ID: 1127623994

View in Genome Browser
Species Human (GRCh38)
Location 15:60762442-60762464
Sequence CTTTCACCATAGATGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127623994_1127624000 2 Left 1127623994 15:60762442-60762464 CCTTGCCCCATCTATGGTGAAAG 0: 1
1: 0
2: 1
3: 13
4: 145
Right 1127624000 15:60762467-60762489 CACCAGAATTCAGAGAAAGGAGG 0: 1
1: 1
2: 1
3: 26
4: 282
1127623994_1127623999 -1 Left 1127623994 15:60762442-60762464 CCTTGCCCCATCTATGGTGAAAG 0: 1
1: 0
2: 1
3: 13
4: 145
Right 1127623999 15:60762464-60762486 GGTCACCAGAATTCAGAGAAAGG 0: 1
1: 0
2: 2
3: 21
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127623994 Original CRISPR CTTTCACCATAGATGGGGCA AGG (reversed) Intronic
900820275 1:4881300-4881322 CCTTCCCCATAGATGGCACAGGG + Intergenic
904288563 1:29469424-29469446 CTTTCACCATAAATAGGGTTGGG + Intergenic
904831387 1:33308125-33308147 CTTTCAACTTAGATGGGGCAGGG + Intronic
906104510 1:43283929-43283951 CTTTCAACTTAGAAGGGCCAGGG - Intronic
906295227 1:44645415-44645437 CTTTCACCATTGCTGGTGGATGG - Exonic
907051641 1:51333614-51333636 CTCCCTCCATAGATGGGTCAGGG + Intronic
907252523 1:53150456-53150478 ATTTCACCAAAGAGGAGGCATGG - Intergenic
907911215 1:58828328-58828350 ATTTTTCCATAGATGGGGCAGGG - Intergenic
910157572 1:84236469-84236491 CTTTCCTCATTGATGAGGCATGG - Exonic
910288179 1:85577019-85577041 CTTTCACCAAATATGGGCCGGGG + Intronic
913173556 1:116253959-116253981 ATTTTTCCATGGATGGGGCAAGG - Intergenic
916505807 1:165427372-165427394 ATTCCAACATTGATGGGGCAAGG - Intronic
917205622 1:172568141-172568163 GTTTTCCCATGGATGGGGCAGGG - Intronic
1067844949 10:49712295-49712317 TTTTCTCCATAGATGGGGGGAGG - Intergenic
1069956410 10:72054526-72054548 CCTTCACCATAAATGGGTAAAGG + Intergenic
1070558656 10:77549350-77549372 CTCTCTCCCTAGATGGGGAAGGG + Intronic
1071920378 10:90342957-90342979 CTTTAACCATAGGTTTGGCAGGG + Intergenic
1073443318 10:103565422-103565444 CTCTCTCCATACCTGGGGCAGGG + Intronic
1075240908 10:120777564-120777586 CTTTAACCAGAGACGAGGCAAGG - Intergenic
1078820697 11:14878129-14878151 CTTTCAGCACAGATGAGGTAGGG + Exonic
1084175225 11:67419356-67419378 ATTGCCCCAGAGATGGGGCAGGG - Intronic
1087854843 11:103079227-103079249 GTTTTACCATGGATGGGGCTGGG - Intronic
1089301940 11:117504214-117504236 CTTGCATCAGAGCTGGGGCAAGG - Intronic
1094399312 12:30044543-30044565 CTTGGACTAGAGATGGGGCAAGG + Intergenic
1096755297 12:53794312-53794334 CTTTCCTAATAGATGGGGCAGGG + Intergenic
1098167402 12:67712268-67712290 CTTTCACTATATATGTGGAATGG + Intergenic
1102999763 12:117376347-117376369 CTTTCAGCCTGGAAGGGGCACGG + Intronic
1103587441 12:121966561-121966583 CTTTGGTCATGGATGGGGCATGG - Intronic
1103738702 12:123077409-123077431 CGTGCGCCCTAGATGGGGCAGGG - Intronic
1104147397 12:126048519-126048541 CTTACAACATAGATGAAGCAAGG + Intergenic
1104154032 12:126113497-126113519 TTTTCACCTTAGATGGAACAAGG + Intergenic
1104451214 12:128869463-128869485 ATTTCAAAATAGATGGGGCTGGG - Intronic
