AAATTTCCAGCCGGGTGCGGTGG + Intronic
952800306 3:37284537-37284559 GTGTTCACAGCCGGGTGTGGTGG - Intronic
953619195 3:44518217-44518239 GCATTTGCAGCTGGGTGCGGTGG - Intergenic
953857220 3:46508620-46508642 TCATTTCCGGCCGGGCGCGGTGG - Intergenic
953864517 3:46572771-46572793 CCATATACGGCCGGGCGCGGTGG - Intronic
953918172 3:46934070-46934092 ATATTTACAACCGGGTGCTGTGG - Intronic
953954897 3:47224247-47224269 ACATTTAAAGCCGGGTGTGGTGG + Intergenic
953958609 3:47249768-47249790 GTAATTCCAGCCAGGTGCGGTGG + Intronic
953961599 3:47270189-47270211 GCTCTTAGAGCCAGGTGCGGTGG - Intronic
954049992 3:47967047-47967069 ACATTTAGGGCCGGGTGCAGTGG + Intronic
954061719 3:48073321-48073343 ACAAGTTCAGCCGGGTGCGGTGG + Intronic
954100099 3:48365536-48365558 AAATTTACGGCTGGGTGCGGTGG + Intergenic
954187720 3:48931727-48931749 CAATTTTCAGCCGGGTGCGGTGG + Intronic
954503233 3:51041502-51041524 ACATTTTGGGCCGGGTGCGGTGG - Intronic
954564518 3:51587919-51587941 TGATTTATGGCCGGGTGCGGTGG + Intronic
955291786 3:57698717-57698739 GCATTCATGGCCGGGCGCGGTGG - Intergenic
955375530 3:58392945-58392967 AAATTTAGGGCCGGGTGCGGTGG - Intronic
955557744 3:60156064-60156086 TCATTTAGGGCCGGGTGTGGGGG + Intronic
956072509 3:65468662-65468684 TCTTTGACAGCCGGGTGCAGTGG - Intronic
956415410 3:69021969-69021991 TCATTTACGGCCAGGTGCTGTGG - Exonic
956665357 3:71637230-71637252 ACATTTAGGGCCGGGTGTGGTGG - Intergenic
956773429 3:72546242-72546264 GTATTTACGGGCGGGTGTGGTGG - Intergenic
956791262 3:72681672-72681694 AACTTGACAGCCGGGTGCGGTGG - Intergenic
957225647 3:77442023-77442045 AGATTTACGGCCGGGCGCGGTGG + Intronic
957246587 3:77723799-77723821 GAACTTTCTGCCGGGTGCGGGGG + Intergenic
957558871 3:81796103-81796125 TCATTCCCAGCGGGGTGCGGTGG - Intergenic
957724089 3:84042117-84042139 GCATTTAAGGCCAGGCGCGGTGG - Intergenic
958961770 3:100517371-100517393 CCATTCCCAGCCGGGTGCGGTGG - Intronic
959341757 3:105140020-105140042 ACATTTGCAGCCGGGCGTGGTGG - Intergenic
959727717 3:109562692-109562714 GCAAATACAGCTGGGTGTGGTGG - Intergenic
960041586 3:113155463-113155485 ACATTTTCGGCCAGGTGCGGTGG + Intergenic
960168001 3:114426046-114426068 GCCTCCTCAGCCGGGTGCGGTGG + Intronic
960202943 3:114860019-114860041 GAAATTACAGCCGGGCGCGGTGG + Intronic
960972345 3:123148923-123148945 GCATTTACAGGCAGGTGCATAGG + Intronic
961223476 3:125218525-125218547 GAATTTAAGGCCGGGTGTGGTGG + Intergenic
961226967 3:125258552-125258574 GTAGTTACAGCCAGGTGCAGTGG - Intronic
962050947 3:131814889-131814911 GCATTTCAGGCCGGGCGCGGTGG - Intronic
962231146 3:133666456-133666478 ACATTCAAGGCCGGGTGCGGTGG - Intergenic
962586319 3:136845879-136845901 TTTTTTACGGCCGGGTGCGGTGG - Intronic
962703151 3:138018621-138018643 GCCTTGAGGGCCGGGTGCGGTGG - Intronic
963141381 3:141948815-141948837 CCATTTGAGGCCGGGTGCGGTGG + Intergenic
963153485 3:142071443-142071465 TCCTTTATGGCCGGGTGCGGTGG - Intronic
963218631 3:142780133-142780155 TCAATTACGGCTGGGTGCGGTGG - Intronic
963230212 3:142902036-142902058 TCATTCACAGCCGGGTGCGGTGG + Intergenic
963249492 3:143089973-143089995 GAAGTTGCAGCCGGGCGCGGTGG - Intergenic
963720638 3:148858283-148858305 GTGTTTTCAGCCGGGTGCAGTGG + Intronic
963742367 3:149093240-149093262 TCATTTACAGCCAGGTGAGATGG - Intergenic
964115256 3:153130144-153130166 GAATTTCCAGCTGGGTGCAGTGG - Intergenic
964813155 3:160687512-160687534 GCTTTCTCAGCCGGGTGCAGTGG + Intergenic
964864256 3:161237813-161237835 TTATGAACAGCCGGGTGCGGTGG - Intronic
965205684 3:165717505-165717527 GGATTTCTGGCCGGGTGCGGTGG - Intergenic
965355120 3:167664119-167664141 GTATTTAAGGCCGGGCGCGGTGG - Intergenic
965534433 3:169810775-169810797 GCATTTCCGGCCGGGTGCGGTGG + Intronic
965665822 3:171092233-171092255 GCATTTGCAGCCGGGCGCGGTGG - Intronic
965740385 3:171867916-171867938 GCATTGGCAGCTGGGCGCGGTGG - Intronic
965783736 3:172315087-172315109 GAATTTACAGCCGGGCGCGGTGG + Intronic
966039955 3:175471196-175471218 GAAATTATGGCCGGGTGCGGTGG + Intronic
966550109 3:181195281-181195303 GAATTTACGGCCAGGTGCGGTGG - Intergenic
967194376 3:187013870-187013892 GTATTTGCGGCCGGGTGCGGTGG - Intronic
967226567 3:187297776-187297798 ACTTTTTCAGCCGGGTGTGGTGG - Intergenic
967521589 3:190438900-190438922 CCATTTCCCGCCGGGCGCGGTGG + Intronic
967793085 3:193570010-193570032 GCTTTGCCAGCAGGGTGCGGTGG + Intronic
968122767 3:196137439-196137461 GAATTTGGGGCCGGGTGCGGTGG - Intergenic
968190635 3:196664732-196664754 TGATTTCCTGCCGGGTGCGGTGG + Intronic
968256088 3:197273523-197273545 ATATATTCAGCCGGGTGCGGTGG - Intronic
968297861 3:197591445-197591467 GCATTCAGGGCCGGGTGTGGTGG - Intergenic
968301136 3:197616212-197616234 GGTTTTATAGCTGGGTGCGGTGG - Intergenic
968313870 3:197706011-197706033 TTATTTTCAGCCGGGTACGGTGG - Intronic
968336726 3:197919910-197919932 ACATTTACAGCCAGGCTCGGTGG + Intronic
968421691 4:490187-490209 TCACAAACAGCCGGGTGCGGTGG + Intronic
968422116 4:494471-494493 GTACTTCCAGCCAGGTGCGGTGG - Intronic
968455349 4:695651-695673 AGAGTTTCAGCCGGGTGCGGTGG - Intergenic
968458547 4:711742-711764 ACATTTTCGGCCGGGTGCGGTGG - Intronic
968459534 4:717663-717685 GCACACACAGCCGGGCGCGGTGG - Intronic
968632253 4:1657924-1657946 CCGTTTACAGCCGGGCGTGGTGG - Intronic
968777845 4:2555489-2555511 GAATTAACAGCTGGGTGCAGTGG + Intronic
968786981 4:2629842-2629864 GCATTATCGGCCGGGTGCGGTGG + Intronic
968828894 4:2921413-2921435 GAATTTTCGGCCGGGTGCAGTGG - Intronic
969120770 4:4909416-4909438 GAATATAAAGCCGGGTACGGGGG - Intergenic
970195950 4:13549814-13549836 CCATTCCTAGCCGGGTGCGGTGG - Intergenic
970382807 4:15524736-15524758 AAAATTAAAGCCGGGTGCGGTGG - Intronic
970613998 4:17751018-17751040 GCACATAGGGCCGGGTGCGGTGG + Intronic
971201848 4:24516493-24516515 ACAGGTACAGCCGGGCGCGGTGG + Intergenic
971369203 4:26002268-26002290 GCAACTGCAGCCGGGTGGGGTGG + Intergenic
