ID: 1127627332

View in Genome Browser
Species Human (GRCh38)
Location 15:60793011-60793033
Sequence TCTCTCTTTTGAGGGAGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 353}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127627332 Original CRISPR TCTCTCTTTTGAGGGAGTGG TGG (reversed) Intronic
900486312 1:2924384-2924406 TCTCTCTTCTGGGGGTGCGGCGG + Intergenic
900982666 1:6055313-6055335 TCTCGCTTCTCAGGGAGTGGAGG + Intronic
901077336 1:6563558-6563580 TCAGTCTTTTGAGGGAATGGGGG + Intronic
901176336 1:7302150-7302172 TTTCTCTTTGGTGGGGGTGGGGG + Intronic
901807843 1:11749261-11749283 TCTCTCTTTGAGAGGAGTGGAGG + Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
904354749 1:29931669-29931691 TCTCTCCTGGGAGAGAGTGGAGG + Intergenic
904629222 1:31828982-31829004 ACTCTTTTTTGGGGGAGTGGGGG - Intergenic
905387587 1:37614969-37614991 TCTCTCCTCTGGGGGAATGGGGG + Intronic
905581522 1:39086068-39086090 TCACTCTTCTAAGGGAGTGATGG - Intronic
905798538 1:40829193-40829215 TCTCCCTCTTGGAGGAGTGGAGG + Intronic
906168228 1:43703748-43703770 TCTACCTTTCTAGGGAGTGGGGG + Intronic
907048024 1:51311937-51311959 GCTCTCTAGTGAGGGTGTGGGGG - Intronic
907456945 1:54582028-54582050 CCTCTCTTTGAGGGGAGTGGTGG + Intronic
907692104 1:56679427-56679449 TCTGTTTTTGGAGGGTGTGGTGG + Intronic
909252011 1:73370447-73370469 TCTCTATATTGAGTGGGTGGTGG - Intergenic
910011429 1:82468466-82468488 ATTCTCTTTTGAGGCAGCGGAGG - Intergenic
910709502 1:90165215-90165237 TCTCTACTTTGAGGGAGGTGGGG - Intergenic
911068949 1:93816966-93816988 TTTTTTTTTTGAGGGGGTGGTGG - Intronic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
913343328 1:117782023-117782045 TTTCTATTTTTGGGGAGTGGTGG - Intergenic
915623959 1:157103281-157103303 TTTTTCTTTTGGGGGAGTCGGGG - Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
917144746 1:171877181-171877203 TCTATGTTATGAGGGAGGGGAGG - Intronic
917840589 1:178974275-178974297 TCTCTCTCAGGAGAGAGTGGAGG + Intergenic
918433842 1:184490345-184490367 TCTCTTTTTCCAAGGAGTGGGGG + Intronic
918605110 1:186415455-186415477 TCTCTTTTTTGTGGGGGTGAGGG + Intronic
918617746 1:186566293-186566315 TCACTGTTTGGAGTGAGTGGTGG + Intergenic
920096623 1:203490675-203490697 TCTCTCTTCTGAGGGAAGGTTGG + Exonic
920862107 1:209718549-209718571 TCTGTTTTTTGGGGGTGTGGGGG - Intronic
1063093357 10:2887564-2887586 TGTCTCCCGTGAGGGAGTGGCGG + Intergenic
1065999676 10:31092531-31092553 TTTCTCTCTTGAGGTAGTGCAGG + Intergenic
1066250976 10:33632418-33632440 TTTCTCTTTTGAAGGATTAGTGG + Intergenic
1067105437 10:43362933-43362955 TGTCTGTTTTGAGGCAGAGGAGG - Intergenic
1067839632 10:49665496-49665518 TTTCTTTTTTGGGGGAGAGGAGG + Intergenic
1067860743 10:49845056-49845078 CCTCTCTTTTGAGTGTATGGTGG - Intronic
1069595967 10:69670428-69670450 TCTATATTTTGAGTGAATGGTGG + Intergenic
1070461147 10:76671802-76671824 TCTCTCTTTTGTGAGAGAGAGGG + Intergenic
1070503908 10:77096455-77096477 TGGCTTTTTTGAGGGAGTGTGGG - Intronic
1071398315 10:85244812-85244834 TCTGTCTTTTGAGGAACTGCAGG - Intergenic
1072404177 10:95134061-95134083 TCTCTCTCTTGTGAGAGAGGGGG + Intergenic