1104812898 12:131629047-131629069 CTCTGACCACAAATGGGGCACGG - Intergenic
1107319065 13:39166532-39166554 CTTCCACCCTGGAAGGGGCATGG - Intergenic
1108487138 13:50938536-50938558 ATTTTTCCATGGATGGGGCAGGG + Intronic
1108715686 13:53075718-53075740 TCATCACCATAGAGGGGGCAGGG - Intergenic
1109527491 13:63596119-63596141 CTTTCATCAGAGAGGGGACATGG + Intergenic
1111288922 13:86136033-86136055 CTTTGACCAAAGAAGGGCCATGG + Intergenic
1111849769 13:93557966-93557988 CATTCTCCATAGTTGGGGAAGGG + Intronic
1111925729 13:94461495-94461517 CTTCCACCACAGGTTGGGCATGG - Intronic
1112640984 13:101274954-101274976 GTTCCAGCAGAGATGGGGCAAGG + Intronic
1112839409 13:103558025-103558047 CTGTCACCATAGTGGGAGCATGG + Intergenic
1114344224 14:21778793-21778815 CTTTCATAATAAATGGGGAAGGG - Intergenic
1118012754 14:61626678-61626700 CTTTCACGATGGATGGAGAATGG - Intronic
1119567621 14:75641957-75641979 GTGGCAACATAGATGGGGCAGGG + Intronic
1122158805 14:99768102-99768124 CTTCTCCCAGAGATGGGGCACGG + Intronic
1127623994 15:60762442-60762464 CTTTCACCATAGATGGGGCAAGG - Intronic
1129047921 15:72753225-72753247 CTCTTACCACTGATGGGGCATGG + Intronic
1129242455 15:74259586-74259608 CCTTCATATTAGATGGGGCAGGG + Intronic
1130402903 15:83573965-83573987 CTTTCAGCCTGGATGGGTCAGGG + Intronic
1130422765 15:83764632-83764654 CCTGCACGCTAGATGGGGCAAGG - Intronic
1132343061 15:101090165-101090187 TTTTCACCATGGCTGGGGAAAGG - Intergenic
1138343482 16:56306128-56306150 CTTTCAACAAAGAGGGAGCAGGG - Intronic
1139585317 16:67899107-67899129 CTTTCCCCAGAAATGGGGCTAGG + Intronic
1143066066 17:4248420-4248442 GTTTGTCCATAGATGGGGTAGGG - Intronic
1148351934 17:46947363-46947385 GTTTCACCAGATCTGGGGCAGGG - Intronic
1149102619 17:52924282-52924304 CTTTCAGCAAAATTGGGGCATGG + Intergenic
1150442836 17:65204871-65204893 GTCTCACCAGAGATGGGGCTGGG + Intronic
1158014438 18:52766887-52766909 CTTTTACCATTGATGGGGACAGG - Intronic
1158095924 18:53770862-53770884 CTATCACCAAAGATAGGCCAAGG + Intergenic
1158841242 18:61390089-61390111 CTTTGACAATAGATGGGGTGGGG - Intronic
1161564291 19:4991261-4991283 ATTTCACCACAGATGGGGGTAGG - Intronic
1163090023 19:15012991-15013013 CTTTCACCACAGACGAGGCCTGG - Intronic
1163389480 19:17021726-17021748 CTTTGACCAGAGGTGGGACAGGG - Intronic
1164386244 19:27773027-27773049 CGTTGACCATAGACAGGGCAAGG - Intergenic
1165385705 19:35509679-35509701 CTTATACCACAGATGGGGCTGGG - Intronic
1167979996 19:53267392-53267414 CTATCTCCATAGAGTGGGCAGGG - Exonic
1167985889 19:53315391-53315413 CTATCTCCATAGAGTGGGCAGGG + Intergenic
927205881 2:20609946-20609968 CTATCACCAAAGGTGGGGCATGG + Intronic
929547744 2:42866677-42866699 CTTCCTCCAGAGATGGGGCAGGG + Intergenic
932088906 2:68787508-68787530 GTTTCAGCATAGATGAGACAGGG - Intronic
932341793 2:70967266-70967288 ATTTCACTGTAGATGGGGCAGGG - Intronic
932973211 2:76571056-76571078 CTCTCAGCACAGATTGGGCAGGG + Intergenic
933056998 2:77683133-77683155 ATTTTTCCACAGATGGGGCACGG + Intergenic