971674320 4:29606092-29606114 GCATGTTCAGCCGGGCGCGGTGG + Intergenic
971958661 4:33456103-33456125 GCAGTTCTGGCCGGGTGCGGTGG - Intergenic
972194888 4:36641706-36641728 ACATTTTCAGCCGGGCGCGGTGG + Intergenic
972466467 4:39361759-39361781 GCAGTTCCAGCTGGGCGCGGTGG + Intronic
972478485 4:39475574-39475596 ACATTTAAGGCCGGGTGCAGTGG + Intronic
972494594 4:39622367-39622389 GCATTTGTGGCCGGGCGCGGTGG - Intronic
972515316 4:39805785-39805807 GCATTTGAGGCCGGGCGCGGTGG - Intergenic
972522203 4:39869817-39869839 GGATATTCAGCCGGGTGCAGAGG + Intronic
972763348 4:42128691-42128713 GTATTCAAGGCCGGGTGCGGTGG + Intronic
972903641 4:43717636-43717658 AAATTTGCAGCTGGGTGCGGTGG + Intergenic
972918582 4:43909128-43909150 GCAGTTACCGCCAGGTGCGGTGG + Intergenic
972987514 4:44782213-44782235 TCATATGCAGCCGGGAGCGGTGG - Intergenic
973080062 4:45979747-45979769 ACATTTAGGGCCGGGCGCGGTGG - Intergenic
973565598 4:52183865-52183887 ACATTTTCAGCCAGGCGCGGTGG - Intergenic
973634689 4:52851135-52851157 GTATCTGCAGCTGGGTGCGGTGG + Intergenic
973688000 4:53393777-53393799 ACATTCACAGCCGGGGGCGGGGG - Intronic
973752033 4:54030818-54030840 GCATTTTAGGCCAGGTGCGGTGG - Intronic
973807523 4:54540282-54540304 ACATTTCCGGCCGGGCGCGGTGG + Intergenic
973823469 4:54683347-54683369 GCAGTTATGGCCGGGCGCGGTGG + Intronic
973925491 4:55733117-55733139 ACAGTCACAGCCGGGTGCAGTGG - Intergenic
974037981 4:56833681-56833703 GTAATTTTAGCCGGGTGCGGTGG + Intergenic
974437502 4:61875093-61875115 GCATTTTGGGCCGGGCGCGGTGG - Intronic
974699332 4:65419169-65419191 GAGTTTAGGGCCGGGTGCGGTGG - Intronic
974708149 4:65550546-65550568 ACAACTACAGCCGGGTGCGGTGG + Intronic
974767199 4:66362165-66362187 CCATTTACAGCCAGGCACGGTGG - Intergenic
974843206 4:67321901-67321923 GCATTTAAGGCCAGGTGCAGTGG - Intergenic
974860685 4:67517548-67517570 GCATTGTCGGCCGGGTGCGGTGG + Intronic
975109598 4:70608803-70608825 GTAATAGCAGCCGGGTGCGGTGG + Intergenic
975119868 4:70716554-70716576 GCATTGAAGGCCAGGTGCGGTGG + Intronic
975149592 4:71005836-71005858 GCAAATAAGGCCGGGTGCGGTGG + Intronic
975156190 4:71075680-71075702 GCAATCACGGCCGGGCGCGGTGG + Intergenic
976251802 4:83059986-83060008 GCTGTTTCGGCCGGGTGCGGTGG - Intronic
976406758 4:84667995-84668017 TCTTTTACAGCCGAGTGCAGTGG - Intergenic
976411325 4:84716507-84716529 ACATTTTCGGCCGGGCGCGGTGG + Intronic
976506817 4:85856755-85856777 TAATTTCCAGCCGGGCGCGGTGG - Intronic
976567484 4:86567505-86567527 GAATTTTCAGCCAGGTGTGGTGG - Intronic
976878271 4:89884747-89884769 GTTTTTAAAGCCGGGTGTGGTGG - Intronic
977276909 4:94989101-94989123 TCATTCACGGCCGGGTGCGATGG + Intronic
977428860 4:96905956-96905978 GCATTTCCAGCCAGGTGCAGTGG + Intergenic
977773801 4:100893479-100893501 ACATGTTCGGCCGGGTGCGGTGG + Intergenic
977932815 4:102767181-102767203 TGATTTACAGCCAGGTGCAGTGG + Intergenic
978053125 4:104228271-104228293 GCATTTAAGCCCGGGTGGGGAGG - Intergenic
978276295 4:106954806-106954828 ACATTTCTAGCCGGGTGCAGTGG - Intronic
978427315 4:108595996-108596018 GCCCTTCCAGCCGGGTGTGGTGG + Intergenic
978573356 4:110164476-110164498 GCAAGCACAGCCGGGTGAGGTGG + Intronic
978744035 4:112171570-112171592 GAGTTTATGGCCGGGTGCGGTGG + Intronic
978749231 4:112228391-112228413 TCATTTAGAGCTGGGTGTGGTGG - Intergenic
979265356 4:118695822-118695844 GTATTTTGGGCCGGGTGCGGTGG + Intronic
979304768 4:119129917-119129939 GTATATACAGCTGGGTGCAGTGG - Intergenic
979348847 4:119622584-119622606 GCTTTAAAGGCCGGGTGCGGTGG + Intronic
979359106 4:119740867-119740889 GCAGTTTCGGCCCGGTGCGGTGG + Intergenic
979806049 4:124972399-124972421 GCAGTCACGGCCGGGCGCGGTGG - Intergenic
980062582 4:128148141-128148163 GCATCTAAAGCTGGGCGCGGTGG + Intronic
980125086 4:128766347-128766369 GTTTTTTCAGCCGGGTGTGGTGG - Intergenic
980524464 4:133971396-133971418 GAATTTAAGGCCGGGCGCGGTGG - Intergenic
980645787 4:135640811-135640833 ACATTTTCGGCCGGGCGCGGTGG - Intergenic
980796845 4:137696640-137696662 GAACTTAAGGCCGGGTGCGGTGG + Intergenic
980981176 4:139655748-139655770 GTATTTACAGCAGAGTGAGGAGG - Intergenic
981072236 4:140555755-140555777 GCATTTTAGGCCGGGTGTGGTGG - Intergenic
981098983 4:140810422-140810444 GCATTGTCAGCCAGGTGCAGTGG - Intergenic
981932932 4:150209786-150209808 ACATTTAGGGCCAGGTGCGGTGG + Intronic
982001836 4:151027868-151027890 GCAAGTACAGCCGGGCACGGTGG + Intergenic
982027614 4:151267029-151267051 GCTTTTTCAGCTGGGTGTGGTGG + Intronic
982178129 4:152725819-152725841 GCATTTTCAGCCAGATGTGGTGG - Intronic
982230307 4:153202817-153202839 GAATTTAAGGCCGGGCGCGGTGG + Intronic
982349554 4:154400014-154400036 GCTTTCACGGCCGGGCGCGGTGG + Intronic
982436984 4:155391047-155391069 GTATTTGCAGCTGAGTGCGGTGG + Intergenic
982711237 4:158760439-158760461 GTATTCAGGGCCGGGTGCGGTGG + Intergenic
982798819 4:159676852-159676874 GTGTTTCCGGCCGGGTGCGGTGG - Intergenic
983016622 4:162621447-162621469 TCATCTTCAGCCGGGTGTGGTGG + Intergenic
983070465 4:163261778-163261800 GCATTTTCAGCCGGATGTGGTGG - Intergenic
983200413 4:164854913-164854935 GTAATAACAGCTGGGTGCGGTGG + Intergenic
983217255 4:165013582-165013604 CTTTTTACAGCCGGGCGCGGTGG - Intergenic
983222634 4:165057220-165057242 ACATTTTCAGCCTGGTGCAGTGG + Intergenic
983428344 4:167616087-167616109 CCAGAGACAGCCGGGTGCGGTGG - Intergenic
983528880 4:168789417-168789439 ACATTTAGGGCCGGGTGCAGTGG + Intronic
983562970 4:169119413-169119435 GCTTGTATAGCCGGGTGCAGTGG - Intronic
983613237 4:169672948-169672970 TAACTTACAGCCGGGCGCGGTGG - Intronic
983866204 4:172769974-172769996 GCTTTTATAGCTGGGCGCGGTGG + Intronic
983880771 4:172929987-172930009 GCATCTAGGGCCAGGTGCGGTGG + Intronic
983966626 4:173820495-173820517 GCAATTATGGCCGGGTGTGGTGG + Intergenic
983973312 4:173900971-173900993 CCATTTTCAGCTGGGTGCAGTGG + Intergenic
984086014 4:175311941-175311963 GCATTTCTGGCTGGGTGCGGTGG - Intergenic