1074125953 10:110529168-110529190 TTTCTTTTTTGGGGGAGAGGGGG + Intergenic
1074311866 10:112329270-112329292 CCTCTCTTATGAGAGAGAGGGGG - Intergenic
1074695644 10:116048276-116048298 TCAGACTTTTGAGGGAATGGAGG - Intergenic
1074706950 10:116141575-116141597 TCTTTTTTTTGAGGGGGTGGTGG + Intronic
1074856489 10:117477733-117477755 TCACTCTTCTGAGGGGGTGTGGG + Intergenic
1075161635 10:120029578-120029600 TCTCTCTGTTGAGGCAGGGCAGG - Intergenic
1077660145 11:4060531-4060553 CCTTTTTTTTGGGGGAGTGGAGG + Intronic
1077942128 11:6854520-6854542 TCTCTGTTTTGGGGGCTTGGAGG - Intergenic
1079048193 11:17128030-17128052 TATCCCTTTTTACGGAGTGGGGG - Intronic
1079448083 11:20574551-20574573 CCTCTCTTTTTGGGGGGTGGGGG - Intergenic
1079939028 11:26654996-26655018 TCAAACTTTTGAGGCAGTGGGGG - Intronic
1080685690 11:34513229-34513251 TCTCTGTATCGAGGGGGTGGGGG + Intronic
1080701089 11:34644696-34644718 TCTCTCCTCTGAGGGTGTTGTGG + Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081814180 11:45929395-45929417 TTTTTGTTTTGAGGGGGTGGGGG - Intronic
1083629872 11:64089935-64089957 TCTCACTTTACAGGGCGTGGGGG - Intronic
1083695943 11:64442484-64442506 CTTCTCTTTTGAGGTAGTGTAGG - Intergenic
1083813519 11:65118648-65118670 TCACTCTTGTGGTGGAGTGGGGG + Intergenic
1084442615 11:69183615-69183637 TCCCTCTATTGGGGGAGGGGAGG + Intergenic
1085450830 11:76631314-76631336 TCTCTCTTTTTTGGGGGGGGAGG + Intergenic
1085785765 11:79447213-79447235 CCTCTCTGTTGTGAGAGTGGAGG - Intergenic
1087265818 11:96059595-96059617 TCTCTTTTTTGGGGGTGGGGAGG + Intronic
1089489171 11:118871067-118871089 TCTCTTTTTTGAGGTTGGGGTGG - Intergenic
1091235290 11:134018124-134018146 ACTCTCTTTTGAGACACTGGCGG + Intergenic
1092511971 12:9166356-9166378 CCTCTCTTTTCAGGGAATGAGGG - Intronic
1092898884 12:13040147-13040169 TCTCTCTGCAGAGGGAGTGAGGG + Intergenic
1093165934 12:15804356-15804378 TCTCTCTTTACAAGGAGAGGGGG - Intronic
1094167082 12:27453983-27454005 TCTCTTTTTTGTGGGGGAGGGGG + Intergenic
1094565527 12:31595202-31595224 CCTCTTTTTTGGGGGGGTGGCGG + Intergenic
1095381859 12:41604688-41604710 TCTTTTTTTTGGGGGGGTGGGGG + Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096796134 12:54079105-54079127 TCTCTGTTTGGAGGCACTGGTGG - Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097233130 12:57523943-57523965 TCTTTCTTTTGAGAGGGTGCTGG + Intronic
1097665249 12:62470955-62470977 TCTCTGTTTTGAAGCAGTAGTGG + Intronic
1097884669 12:64717093-64717115 TTTTTCTTTTGAGGGAGTAGGGG + Intronic
1099213265 12:79820347-79820369 TCTTTCCTGTGAGGGTGTGGGGG - Intronic
1099775826 12:87128149-87128171 TCTTTTTTTTGCGGGGGTGGGGG + Intergenic
1100193626 12:92219528-92219550 TCTCTCTTTTTAAAGAGTTGGGG + Intergenic
1101444296 12:104726584-104726606 TCTCTGTCTTGGGGGAGAGGAGG - Intronic
1101723809 12:107373466-107373488 ACTTTCCTTTGAGGAAGTGGGGG + Intronic
1102322482 12:111949118-111949140 TCTTTCTTTTTTGGGGGTGGGGG - Intronic
1103149979 12:118628964-118628986 GCTATCTTTTGAGGGGATGGAGG + Intergenic
1104339270 12:127932023-127932045 TCTCCCTTTGGAGGGAATAGAGG + Intergenic