933254024 2:80060287-80060309 CTCTCACCATAGATGGCTAAAGG + Intronic
933927130 2:87104276-87104298 ATTTTTCCACAGATGGGGCACGG + Intergenic
934937001 2:98472803-98472825 CTTGCAGCTTAGCTGGGGCATGG + Intronic
936401547 2:112168377-112168399 CTTGAAGCATAGATGGGGCCTGG + Intronic
937060149 2:118974793-118974815 CCTTCATCCTAGATGGGGCTGGG + Intronic
937637318 2:124170709-124170731 CTTTCACCATAGAGGCAGCCAGG - Intronic
942993249 2:182228707-182228729 CTTTTACCATAGATGGAGAAAGG - Intronic
943071598 2:183147417-183147439 CTTACTCAATAGATGGTGCAAGG - Intronic
943221327 2:185110405-185110427 CTTTCACAATAGAAAAGGCATGG + Intergenic
945415392 2:209564630-209564652 CCTTCCCCATAGATGGTGCTGGG + Intronic
945670873 2:212801408-212801430 CTGTCACTATAGATCAGGCAAGG - Intergenic
1171436277 20:25126973-25126995 CTTCCATCATGGAAGGGGCAGGG + Intergenic
1175399767 20:58693432-58693454 CTTCCACCAGAGAGGGGGCAGGG - Intronic
1182491251 22:30673478-30673500 CGTACACCTTAGGTGGGGCAAGG + Intergenic
1183859930 22:40662426-40662448 CTTCCATCATAGAAGGGGTAGGG + Intergenic
1184016068 22:41786637-41786659 CAGTCACCATGGCTGGGGCATGG + Intronic
1184757075 22:46522861-46522883 ATTTCACCAGAGATGAGGCCTGG - Intronic
949419412 3:3849958-3849980 TTTTCACCATTGGTGGGGTAGGG + Intronic
950532008 3:13557684-13557706 CTGTCACTGTGGATGGGGCAGGG + Intronic
950734408 3:14993788-14993810 CTTTTACCTGAGAGGGGGCATGG - Intronic
952976338 3:38699413-38699435 CCTCCACCAAAGATGAGGCAAGG + Intronic
954703753 3:52467365-52467387 CCTTCAGCACAGATGGGGTAGGG + Intronic
957278882 3:78124732-78124754 CTTACACTATTGATGGGACATGG + Intergenic
959378408 3:105612932-105612954 GTTTCTCCAGAGATGGGGCTGGG - Intergenic
960415452 3:117380038-117380060 GCTTCACCATGCATGGGGCATGG - Intergenic
961925803 3:130478939-130478961 CTTTCACAATAGTTGGGAAATGG - Intronic
964196118 3:154066794-154066816 CTTTTACCAAAGAAGGGTCATGG - Intergenic
965490038 3:169324105-169324127 ATTTCACCAGAGTAGGGGCATGG + Intronic
966371255 3:179252678-179252700 CTACCACCAGAGAAGGGGCATGG + Intronic
968451081 4:676336-676358 CTTCCACCAGAGGTGGGGCGGGG + Intronic
968741927 4:2335463-2335485 CTGTCACCCTAGATAGGGCAAGG - Intronic
974189911 4:58491385-58491407 TTTCCAGCATAGCTGGGGCATGG + Intergenic
978674025 4:111288066-111288088 CTTTTACCATAGCTGGGGAATGG - Intergenic
981034654 4:140156879-140156901 CTTTCCCCACATCTGGGGCATGG - Intergenic
982099203 4:151952141-151952163 CTTTCAGCAGAGATGGGTTAAGG + Intergenic
984072815 4:175136671-175136693 TTTTCACCATAGAGGGGAAAAGG + Intergenic
984228472 4:177064670-177064692 TTTTCTCCATAGATGAGACAGGG - Intergenic
984793732 4:183638302-183638324 CTTTAACCATAAATTTGGCAGGG - Intergenic
985819321 5:2148876-2148898 CGTGGACCACAGATGGGGCAGGG - Intergenic
985887315 5:2689634-2689656 ATTTTTCCATAGATGGGGCAAGG - Intergenic
986835417 5:11631712-11631734 CTTCCACCATACATAGGGCCTGG - Intronic
987970667 5:24939684-24939706 CATTCACCTTAGATGTGGAAGGG + Intergenic
990510367 5:56484105-56484127 CATTGACCATGGATGGGGCTGGG - Intergenic