984454852 4:179952495-179952517 GCATTCAAGGCCGGGCGCGGTGG - Intergenic
984583200 4:181534101-181534123 GCATTCAAGGCCGGGTGCAGTGG + Intergenic
984958057 4:185065631-185065653 GCATATACGGCTGGGCGCGGTGG + Intergenic
985077706 4:186233198-186233220 GTAATTACCGCTGGGTGCGGTGG - Intronic
985149254 4:186929522-186929544 GAAAATACAGCCGGGCGCGGTGG + Intergenic
985241481 4:187935327-187935349 GCATGCACAGCCAGGTGCTGTGG + Intergenic
985262041 4:188123650-188123672 GAATTTTGGGCCGGGTGCGGTGG - Intergenic
985429309 4:189863065-189863087 GCATTTTCATTTGGGTGCGGTGG - Intergenic
985659523 5:1149739-1149761 GCTATTCAAGCCGGGTGCGGTGG + Intergenic
985877143 5:2608789-2608811 ACAATTACGGCTGGGTGCGGTGG + Intergenic
986139886 5:5019493-5019515 TCACTCTCAGCCGGGTGCGGTGG - Intergenic
986246884 5:6016546-6016568 TCATTTACGGCCGGGTGTGGCGG + Intergenic
986696446 5:10360424-10360446 CCACATACAGCCGGGCGCGGTGG - Intronic
987330312 5:16851089-16851111 GCATTTGAAGCCAGGTGTGGTGG - Intronic
987369900 5:17183610-17183632 GCAGCTCCAGCCGGGTGCAGTGG - Intronic
988496392 5:31749707-31749729 ACCGTCACAGCCGGGTGCGGAGG - Intronic
988504864 5:31813161-31813183 GTATTCACGGCCAGGTGCGGTGG + Intronic
988516159 5:31906553-31906575 CTATTTATAGCCGGGTGCAGTGG + Intronic
988735691 5:34018837-34018859 GAATTTGCGGCTGGGTGCGGGGG + Intronic
989026575 5:37075216-37075238 GAATTTTCAGCTGGGTGTGGTGG + Intergenic
989256851 5:39375595-39375617 GCTATTATAGCCAGGTGCGGTGG + Intronic
989292583 5:39787012-39787034 GAATATACAGCCGGGCGTGGTGG - Intergenic
989404109 5:41041337-41041359 ACATCTTCAGCGGGGTGCGGTGG + Intronic
989480669 5:41926284-41926306 AAATTTACGGCCGGGCGCGGTGG + Intronic
989783662 5:45301429-45301451 GCAATTCCAGTCAGGTGCGGTGG + Intronic
990223430 5:53621985-53622007 TAATTTACGGCCGGGCGCGGTGG - Intronic
990401664 5:55444366-55444388 GCATTTGGGGCCGGGCGCGGTGG - Intronic
990672931 5:58152749-58152771 AAAATTACGGCCGGGTGCGGTGG + Intergenic
990899719 5:60737449-60737471 GTATTTATGGCCGGGTGCGGTGG + Intergenic
990982773 5:61616674-61616696 GCATTTCTGGCCGGGTGCGGTGG + Intergenic
991181607 5:63757790-63757812 ACATTTATGGCCGGGTGCAGTGG - Intergenic
991315564 5:65300916-65300938 GGACTTACGGCCGGGCGCGGTGG - Intronic
991715278 5:69445959-69445981 GATTTTACAGCCAGGTGTGGTGG - Intergenic
991943682 5:71879667-71879689 GCAGTCACAGCTGGGTGTGGTGG + Intergenic
992130374 5:73685906-73685928 CCAATTCCAGCCGGGTGTGGTGG - Intronic
992300102 5:75369201-75369223 ACATTTTCAGCCGGGGGCAGCGG - Intronic
992379191 5:76220382-76220404 GAATTGACAGCCGGGTGCAGTGG + Intronic
992399820 5:76402374-76402396 TTATTTAGAGCCGGGCGCGGCGG - Intergenic
992792661 5:80227471-80227493 GTGTTTACAGCCGGGAGCAGCGG + Intronic
992842425 5:80709330-80709352 GTTTTTAGGGCCGGGTGCGGTGG + Intronic
992956394 5:81913438-81913460 AAATTGACAGCTGGGTGCGGTGG - Intergenic
993064433 5:83080237-83080259 AAAATTCCAGCCGGGTGCGGTGG + Intronic
993968425 5:94387404-94387426 GCATTCCCAGCTGGGTGCAGTGG + Intronic
993975092 5:94469457-94469479 CCATTTGAGGCCGGGTGCGGTGG - Intronic
994038806 5:95233614-95233636 TCATTTAGGGCCAGGTGCGGTGG - Intronic
994067228 5:95556720-95556742 GCATTCACGGCCGGGCGCGGTGG + Intronic
994147734 5:96413510-96413532 GCATTTAGAGCCAGGCGCAGTGG + Intronic
994186358 5:96819209-96819231 GCAGTTCAAGCCGGGTGTGGTGG - Intronic
994471605 5:100214959-100214981 AAATTTAGGGCCGGGTGCGGTGG - Intergenic
994588204 5:101738691-101738713 GCAATCACGGCCGGGCGCGGTGG + Intergenic
995318612 5:110804908-110804930 TCATTTTCCGCTGGGTGCGGTGG + Intergenic
995340070 5:111048534-111048556 TCATTTATGGCCGGGCGCGGTGG + Intergenic
995387373 5:111602687-111602709 GCCTAGTCAGCCGGGTGCGGTGG - Intergenic
995688929 5:114801457-114801479 GCACTTCCGGCCGGGCGCGGTGG - Intergenic
995717078 5:115090964-115090986 GCATTTGTGGCCAGGTGCGGTGG - Intergenic
995722220 5:115148694-115148716 AGATTTACGGCCGGGCGCGGTGG - Intronic
995940641 5:117578470-117578492 CCAGTTAAGGCCGGGTGCGGTGG - Intergenic
996611100 5:125381658-125381680 TCATTCACGGCCGGGCGCGGTGG + Intergenic
996722164 5:126640383-126640405 ACATTTACGGCTGGGTGCGATGG - Intergenic
996734266 5:126744109-126744131 ACATTCTCAGCCGGGGGCGGTGG + Intergenic
996737144 5:126768540-126768562 GCAGTTTCAGCCGGGCGCGGTGG + Intergenic
997114305 5:131109514-131109536 ACATTTACGGCCAGGTGTGGTGG - Intergenic
997455883 5:134017177-134017199 GTATTTCAAGCCGGGCGCGGTGG + Intergenic
998400672 5:141847230-141847252 AAAAATACAGCCGGGTGCGGTGG - Intergenic
998601667 5:143591354-143591376 GTATATTCAGCCGGGTGCAGTGG + Intergenic
998825058 5:146092821-146092843 GCAAATTCGGCCGGGTGCGGTGG - Intronic
998884003 5:146675389-146675411 GTATTTATAGCGGGGTGAGGGGG - Intronic
999172686 5:149608655-149608677 GTACTTACTGCCGGGTGTGGTGG - Intronic
999258941 5:150226031-150226053 GAATTCTCGGCCGGGTGCGGTGG - Intronic
999282199 5:150373326-150373348 ACATTTATGGCCAGGTGCGGTGG - Intronic
999315073 5:150578419-150578441 GCAGTTTCGGCCGGGTGCGGTGG + Intergenic
999463780 5:151780797-151780819 GCATTATCAGCCAGGCGCGGTGG - Intronic
999523897 5:152381649-152381671 ACATTTAAGGCCGGGCGCGGTGG - Intergenic
999808623 5:155107364-155107386 ATATGTACAGCCGGGTGTGGTGG + Intergenic
999894778 5:156019875-156019897 GCATTTAAAGCCCTGTGCTGTGG + Intronic
999907903 5:156163731-156163753 TCATTTTCGGCCGGGCGCGGTGG + Intronic
1000008405 5:157209046-157209068 TCAGTCACAGCCGGGTGCAGTGG + Intronic
1000016325 5:157280509-157280531 TCATTTACAGACGGGTGTGGTGG - Intronic
1000077421 5:157804635-157804657 GCTTGTACTGCCGGGCGCGGTGG + Intronic
1000099527 5:158001954-158001976 GAATTTTCAGCTGGGAGCGGTGG + Intergenic
1000314287 5:160073775-160073797 TCATTCCAAGCCGGGTGCGGTGG + Intronic
1000583268 5:163061307-163061329 GCATTACCCGCTGGGTGCGGTGG + Intergenic
1000602855 5:163296011-163296033 CCTTCTCCAGCCGGGTGCGGTGG - Intergenic