1104630546 12:130397758-130397780 TCTCTGTCTCGAGGGAGTGCGGG + Exonic
1105351376 13:19619301-19619323 TTTCTCTCTTGAGGGAGAAGAGG + Intergenic
1106679503 13:31995615-31995637 TCTCTTTTTTGGGGGGGTAGGGG + Intergenic
1106883708 13:34159798-34159820 TTTCTTTTTTGGGGGATTGGTGG + Intergenic
1107060597 13:36155444-36155466 CCTATGTTTTGAGGAAGTGGAGG + Intergenic
1107274152 13:38657762-38657784 TCTTTTTTTTGGGGGAGAGGGGG + Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1107974281 13:45674734-45674756 TCTCTCTTTTGGGGGTAAGGAGG + Intergenic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1109006496 13:56884231-56884253 TCTCTTTTTTGGGGGAGGGGAGG + Intergenic
1109997975 13:70154684-70154706 TCTCTTTGTTGAGGGATTGCTGG - Intergenic
1113368333 13:109699530-109699552 ACTCTATTTTGGGGGATTGGTGG - Intergenic
1113898250 13:113779464-113779486 TCTCTGTTTTGGGGGCGTAGAGG + Intronic
1116897880 14:50334921-50334943 TTTTTTTTTTGAGGGGGTGGGGG + Intronic
1118612947 14:67555584-67555606 CCTCTCTACTGAGGGAGTGGAGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120982339 14:90301178-90301200 TCTTTCTCTGGAGGGAGAGGGGG - Intronic
1121607444 14:95251782-95251804 TGTCTCTTTTGTTGGAGTGCTGG + Intronic
1121941995 14:98079832-98079854 TATCTCTTTTGAGGACATGGAGG + Intergenic
1123934282 15:25186630-25186652 CCTTCCTTATGAGGGAGTGGTGG + Intergenic
1125759217 15:42085522-42085544 TCTCTGATTTCAGGGAGAGGAGG - Exonic
1126020026 15:44391102-44391124 AGTCTCTTTTGAGGGAAGGGGGG - Intronic
1127256693 15:57299212-57299234 TCTTTCTTTTGAAGGAGGAGAGG + Intronic
1127627332 15:60793011-60793033 TCTCTCTTTTGAGGGAGTGGTGG - Intronic
1129028274 15:72599425-72599447 TGTCTCTGTGGAGGGAGTAGAGG - Exonic
1129556980 15:76520599-76520621 TTTGTCTGTTGAGGGGGTGGGGG - Intronic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1130953703 15:88612108-88612130 TCTCTGTTTTCAGGGAGCAGTGG + Intergenic
1131037192 15:89230633-89230655 TCTCTCTTTTTTGGGGGTGTGGG + Intergenic
1131037194 15:89230635-89230657 TCTCTTTTTTGGGGGTGTGGGGG + Intergenic
1131997315 15:98144793-98144815 TTTCTCTTTTGTGGGTCTGGGGG + Intergenic
1132070582 15:98773651-98773673 TCCATCTTTTGGGGGAGGGGAGG - Intronic
1133442661 16:5833720-5833742 TCTCTCTTTTGAGAGAAAGAAGG + Intergenic
1134568766 16:15273911-15273933 TCACTTTTTTGGGGGAGAGGTGG - Intergenic
1134933833 16:18229831-18229853 TCACTTTTTTGGGGGAGAGGTGG - Intergenic
1135647267 16:24174007-24174029 TCTCTTTTTTGGGGGGGTGGGGG + Intronic
1136138282 16:28271555-28271577 ACTCTCTTTTTTGGGGGTGGGGG - Intergenic
1137259238 16:46809933-46809955 TTTTTCTTATGAGGGTGTGGGGG - Intronic
1137541504 16:49365299-49365321 TCTTTCTTTTCAGGGAGTATTGG + Intergenic
1140031182 16:71340557-71340579 TCTGTGTTTTGAGGGAGAAGGGG + Intergenic
1141282595 16:82642495-82642517 TCTCTCTTTGGTGGGAGAGCTGG + Intronic
1142773301 17:2115718-2115740 TCTCTTTTTTGCGGGGGAGGTGG + Intronic
1143131269 17:4678994-4679016 TCCCTCTGTTGAGGGTGTTGAGG - Intronic
1144668509 17:17118257-17118279 CCTCTCTTTTGAGGATGTGCTGG + Intronic