991066235 5:62427759-62427781 ATTTTTCCACAGATGGGGCAGGG - Intronic
991262969 5:64686599-64686621 CTCTCACCATAGTTGTTGCATGG + Intergenic
996814183 5:127556234-127556256 ATTTGACCATATTTGGGGCAGGG + Intergenic
997253347 5:132408532-132408554 CCTTCTCCCTAGATGGGGCCTGG - Intergenic
1008745758 6:54667787-54667809 CTTTCAGCAGAGAGGGGACATGG - Intergenic
1019275449 7:173269-173291 CTGTGTCCACAGATGGGGCAGGG + Intergenic
1020822555 7:12988642-12988664 ATTTCACCAGAGCTGGGGTAGGG - Intergenic
1021339076 7:19440675-19440697 CTTTCAAGATTGGTGGGGCAAGG - Intergenic
1021496554 7:21281205-21281227 GTTTCACCATAGGCTGGGCAAGG - Intergenic
1023166859 7:37351449-37351471 CTTTCCCCATGGAGGGAGCATGG - Intronic
1024328767 7:48135553-48135575 TTTCCAGCATAGCTGGGGCATGG + Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1026933757 7:74239872-74239894 CCTTCCCCATGGAAGGGGCATGG + Intronic
1027726627 7:81813746-81813768 CTTCCACCATGAATGGGGAAGGG - Intergenic
1031794412 7:126153278-126153300 CCTACAGCATAGCTGGGGCATGG + Intergenic
1033422641 7:141217271-141217293 CTTTCAGCACAGGTGGGGCCTGG + Intronic
1035922614 8:3694186-3694208 ATGTGTCCATAGATGGGGCAGGG + Intronic
1036598781 8:10240173-10240195 CTTTCAGCATGGAAGGGGCCCGG + Intronic
1038429118 8:27485708-27485730 CTTTCAGCAGAGAGGGGACACGG + Intergenic
1038447102 8:27611789-27611811 CCTTCCCCAGAGATGGGGTAGGG + Intronic
1041978841 8:63831913-63831935 CTTTCAGCAGAGAGGGGACATGG - Intergenic
1046570379 8:115956872-115956894 CTCTCACCTTCCATGGGGCAGGG + Intergenic
1047559921 8:125975791-125975813 CTTTCTCCACAGATGGGGATGGG + Intergenic
1049138124 8:140924232-140924254 ATTTGAGCATAGATGTGGCAGGG - Intronic
1050575783 9:6994009-6994031 GTTTTTCCATGGATGGGGCAGGG + Intronic
1050850510 9:10279067-10279089 CTTTTACCATACATGGGGCCAGG - Intronic
1051193922 9:14542753-14542775 CTTTCACCATGAATAGGGCAGGG - Intergenic
1052414782 9:28164539-28164561 CTTTGACCATAGATGGGCTCTGG - Intronic
1052454521 9:28678254-28678276 CTTTCAGCACAGATGGAGCCTGG - Intergenic
1052739453 9:32379541-32379563 CTCCCACCAAGGATGGGGCAAGG + Intergenic
1055810554 9:80143155-80143177 CTTTCACCCTAGATGCAGTAGGG - Intergenic
1057693959 9:97310675-97310697 CTTTCACCCTCTTTGGGGCAGGG + Intronic
1058806053 9:108593264-108593286 ATTTCAATATAGATTGGGCATGG - Intergenic
1060814523 9:126627582-126627604 CTTTCCCCAGAGCTGGAGCAGGG + Intronic
1189157853 X:38777878-38777900 CTTTGACCGTGGATGGAGCAGGG + Intergenic
1189515713 X:41711855-41711877 CTTTCAGCAGAGAGGGGACACGG - Intronic
1189704995 X:43750894-43750916 CTTTCACCTTAGAAAGGGCAGGG + Intergenic
1189989256 X:46578816-46578838 CTTTCACCAATGATTGGGCTAGG - Intronic
1193265411 X:79463199-79463221 CTTTCACCAGAGCTGGGGTTGGG + Intergenic
1199584816 X:149403811-149403833 CTTTCACCAGACATGAGGCTTGG + Intergenic
1200254248 X:154571113-154571135 CTGTCACCATAAATGGTGCTTGG + Intergenic
1200263521 X:154633295-154633317 CTGTCACCATAAATGGTGCTTGG - Intergenic
1202034012 Y:20612582-20612604 CTTCCAGTATAGTTGGGGCATGG - Intergenic