1000940420 5:167353792-167353814 CCATATACGGCCGGGCGCGGTGG - Intronic
1001123713 5:169000111-169000133 GAAGTTATGGCCGGGTGCGGTGG + Intronic
1001349147 5:170939671-170939693 GTGTTTACAGCCAGGTGCGGTGG - Intronic
1001524062 5:172416038-172416060 GAACTTCCAGCCGGGCGCGGTGG + Intronic
1001588698 5:172850910-172850932 GGATTTCCAGCCGGGCACGGTGG + Intronic
1001777840 5:174342284-174342306 GCCTTATAAGCCGGGTGCGGTGG - Intergenic
1002149290 5:177214042-177214064 GTATTTACGGCCAGGTGCGGTGG + Intronic
1002470742 5:179434083-179434105 GCACATGCAGCCGGGTGCGGTGG - Intergenic
1002602358 5:180361351-180361373 GGACCCACAGCCGGGTGCGGTGG - Intergenic
1003203019 6:3980297-3980319 GTTTTAAAAGCCGGGTGCGGTGG - Intergenic
1003210311 6:4057899-4057921 TAAGTTACAGCCGGGTGCGGTGG - Intronic
1003266570 6:4569979-4570001 ACATTTATGGCTGGGTGCGGTGG - Intergenic
1003279731 6:4680939-4680961 GCCATAACAGCCGGGTGCAGTGG + Intergenic
1003323165 6:5070902-5070924 ACATTTTCTGCTGGGTGCGGTGG + Intergenic
1003335309 6:5165828-5165850 GCATTTGTGGCCGGGCGCGGTGG - Intronic
1003463282 6:6352258-6352280 GCATTCAGAGCCTGGTGTGGTGG - Intergenic
1003570957 6:7256263-7256285 GCATTTCAGGCCGGGTGCAGTGG + Intergenic
1003633311 6:7808205-7808227 ACATTTAAGGCCGGGCGCGGTGG - Intronic
1003735557 6:8874157-8874179 GAATATAGGGCCGGGTGCGGTGG - Intergenic
1003835725 6:10070565-10070587 ACATTTTCGGCCGGGCGCGGTGG + Intronic
1003861942 6:10330410-10330432 GGATTTAAGGCCGGGTGTGGTGG - Intergenic
1003994409 6:11524266-11524288 TCAGTTAAAGCCAGGTGCGGTGG + Intergenic
1004050225 6:12070398-12070420 GATTTTTCGGCCGGGTGCGGTGG + Intronic
1004177020 6:13348929-13348951 CCATTCACAGCCAGGCGCGGTGG - Intergenic
1004260840 6:14106313-14106335 GCTGTTTCAGCCGGGTGTGGTGG - Intergenic
1004361281 6:14973378-14973400 GGATGTACAGCTGGGTGCGGTGG - Intergenic
1004384956 6:15164643-15164665 ACAGTTGTAGCCGGGTGCGGTGG + Intergenic
1004394379 6:15235323-15235345 ACATTTACAGCCTGGCACGGTGG - Intergenic
1004632942 6:17438823-17438845 GCTTTTTCTGCCGGGCGCGGTGG + Intronic
1004795554 6:19079709-19079731 GCTCTTCCGGCCGGGTGCGGTGG + Intergenic
1004844547 6:19625330-19625352 GTATTTACGACCGGGCGCGGTGG + Intergenic
1004973452 6:20937373-20937395 ACATTTAAAGCCAGGTGTGGTGG - Intronic
1005020261 6:21411372-21411394 ACATTTTCGGCCGGGCGCGGTGG + Intergenic
1005027805 6:21480348-21480370 ACATTTGCAGCCGAGTGCGGTGG - Intergenic
1005250680 6:23942445-23942467 GTTTTTGCAGCTGGGTGCGGTGG - Intergenic
1005482195 6:26265494-26265516 GAATTTATGGCCGGGCGCGGTGG + Intergenic
1005899262 6:30203702-30203724 GTATTCTCAGCCGGGCGCGGTGG - Intronic
1005915996 6:30351856-30351878 ACGTTGTCAGCCGGGTGCGGTGG - Intergenic
1006033922 6:31197507-31197529 GCAGTGACAGCCGAGCGCGGTGG - Intergenic
1006089164 6:31617809-31617831 GAATTTACAGCTGGGCGTGGTGG + Intergenic
1006317843 6:33300676-33300698 TTATTTGCAGCCGGGCGCGGTGG + Intronic
1006428580 6:33981551-33981573 TCACTTTCCGCCGGGTGCGGTGG - Intergenic
1006847899 6:37075628-37075650 GCATTTCCGGCCGGGCGCAGCGG - Intergenic
1006849508 6:37087591-37087613 GCAAGAACGGCCGGGTGCGGTGG - Intergenic
1006859905 6:37164677-37164699 GCATTTTCGGCCGGGCGCGGCGG + Intergenic
1007020133 6:38511627-38511649 GTATTTACAGCCAGGAGCGGTGG - Intronic
1007047095 6:38787436-38787458 ACATGTACTGCCGGGTGCAGTGG + Intronic
1007347201 6:41240538-41240560 GCATATGTGGCCGGGTGCGGTGG + Intergenic
1007555609 6:42763531-42763553 GTGTTTTCAGCTGGGTGCGGTGG + Intronic
1007724785 6:43908777-43908799 GGATTTAGGGCCGGGCGCGGTGG + Intergenic
1008514758 6:52308476-52308498 GGATTTCTGGCCGGGTGCGGTGG + Intergenic
1008787594 6:55188067-55188089 GCATTTATGGCCGGGTGTGGTGG - Intronic
1009419658 6:63450960-63450982 ACCATTACAGCCGGGTGTGGTGG - Intergenic
1009797614 6:68492052-68492074 ACAGATATAGCCGGGTGCGGTGG - Intergenic
1010213691 6:73383123-73383145 AGATTTACAGCCAGGTGTGGTGG - Intronic
1010233229 6:73553806-73553828 GCATATAAAGCTGGGTGCAGTGG - Intergenic
1010248209 6:73681888-73681910 GAATTTCCAGCCAGGTGCGGTGG - Intergenic
1010279255 6:74005053-74005075 CCATTAAAGGCCGGGTGCGGTGG + Intergenic
1010286880 6:74088933-74088955 GATTTTACAGCCGGGAGCAGTGG - Intergenic
1010603093 6:77855049-77855071 GCATTTAGGTCCGGGTGTGGTGG + Intronic
1010811748 6:80308866-80308888 AAATCTACGGCCGGGTGCGGTGG - Intronic
1010874404 6:81083830-81083852 GAATTCACAGCCGGGCACGGAGG - Intergenic
1011282137 6:85687872-85687894 GGATTTGCAGCCAGGTGTGGTGG - Intergenic
1011441528 6:87392019-87392041 TTATTTACAGCCGGGCACGGTGG - Intronic
1013112348 6:107074126-107074148 ATATTTATGGCCGGGTGCGGTGG + Intronic
1013120106 6:107133580-107133602 GGATGTTTAGCCGGGTGCGGTGG - Intergenic
1013243596 6:108268146-108268168 ACATTTACGGCCGGGCACGGTGG - Intergenic
1013350769 6:109303765-109303787 GCTTTGACAGCTGGGTGTGGTGG + Intergenic
1013360631 6:109390997-109391019 GCACTCTCAGCCGGGTGCGGTGG + Intronic
1013557477 6:111271086-111271108 GCAGTTGAGGCCGGGTGCGGTGG + Exonic
1013736150 6:113229340-113229362 GCATTTAAAGCAGTGTGCAGAGG + Intergenic
1013777246 6:113692106-113692128 GCAGCTACAGCCAGGTGCAGTGG - Intergenic
1014040365 6:116818245-116818267 GAATTTTCGGCCGGGCGCGGTGG + Intronic
1015154880 6:130081710-130081732 AAATATGCAGCCGGGTGCGGTGG - Intronic
1015226271 6:130860819-130860841 GCAGTAAGAGCCGGGCGCGGTGG - Intronic
1015410809 6:132891898-132891920 GCATTAAAGGCCGGGCGCGGTGG - Intergenic
1016229278 6:141782814-141782836 ACATTTCAAGCTGGGTGCGGTGG - Intergenic
1016318647 6:142818387-142818409 GCTTTTAAAGCCGGGCACGGTGG + Intronic
1016413899 6:143813330-143813352 TCAGATGCAGCCGGGTGCGGTGG + Intronic
1016457169 6:144243429-144243451 ACTTTTCCAGCCGGGTGCTGTGG - Intergenic
1017123930 6:151049066-151049088 GCATTCACAGCCGGGCACGGTGG + Intronic
1017460906 6:154649433-154649455 GCATTACCGGCCGGGCGCGGTGG + Intergenic