1144668652 17:17118931-17118953 CCTCTCTTTTGAGGAGGTGCTGG - Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1146100210 17:29973335-29973357 TCTCCCTTTTGCGGGAGGAGAGG - Intronic
1146418427 17:32659330-32659352 TCTCTATTGTGAAGGTGTGGCGG - Exonic
1146773390 17:35589494-35589516 TTTCTCTTTTGGGGAACTGGAGG + Intronic
1146946618 17:36877849-36877871 TTCCTCTTCTGAGGGAATGGAGG + Intergenic
1147627671 17:41910384-41910406 TCTCTCTTTGCTGGGTGTGGTGG - Intronic
1149300526 17:55301125-55301147 CCTATCTTTGGAGGGAGTGCAGG - Intronic
1150538399 17:66070544-66070566 TCACTCCCTTGAGGGAGCGGGGG - Intronic
1151134545 17:71933226-71933248 TCTCTCTTTTGAGGAGGAAGGGG - Intergenic
1151193745 17:72417013-72417035 TGTCTTTTGTTAGGGAGTGGAGG - Intergenic
1151907678 17:77059551-77059573 TCTCTTTTTTGGGGGGGTGAGGG - Intergenic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1152357517 17:79814033-79814055 TCTCTCTTCTGATGGGGTTGGGG + Intergenic
1152465127 17:80462029-80462051 TCTCCCATTAGGGGGAGTGGAGG - Intergenic
1153301322 18:3594490-3594512 TCGCTCTTTGGAAGGGGTGGAGG + Intronic
1154088895 18:11337633-11337655 GTTCTTTTTTGAGGGAGAGGTGG - Intergenic
1154162403 18:11990079-11990101 TCTCTCTTCTGTGGGAGTGAGGG + Intronic
1154509616 18:15082725-15082747 TCTCTGTTTTGAAGAAATGGTGG + Intergenic
1156497610 18:37536419-37536441 TCCCTTTTAGGAGGGAGTGGGGG - Intronic
1156743863 18:40365798-40365820 GCACTCTTTTGAAGAAGTGGTGG - Intergenic
1158285575 18:55877627-55877649 TCTCTATCTTGAGAGAGTTGTGG + Intergenic
1159889858 18:73943275-73943297 GCTGTCTTTTGGGGGAGTGGGGG + Intergenic
1161416931 19:4152585-4152607 TCTCTCTTGGTAGGGGGTGGAGG + Intergenic
1162584388 19:11550072-11550094 ACCCACTTGTGAGGGAGTGGGGG - Exonic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163680956 19:18682306-18682328 TCCCTCTCTTGAGGGAGGGAGGG + Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164433716 19:28209934-28209956 TCTCTCTTTAGGGGAAGAGGTGG - Intergenic
1164701685 19:30289207-30289229 TCTCATTTGTGAGGGGGTGGAGG - Intronic
1164712606 19:30368148-30368170 TCTCTCCTTGCAGAGAGTGGGGG - Intronic
1165185747 19:34019486-34019508 TCGCTTTTTTGAGGGAGAAGGGG + Intergenic
1165356309 19:35306202-35306224 TCTTTTTTGTGGGGGAGTGGGGG - Intronic
1165637462 19:37354089-37354111 TCTCTTTTTTGAGGGGTGGGTGG + Intronic
1166289907 19:41856288-41856310 TCTTTCTTTTGGCGGGGTGGAGG + Intergenic
1166290049 19:41857122-41857144 TCTTTCTTTTGGCGGGGTGGAGG - Intergenic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1167889337 19:52527460-52527482 TCTCTGTTTTTAGGTTGTGGAGG - Intergenic
928005913 2:27561452-27561474 TATCTCTTTTGTGTGTGTGGCGG + Intronic
928488855 2:31759975-31759997 TTCCTCTTTTAGGGGAGTGGGGG - Intergenic
929291808 2:40201100-40201122 TTTTTTTTTTGAGGGAGTGGGGG - Intronic
929464854 2:42135223-42135245 TCAGGCATTTGAGGGAGTGGTGG + Intergenic
930778198 2:55196378-55196400 TCTCTGGGTTGGGGGAGTGGTGG - Intronic
931087245 2:58846269-58846291 GCTTTCTTTTTAAGGAGTGGAGG + Intergenic
931213601 2:60221088-60221110 TCTCACTTTGGAGGTGGTGGGGG - Intergenic