1017465629 6:154691216-154691238 GAATTGTCAGCCAGGTGCGGTGG + Intergenic
1017476586 6:154800071-154800093 GCAGTCACGGCCAGGTGCGGTGG - Intronic
1017517407 6:155169279-155169301 GCATTTGTGGCCGGGTGCTGTGG - Intronic
1017661390 6:156677552-156677574 GCATTCAAGGCCGGGCGCGGTGG - Intergenic
1017722406 6:157253133-157253155 GCATGGACAGCCGTGTGCTGTGG + Intergenic
1017752676 6:157502976-157502998 ACAAACACAGCCGGGTGCGGTGG - Intronic
1018164300 6:161078924-161078946 GCAGTTGGAGCCGGGTGCGGTGG + Intronic
1018254625 6:161905671-161905693 ACATTTTCGGCCGGGTGTGGTGG + Intronic
1018435706 6:163756817-163756839 GTATATACAGCCGGGCACGGTGG - Intergenic
1018688419 6:166322168-166322190 GAAGTTACGGCTGGGTGCGGTGG - Intronic
1019814083 7:3186655-3186677 TCATTCTCAGCCGGGCGCGGTGG + Intergenic
1019998627 7:4741616-4741638 ACATTTTCAGCCGTGCGCGGTGG - Intronic
1020029373 7:4921935-4921957 TCATTTCTGGCCGGGTGCGGTGG + Intronic
1020090866 7:5339855-5339877 GAACATACAGCCGGGTGTGGTGG - Intronic
1020160714 7:5769401-5769423 GCATTTGCGGCCAGGCGCGGTGG - Intronic
1020219078 7:6220706-6220728 ACATACACAGCCGGGCGCGGTGG + Intronic
1020244293 7:6418949-6418971 GTAGTTGCAGCCAGGTGCGGTGG - Intronic
1020263215 7:6543105-6543127 CCACTTCCGGCCGGGTGCGGTGG + Intronic
1020559048 7:9706244-9706266 GGATTTACAGCCAGGCACGGTGG - Intergenic
1020649913 7:10861496-10861518 GCATTTGCAGCCGGGCGTGGTGG - Intergenic
1020770084 7:12379805-12379827 GTACTTAAGGCCGGGTGCGGTGG + Intronic
1020863458 7:13524585-13524607 CAATTTTCAGCAGGGTGCGGTGG + Intergenic
1021344621 7:19509639-19509661 GCATTTCAGGCCGGGCGCGGTGG - Intergenic
1021460404 7:20880405-20880427 GCATTCAAGGCCGGGTGTGGTGG - Intergenic
1021797386 7:24270275-24270297 AAAATTACGGCCGGGTGCGGTGG + Intergenic
1022541422 7:31138943-31138965 ACATTTTGGGCCGGGTGCGGTGG - Intergenic
1022725083 7:32973977-32973999 GACTTTACAGCCAGGTGCAGTGG - Intronic
1022941082 7:35240035-35240057 GCATTTTTGGCCAGGTGCGGTGG - Intronic
1023216690 7:37870301-37870323 CCAATTTGAGCCGGGTGCGGTGG + Intronic
1023331679 7:39124330-39124352 GAATTGCCAGCTGGGTGCGGTGG - Intronic
1023635755 7:42208494-42208516 GCATTTACAGGCGGGAGCTGGGG - Intronic
1023918060 7:44605535-44605557 ACATTTGCAGCTGGGTGCAGTGG - Intergenic
1024259602 7:47563904-47563926 ACATTTAAGGCCGGGCGCGGTGG + Intronic
1024479028 7:49844968-49844990 GAATTGCCGGCCGGGTGCGGTGG - Intronic
1024726779 7:52207163-52207185 ACATATACGGCCGGGCGCGGTGG + Intergenic
1024731266 7:52256255-52256277 CCATTCACGGCCGGGCGCGGTGG - Intergenic
1024734179 7:52286700-52286722 CTATTCATAGCCGGGTGCGGTGG + Intergenic
1024800654 7:53073700-53073722 ACATTAGCGGCCGGGTGCGGTGG + Intergenic
1025048517 7:55713863-55713885 GACTTTACAGCCAGGTGCAGTGG + Intergenic
1025060756 7:55804544-55804566 AAAATTCCAGCCGGGTGCGGTGG - Intronic
1025166241 7:56714824-56714846 GCATTGCCAGCCGGGTGTGGTGG - Intergenic
1025226005 7:57163883-57163905 GCATTAAAGGCCGGGTGTGGTGG - Intergenic
1025702883 7:63836051-63836073 TCCTTTTCAGCCGGGTGCAGTGG - Intergenic
1025765015 7:64436084-64436106 GAAGATCCAGCCGGGTGCGGTGG - Intergenic
1025793324 7:64714821-64714843 GCAATTTCAGCCAGGTGCAGTGG - Intergenic
1025802186 7:64796753-64796775 ACATTTCCGGCGGGGTGCGGTGG + Intronic
1025902019 7:65752056-65752078 GCTTTTCCAGCCGGGTGCGGTGG - Intergenic
1025961790 7:66229395-66229417 CCAGTCTCAGCCGGGTGCGGTGG - Intronic
1026030137 7:66785585-66785607 GCCTTTGTGGCCGGGTGCGGTGG + Intronic
1026030546 7:66789393-66789415 GTATTTGAGGCCGGGTGCGGTGG + Intronic
1026237824 7:68544004-68544026 TCACATACAGCCGGGCGCGGTGG + Intergenic
1026250853 7:68669277-68669299 ACATTCTCGGCCGGGTGCGGTGG - Intergenic
1026285604 7:68960079-68960101 ACATTTTCGGCTGGGTGCGGTGG + Intergenic
1026317498 7:69239866-69239888 GGATCTACGGCCGGGTGTGGTGG - Intergenic
1026825786 7:73580490-73580512 TCTTTTAAGGCCGGGTGCGGTGG + Intergenic
1026920673 7:74153179-74153201 AAGTTTACAGCTGGGTGCGGTGG - Intergenic
1026981375 7:74528777-74528799 GGATATACAGCCGGGTGGGTGGG + Intronic
1027000347 7:74648651-74648673 GCATTTGCAGCCAGGTGCGGTGG - Intergenic
1027124343 7:75545352-75545374 GCTTTTCCAGCTGGGTGCAGTGG + Intronic
1027168870 7:75855746-75855768 CCGCTTACAGCCAGGTGCGGTGG + Intronic
1027396136 7:77756487-77756509 ACATTTATAGCTGGGTGTGGTGG + Intronic
1027611659 7:80368843-80368865 TCATTCACGGCCGGGCGCGGTGG + Intergenic
1027694261 7:81388967-81388989 CCACTTAGAGCCGGGCGCGGTGG - Intergenic
1027719911 7:81727328-81727350 TCAGTTTCGGCCGGGTGCGGTGG - Intronic
1028051379 7:86192055-86192077 CCATTTTCAGCCGGGCGCGGTGG - Intergenic
1028326425 7:89532292-89532314 ACATTTTCAGCCGGGCGTGGTGG + Intergenic
1028791886 7:94862801-94862823 ACATTTAGGGCCAGGTGCGGTGG + Intergenic
1029212475 7:98920181-98920203 AGATTTATGGCCGGGTGCGGTGG + Intronic
1029266000 7:99341019-99341041 GAATTTTAGGCCGGGTGCGGTGG + Intronic
1029415045 7:100437126-100437148 CCATTTATGGCCAGGTGCGGTGG - Intergenic
1029488859 7:100859426-100859448 GGTATGACAGCCGGGTGCGGTGG + Intronic
1029492633 7:100880590-100880612 GCCTATTCAGCCGGGTGCGGTGG - Intronic
1029625118 7:101715946-101715968 GCACTTGGAGCCGGGCGCGGTGG + Intergenic
1029843482 7:103389911-103389933 TGATTTCCAGCCGGGTGTGGTGG - Intronic
1029858469 7:103543356-103543378 GCCTTTAAGGCTGGGTGCGGTGG + Intronic
1030038192 7:105426045-105426067 TCATCTTCAGCCGGGTGCAGTGG + Intergenic
1030044925 7:105486338-105486360 ATATGTACAGCTGGGTGCGGTGG - Intronic
1030355230 7:108534796-108534818 CTATTTACAGCCCGGTGTGGTGG + Intronic
1030650288 7:112110029-112110051 GATTTTACGGCCGGGCGCGGTGG - Intronic
1030667586 7:112297212-112297234 AAATTTTCAGCCGGGTGCAGTGG - Intronic
1030867695 7:114719868-114719890 TCATTAAAGGCCGGGTGCGGTGG + Intergenic
1031312642 7:120217977-120217999 GCATTTACCGCTGGGCACGGTGG + Intergenic
1031367291 7:120918114-120918136 GCATGAAGGGCCGGGTGCGGTGG - Intergenic
1031404920 7:121373733-121373755 GTATTTATGGCCGGGTGCAGTGG + Intronic
1031824810 7:126550397-126550419 ACTTTTTCGGCCGGGTGCGGTGG - Intronic
1032031152 7:128484866-128484888 TGTATTACAGCCGGGTGCGGTGG - Intronic
1032144904 7:129370407-129370429 AAATTTGCAGCCGGGTGCGGTGG + Intronic
1032170852 7:129583366-129583388 GTAGGTACAGCCAGGTGCGGTGG - Intergenic
1032174751 7:129613608-129613630 CTCTTTACGGCCGGGTGCGGTGG + Intronic
1032182955 7:129697254-129697276 GCATAAATAGCCGGGCGCGGTGG + Intronic
1032199496 7:129809362-129809384 GTACTTTCAGCCGGGTGTGGTGG + Intergenic
1032234209 7:130105860-130105882 ACATTTAAGGCCGGGCGCGGTGG + Intronic
1032261335 7:130339638-130339660 AAATTAACAGCCGGGCGCGGTGG + Intergenic
1032302082 7:130696748-130696770 GCATTTTGGGCCGGGTGTGGTGG + Intergenic
1032370800 7:131349479-131349501 AGATTTAAGGCCGGGTGCGGCGG - Intronic
1032827218 7:135582745-135582767 GCATTATCAGCCAGGTGTGGTGG - Intronic
1032834987 7:135663929-135663951 GCATTTGGGGCCGGGCGCGGAGG - Intronic
1032966249 7:137101862-137101884 ACAATTATGGCCGGGTGCGGTGG - Intergenic
1033143172 7:138846245-138846267 GCAGTTTTGGCCGGGTGCGGTGG + Intronic
1033188577 7:139254004-139254026 GCTGTCACGGCCGGGTGCGGTGG + Intronic
1033198408 7:139347298-139347320 GCAGTTCAAGCCGGGTGTGGTGG + Intronic
1033335967 7:140452539-140452561 GAATTTATGGCTGGGTGCGGTGG - Intergenic
1033379405 7:140799137-140799159 GCAAAGGCAGCCGGGTGCGGTGG - Intronic
1034103279 7:148469400-148469422 GCATTTTTGGCCGGGTGCGGTGG + Intergenic
1034138724 7:148796813-148796835 GCATCTAGAGCAGGGTGCGGGGG - Intronic
1034156759 7:148961922-148961944 ACATTTCCAGCCAGGCGCGGTGG + Intergenic
1034616604 7:152423051-152423073 ACATTCCCAGCCGGGTGCGGTGG + Intronic
1034621186 7:152458369-152458391 GCATTTCCAGGCGGGGGCGGTGG + Intergenic
1035016248 7:155768898-155768920 GCAGTGACAGCCGGGTGCGGTGG - Intronic
1035190094 7:157159578-157159600 CCATTTGCAGCTGGGTGCGATGG + Intronic
1035395650 7:158533388-158533410 GGATTTGCAGCCAGATGCGGAGG - Intronic
1036134548 8:6148166-6148188 GCATTTTCTCCCGGGTTCGGGGG - Intergenic
1036476433 8:9097373-9097395 TCATTTAGGGCCAGGTGCGGTGG + Intronic
1036741166 8:11363016-11363038 GGCTTTCCAGCCAGGTGCGGAGG + Intergenic
1037336646 8:17798617-17798639 AATTTTCCAGCCGGGTGCGGTGG - Intronic
1037597386 8:20365670-20365692 TCTTTTACAGCCAGGTGCAGTGG + Intergenic
1037867805 8:22461129-22461151 AGATTTTCAGCTGGGTGCGGTGG - Intronic
1038196538 8:25373283-25373305 ACCTATCCAGCCGGGTGCGGTGG - Intronic
1038295005 8:26283519-26283541 TTATTTAAGGCCGGGTGCGGTGG - Intergenic
1038506737 8:28091191-28091213 ACATTTACGGCCGGGCGCGGTGG - Intronic
1038742562 8:30228147-30228169 ACATTGGCAGCCGGGAGCGGTGG + Intergenic
1038842514 8:31198202-31198224 CCAATCTCAGCCGGGTGCGGTGG - Intergenic
1038867876 8:31459158-31459180 ACATTTCCAGCTGGGCGCGGTGG - Intergenic
1039049070 8:33476521-33476543 GCATCTATGGCCGGATGCGGTGG + Intronic
1039161951 8:34631595-34631617 GGATTAGCAGCTGGGTGCGGTGG - Intergenic
1039381461 8:37089394-37089416 CCATTTTCGGCCGGGTGCAGTGG - Intergenic
1039410286 8:37349207-37349229 GCATTTGGGGCCGGGCGCGGTGG - Intergenic
1039504153 8:38039689-38039711 GCATTTAGGGCCAGGTGCAGTGG - Intronic
1039561329 8:38514521-38514543 CCCTTTACGGCCGGGTGCTGTGG + Intronic
1039591682 8:38755413-38755435 GCATTCCCAGCTGGGTGTGGTGG + Intronic
1039740330 8:40377084-40377106 GTATTTTCAGCCAGGTGCTGTGG - Intergenic
1039993266 8:42508184-42508206 GCATCTTCAGCCAGGTGCAGTGG + Intronic
1040000632 8:42573422-42573444 GACTTTCCAGCCGGGCGCGGTGG + Intergenic
1040039941 8:42905796-42905818 AAATTTTCAGCCAGGTGCGGTGG + Intronic
1040355232 8:46610846-46610868 ACATTTAAAGCCGGGTGTAGAGG + Intergenic
1040454057 8:47578183-47578205 ACATAATCAGCCGGGTGCGGTGG + Intronic
1040478754 8:47804585-47804607 GCATGTCCAGCCGGGTGCAGTGG - Intronic
1040812547 8:51471975-51471997 ACATTTCCGGCCGGGCGCGGTGG - Intronic
1041298728 8:56388995-56389017 GCATTTAAGGTTGGGTGCGGTGG + Intergenic
1041323053 8:56634646-56634668 TCATTTAAGGTCGGGTGCGGTGG - Intergenic
1041712183 8:60904837-60904859 GTATCTACAGCCGGGCACGGTGG + Intergenic
1042318116 8:67445975-67445997 TCATTTACGGCCGGGGGCGGTGG + Intronic
1043431715 8:80201570-80201592 GCCATTACGGCCGGGCGCGGTGG + Intronic
1044509856 8:93062009-93062031 CAATTTATAGCCGGATGCGGTGG - Intergenic
1044647692 8:94461454-94461476 GTATTTATGGCCGGGTGTGGTGG - Intronic
1044754162 8:95444568-95444590 GCATTTCCAGCCAGGCGCAGTGG + Intergenic
1044833570 8:96274436-96274458 GAAAAAACAGCCGGGTGCGGCGG + Intronic
1044937693 8:97308911-97308933 AAATTCACAGCCGGGTGTGGTGG - Intergenic
1044991201 8:97797418-97797440 GTAATTCCAGCCGGGCGCGGTGG - Intronic
1045240276 8:100394445-100394467 GCACTTGCAGCCGGGCACGGTGG + Intronic
1045444330 8:102244263-102244285 GTATTAATAGCCGGGTGCCGTGG - Intergenic
1045479545 8:102581176-102581198 ACATTTACAGCTGGGTATGGTGG - Intergenic
1045489778 8:102659266-102659288 ACATTTGCAGCCAGGCGCGGTGG + Intergenic
1045507218 8:102787391-102787413 CCACAGACAGCCGGGTGCGGTGG - Intergenic
1046775925 8:118163586-118163608 GGAGCTTCAGCCGGGTGCGGTGG + Intergenic
1046891892 8:119431139-119431161 CCATGTCCAGCCAGGTGCGGTGG + Intergenic
1046912992 8:119649104-119649126 GCATTTATGGCCGGGCACGGTGG + Intronic
1047010723 8:120669737-120669759 GCATTTTCGGCCGGGCGCGGTGG - Intronic
1047277259 8:123415878-123415900 GTGTTTAGGGCCGGGTGCGGTGG - Intronic
1047742927 8:127821521-127821543 AAAATTACTGCCGGGTGCGGTGG + Intergenic
1047761210 8:127955869-127955891 GATATTACAGCCGGGTGTGGTGG - Intergenic
1048272682 8:133042072-133042094 ACACTGACAGCCGGGTGTGGTGG - Intronic
1048477356 8:134755522-134755544 GGATTTCCTGCCTGGTGCGGTGG + Intergenic
1048850709 8:138642741-138642763 ACAATTCTAGCCGGGTGCGGTGG + Intronic
1048855429 8:138682984-138683006 GCATGTAGGGCCGGGTGCGGTGG - Intronic
1049045187 8:140144772-140144794 ACAATTAAAGCTGGGTGCGGTGG - Intronic
1049082492 8:140454349-140454371 GCATAATCAGCCGGGTGTGGTGG + Intronic
1049497055 8:142940824-142940846 CCACTTCCAGCCGGGAGCGGTGG - Intergenic
1049528149 8:143139722-143139744 GATTTTAGGGCCGGGTGCGGTGG - Intergenic
1049739982 8:144234293-144234315 GGAACTACAGCCGGGCGCGGTGG - Intronic
1049750980 8:144283828-144283850 GCATTGATGGCCAGGTGCGGCGG + Intronic
1049800032 8:144513419-144513441 GCATGTGCAGCCGGGAACGGCGG - Exonic
1049844712 8:144794240-144794262 TTATTTCCGGCCGGGTGCGGTGG + Intergenic
1049954494 9:679692-679714 AAATTTTCAGCTGGGTGCGGTGG - Intronic
1050374483 9:4956800-4956822 GAATTTGCGGCCGGGCGCGGTGG + Intergenic
1050779751 9:9317882-9317904 ATTTTTCCAGCCGGGTGCGGTGG + Intronic
1051226385 9:14903832-14903854 ACATTTCTGGCCGGGTGCGGTGG + Intronic
1051611128 9:18962353-18962375 CCAATGAGAGCCGGGTGCGGTGG - Intronic
1051620551 9:19045872-19045894 TCTTTTACTGCCGGGCGCGGTGG + Intronic
1051632863 9:19156444-19156466 TCATTGACAGCCAGGCGCGGTGG + Intergenic
1051682903 9:19625972-19625994 GGATTTCCAGCAGGGCGCGGTGG - Intronic
1051967970 9:22852230-22852252 CCTATTCCAGCCGGGTGCGGTGG + Intergenic
1052246405 9:26341005-26341027 GCTTTTTCAGCCGGGTACAGTGG - Intergenic
1052775183 9:32726067-32726089 TCATCTTCAGCCGGGCGCGGTGG - Intergenic
1052776874 9:32741188-32741210 GCATTTTGGGCCGGGTGTGGTGG - Intergenic
1052814935 9:33095013-33095035 GCATTTAGGGCTGGGCGCGGTGG + Intergenic
1052934990 9:34085542-34085564 TCATTGTCAGCCGGGTGCAGTGG - Intergenic
1052946724 9:34174332-34174354 ACATTATCAGCCCGGTGCGGTGG + Intergenic
1052966839 9:34346823-34346845 CAACTTACAGCCGGGCGCGGTGG - Intergenic
1053133147 9:35630323-35630345 ACTTTAGCAGCCGGGTGCGGTGG - Intronic
1053223289 9:36329291-36329313 AAATTTATAGCCGGGTGCGGTGG + Intergenic
1053247381 9:36545749-36545771 GAAATTGGAGCCGGGTGCGGTGG - Intergenic
1053248297 9:36553395-36553417 ACATACACAGCCGGGCGCGGTGG + Intergenic
1053530526 9:38876961-38876983 CAATTTAGGGCCGGGTGCGGTGG + Intergenic
1053549664 9:39062671-39062693 CCTTTTTCAGCCGGGCGCGGTGG - Intergenic
1053856958 9:42347803-42347825 TCATTTGAGGCCGGGTGCGGTGG + Intergenic
1054202751 9:62101391-62101413 CAATTTAGGGCCGGGTGCGGTGG + Intergenic
1054568338 9:66782950-66782972 TCATTTGAGGCCGGGTGCGGTGG - Intergenic
1054635613 9:67486974-67486996 CAATTTAGGGCCGGGTGCGGTGG - Intergenic
1054782672 9:69179784-69179806 TCACTTTCAGCCGGGCGCGGTGG - Intronic
1054993011 9:71352160-71352182 TCATTTCCAGCCGGGTGCAGTGG - Intronic
1055412074 9:76041552-76041574 GAATTTATGGCCAGGTGCGGTGG + Intronic
1055529338 9:77168262-77168284 GCTGTTAGGGCCGGGTGCGGTGG + Intergenic
1055539091 9:77282642-77282664 GTATTGTCAGCTGGGTGCGGTGG + Intronic
1055930664 9:81556640-81556662 GAATGAACAGCCGGGTGCAGTGG + Intergenic
1056039985 9:82655084-82655106 GCATATATGGCCGGGCGCGGTGG - Intergenic
1056171120 9:83985719-83985741 GCACATACGGCCGGGCGCGGTGG + Intronic
1056318553 9:85415171-85415193 GCATTTACAGCATGGTGAGAGGG + Intergenic
1056524162 9:87427196-87427218 GAATTTAAAGCTGGGCGCGGTGG - Intergenic
1056919905 9:90778199-90778221 GGATTTTCAGCCGGGTGCGGTGG + Intergenic
1057156343 9:92843427-92843449 ACCTTTACAGCCAGGCGCGGTGG - Intergenic
1057358691 9:94353763-94353785 AAAGTTACGGCCGGGTGCGGAGG + Intergenic
1057588800 9:96353631-96353653 TCATTTTCAGCCCAGTGCGGTGG - Intronic
1057591244 9:96375288-96375310 GTACTGACAGCCGGGTGCAGTGG + Intronic
1057616818 9:96599090-96599112 GTACTTAGAGCCGGGTGTGGTGG + Intronic
1057624326 9:96664119-96664141 GCAGTTAGGGCCGGGCGCGGTGG - Intergenic
1057668309 9:97064297-97064319 GAATTCACAGCTGGGTGTGGTGG - Intergenic
1057831668 9:98411859-98411881 GATTTTGCAGCCGGGTGCAGTGG - Intronic
1057993406 9:99797113-99797135 ACATTGACGGCCGGGCGCGGTGG + Intergenic
1058038016 9:100274068-100274090 GATTTTAAAGCTGGGTGCGGTGG + Intronic
1058038891 9:100283019-100283041 TCCTTTTCAGCCGGGCGCGGTGG + Intronic
1058411894 9:104742175-104742197 ACATTTCCCGCCGGGCGCGGTGG - Intergenic
1058655204 9:107214071-107214093 GCATGTGTGGCCGGGTGCGGTGG + Intergenic
1058697473 9:107571858-107571880 CCATCTCCAGCCGGGTGCGGTGG - Intergenic
1058904243 9:109468651-109468673 GTATTCACAGCCGGGCGCGGTGG - Intronic
1058906781 9:109488385-109488407 GTACTTTCAGCCTGGTGCGGTGG - Intronic
1059113042 9:111575011-111575033 GCATTTTCGGCCGGGCACGGTGG + Intronic
1059151270 9:111951721-111951743 GCAGCTACTGCCGGGCGCGGTGG - Intergenic
1059204305 9:112449574-112449596 TCATTTTAGGCCGGGTGCGGTGG + Intronic
1059915670 9:119096815-119096837 GTTATTTCAGCCGGGTGCGGTGG - Intergenic
1060110192 9:120901480-120901502 GTATTTGCAGCTGGGTGTGGTGG - Intergenic
1060118432 9:120965234-120965256 GCAGTCCCAGCTGGGTGCGGTGG + Intronic
1060125419 9:121039922-121039944 GCATTCAAGGCCGGGCGCGGTGG - Intronic
1060380342 9:123164332-123164354 GTATTTCTGGCCGGGTGCGGTGG - Intronic
1060628220 9:125132679-125132701 GCATTCTCAGGCTGGTGCGGTGG + Intronic
1060963268 9:127696569-127696591 ACATTATCATCCGGGTGCGGAGG + Intronic
1060970763 9:127736330-127736352 GTATTTCCGGCCAGGTGCGGTGG + Intergenic
1061021149 9:128015717-128015739 GTATTTGCAGCTGGGTGTGGTGG - Intergenic
1061146010 9:128798999-128799021 TCATTTCCAGCTGGGTGTGGTGG - Intronic
1061146267 9:128800872-128800894 GCATTGTCAGCCAAGTGCGGTGG + Intronic
1061314146 9:129783762-129783784 GCAGTCACAGCTGGGTGCGGTGG - Intergenic
1061419439 9:130465304-130465326 GCTACTACAGCCGGGTGCAGTGG - Intronic
1061538672 9:131265671-131265693 TTGTTTACAGCCAGGTGCGGTGG - Intronic
1061580299 9:131531836-131531858 GGATTTCCAGCCGGGCGCGGTGG + Intergenic
1061723479 9:132568265-132568287 GCATATACAGCTGGGCGCTGTGG + Intronic
1061978577 9:134086593-134086615 GGATTTGTGGCCGGGTGCGGTGG - Intergenic
1062153844 9:135035051-135035073 GGATTACCAGCCGGGTGTGGTGG + Intergenic
1062469240 9:136695135-136695157 TCATTTCCAGCCGGGCGCAGTGG + Intergenic
1062485427 9:136772438-136772460 TGATCTACAGTCGGGTGCGGTGG + Intergenic
1062506340 9:136879240-136879262 TCCATTACAGCCGGGTGCCGTGG + Intronic
1062530864 9:136999317-136999339 CCTATTTCAGCCGGGTGCGGTGG - Intergenic
1062659775 9:137623706-137623728 ACATTTGCGGCCGGGTGCGGAGG - Intronic
1062660603 9:137629815-137629837 CTATTCTCAGCCGGGTGCGGTGG - Intronic
1185512369 X:673200-673222 GCACTACCAGCCGGATGCGGTGG + Intergenic
1185561464 X:1063435-1063457 ACACTTAGGGCCGGGTGCGGTGG + Intergenic
1185578586 X:1193098-1193120 ACATTAACAGCCGGGCGCAGTGG - Intronic
1185644104 X:1604875-1604897 GAAATTTCAGCCGGGCGCGGTGG - Intergenic
1185702274 X:2240003-2240025 GGATGTACAGCTGGGCGCGGTGG + Intronic
1186067904 X:5786204-5786226 AAATATACAGCCGGGCGCGGTGG + Intergenic
1186193773 X:7091626-7091648 CCATTTAAGGCCGGGCGCGGTGG - Intronic
1186262860 X:7799320-7799342 GTATATATAGCCGGGCGCGGTGG + Intergenic
1186328919 X:8511567-8511589 CAATGAACAGCCGGGTGCGGTGG + Intergenic
1186473397 X:9838345-9838367 TGATTTAAGGCCGGGTGCGGTGG - Intronic
1186686446 X:11929818-11929840 GCACCATCAGCCGGGTGCGGTGG + Intergenic
1186747791 X:12587260-12587282 GCATTAAAGGCCAGGTGCGGTGG - Intronic
1187022718 X:15401022-15401044 AGATTTACAGCAGGGCGCGGTGG - Intronic
1187140946 X:16593140-16593162 GAATTCCCAGCCAGGTGCGGTGG + Intronic
1187158656 X:16744543-16744565 CCTTTTTCAGCTGGGTGCGGTGG + Intronic
1187858172 X:23656979-23657001 ACTTTTACAGCCGGCTGCAGTGG + Intergenic
1187861628 X:23689006-23689028 GAAAATACAGCCGGGCGCGGTGG + Intergenic
1187861941 X:23691350-23691372 ACTTTTACAGCTGGGTGCAGTGG + Intergenic
1187872117 X:23773119-23773141 ACATTATCAGCTGGGTGCGGTGG - Intergenic
1187901649 X:24031875-24031897 GCAGTGATGGCCGGGTGCGGTGG + Intergenic
1188912244 X:35864408-35864430 GAGTTTCCAGCCGGGCGCGGTGG + Intergenic
1188913050 X:35874030-35874052 ACATTTAAAGCCGGATGTGGTGG - Intergenic
1189281241 X:39821332-39821354 GTAATTACAGCGGGGCGCGGGGG - Intergenic
1189442583 X:41050288-41050310 ACATTTTCAGCCAGGTGCGGTGG - Intergenic
1189612481 X:42752175-42752197 GAAATTAAGGCCGGGTGCGGTGG + Intergenic
1189810120 X:44773911-44773933 GAATTTCCAGCCGGGCGCGGTGG - Intergenic
1189813158 X:44799299-44799321 AAATTTACAGCCGGGCACGGTGG + Intergenic
1189820935 X:44869897-44869919 GCCTTATAAGCCGGGTGCGGTGG - Intergenic
1190007622 X:46755541-46755563 GCTATTACAGCCGGGTGCGGTGG + Intronic
1190093667 X:47462013-47462035 GTTTTTACAGCTGGGTGCTGTGG - Intronic
1190271730 X:48869528-48869550 GAATTTTCTGCCGGGTGCGGTGG + Intergenic
1190280330 X:48924989-48925011 GCTCCTTCAGCCGGGTGCGGTGG + Intronic
1190419207 X:50211374-50211396 AACATTACAGCCGGGTGCGGTGG + Intronic
1190832774 X:54074111-54074133 GCAGTGTCAGCCAGGTGCGGTGG - Intronic
1190859087 X:54326696-54326718 GAAATTATAGCCGGGTGCAGTGG + Intronic
1190942309 X:55053926-55053948 CTATTTTCAGCCAGGTGCGGTGG + Intergenic
1191053356 X:56217704-56217726 CAATTGACAGCCGGGTGCGGTGG - Intergenic
1191123594 X:56931177-56931199 GAAACTACAGCGGGGTGCGGTGG - Intergenic
1191818962 X:65281511-65281533 GCCTATACAGCCAGGTGCAGTGG - Intergenic
1192403911 X:70864448-70864470 GAATTTTCAGCGGGGTGCAGTGG + Intronic
1192427937 X:71093897-71093919 AAATTTATAGCCAGGTGCGGTGG + Intergenic
1192470637 X:71395868-71395890 ACATTTGCAGCCGGGTGTGGTGG + Intronic
1192476686 X:71450057-71450079 ATATTTAGAGCCGGGTGTGGTGG - Intronic
1192581072 X:72282033-72282055 GCTTTACCAGCCAGGTGCGGTGG + Intronic
1192798186 X:74441939-74441961 GAATTTGCAGCCGGGTGCCATGG + Intronic
1192890362 X:75384027-75384049 ACATTTCTGGCCGGGTGCGGTGG - Intronic
1193116549 X:77781152-77781174 AAATTAACAGCCGGGCGCGGTGG + Intronic
1193889789 X:87031148-87031170 GAATTTCCAGCCAGGTGCGGTGG - Intergenic
1193954755 X:87845698-87845720 ACATTTATGGCCGGGCGCGGTGG + Intergenic
1194036097 X:88874152-88874174 GCATTTTGGGCCGGGTGCGGTGG - Intergenic
1194150192 X:90315821-90315843 ACATTTACGGCCGGGCGCGGTGG + Intergenic
1194441826 X:93942724-93942746 GCATTCAAAGCAGGGTGCAGAGG + Intergenic
1194588934 X:95772642-95772664 AAATTGTCAGCCGGGTGCGGTGG + Intergenic
1194824040 X:98539986-98540008 TCAATTACAGCTGGGTGCGGTGG + Intergenic
1194895806 X:99438020-99438042 CCACTTACGGCCGGGTGCAGTGG + Intergenic
1195232610 X:102865781-102865803 GCATATAGGGCCGGGTGTGGTGG - Intergenic
1195933362 X:110102036-110102058 GAATTTCCAGCTGGGTGCAGTGG + Intronic
1196260564 X:113575658-113575680 CCATTCACAGCTGGGCGCGGTGG + Intergenic
1196370093 X:114968126-114968148 TTATTTGCAGCCGGGTGTGGTGG + Intergenic
1196971656 X:121116246-121116268 ACATTTAAGGCCGGGTGCGGTGG + Intergenic
1196980841 X:121211852-121211874 ACATTCTCAGCCGGGCGCGGTGG - Intergenic
1197238440 X:124095212-124095234 AAATTATCAGCCGGGTGCGGTGG - Intronic
1197763604 X:130044794-130044816 GGATTTACTGCTGGGCGCGGTGG - Intronic
1197807554 X:130412211-130412233 ACATTCACAGCCGGGTGCGGTGG - Intronic
1198132954 X:133717247-133717269 GCAACTATAGCCAGGTGCGGTGG - Intronic
1198146881 X:133866908-133866930 TCATTTACAGCCAAGTGCAGTGG + Intronic
1198238165 X:134756560-134756582 ACATTTTCGGCCGGGCGCGGTGG + Intronic
1199644477 X:149893110-149893132 TCATTTTCAGCCAGGTGCAGTGG + Intergenic
1200171855 X:154082537-154082559 GCATTTTCGGCCGGGTGTGGTGG - Intronic
1200223921 X:154406255-154406277 AATTCTACAGCCGGGTGCGGTGG - Intronic
1200473683 Y:3618978-3619000 GCATTCACAGCTTGGTGAGGTGG - Intergenic
1200748502 Y:6923352-6923374 CCATTCACAGCCGGGCGCGGTGG - Intronic
1200803601 Y:7409856-7409878 GAATTCTCAGCCGGGTGTGGTGG + Intergenic
1201388360 Y:13468386-13468408 GAATTTCAGGCCGGGTGCGGTGG + Intronic
1201507711 Y:14722578-14722600 GCATTTCCGGCCGGGCGCGGTGG + Intronic
1201704713 Y:16923843-16923865 ACATTTATGGCCGGGTGCAGTGG + Intergenic