932021126 2:68087989-68088011 TCTCACTTTGCAGGGACTGGGGG + Intronic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
933967383 2:87441142-87441164 ACTCTCATTTGATGGAATGGTGG + Intergenic
934890581 2:98065237-98065259 TCTTTTTTTTGGGGGGGTGGGGG - Intergenic
935134274 2:100285760-100285782 TTTCTCTTTGGAGGTTGTGGGGG - Intronic
935931971 2:108136704-108136726 TGTCTCTTCTGAGGCTGTGGTGG - Intergenic
936326412 2:111509353-111509375 ACTCTCATTTGATGGAATGGTGG - Intergenic
936343178 2:111655463-111655485 TCTTTCTTTGGAGGTGGTGGGGG - Intergenic
936852404 2:116916668-116916690 TCTTTCTTTGGAAGGAGTAGAGG + Intergenic
937283644 2:120736624-120736646 TCTGTTTTTTCAGGGGGTGGAGG + Intronic
937286689 2:120758484-120758506 CCTCTCTTGTGAGGGAGTGCTGG + Intronic
938272063 2:129981170-129981192 TGTTTGTTTTGAGGAAGTGGGGG - Exonic
938443946 2:131362643-131362665 TGTTTGTTTTGAGGAAGTGGGGG + Intergenic
939021017 2:136958602-136958624 TCACTATTTTGAGGGAATTGGGG + Intronic
940221811 2:151360459-151360481 TTTCTCCTTTTAGTGAGTGGCGG - Intronic
940439295 2:153695300-153695322 TCACTCTTATCAGGGAATGGTGG + Intergenic
941147800 2:161873982-161874004 TCTCTCTCTTGCTGGTGTGGAGG - Exonic
942036650 2:172016617-172016639 TTTCTTTTTTGGGGGGGTGGGGG - Intronic
943091103 2:183375775-183375797 TCTCTTTTTTGGGGGGGAGGGGG - Intergenic
943258810 2:185631459-185631481 TCCCTCTTTTCAGGGATTTGAGG - Intergenic
943479755 2:188404008-188404030 TCTGTCTTTAGTGAGAGTGGGGG - Intronic
945369062 2:208994204-208994226 TCTTTCTTTTGGGGGGGCGGGGG + Intergenic
947849962 2:233278595-233278617 TTTCTGTGGTGAGGGAGTGGTGG + Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1169075673 20:2758678-2758700 TCTCTCTCTTGAGGGAGGTAGGG + Intronic
1169307722 20:4507534-4507556 TGTGTGTTTTGAGGGGGTGGAGG + Intergenic
1169660696 20:7975450-7975472 TCTTTTTTTTGAGGGAGGGATGG - Intergenic
1169707677 20:8524319-8524341 TTTTTCCTTTGAGGGAGGGGAGG + Intronic
1170730846 20:18973593-18973615 TTTCTCTTTTGATAGATTGGTGG + Intergenic
1171972324 20:31572199-31572221 TCTCTGTGTTGAGGAAGAGGAGG + Intronic
1173117482 20:40259588-40259610 TCTCTCTTTTGAGAGATGGAAGG - Intergenic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1174002658 20:47386113-47386135 TCTCTTTTTTGGGGGTGAGGGGG - Intergenic
1174002660 20:47386115-47386137 TCTCTCTTTTTTGGGGGTGAGGG - Intergenic
1174105775 20:48161303-48161325 CTTCTCTCTGGAGGGAGTGGGGG - Intergenic
1174160465 20:48546859-48546881 TCTCTCTCTTGTTGGGGTGGAGG - Intergenic
1174916323 20:54657881-54657903 TATCACTTTTGAAAGAGTGGAGG - Intergenic
1175126723 20:56757781-56757803 TCTCTCTCTAAAGGGAGTGGTGG + Intergenic
1177873057 21:26596802-26596824 TTTTTAATTTGAGGGAGTGGTGG - Intergenic
1178290099 21:31359773-31359795 TTTCTCTTTTGACAGAGTTGTGG - Intronic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1178757052 21:35361463-35361485 TCTGTCTTTTGAGTGAAAGGTGG - Intronic
1178783455 21:35629331-35629353 TCTCTCTTTTGGGGCAGTCTGGG - Intronic
1180739804 22:18045147-18045169 TCTCTCTCTGGAGGGCCTGGGGG + Intergenic
1180984714 22:19897640-19897662 TGTCCCCTCTGAGGGAGTGGGGG - Intronic
1181435942 22:22910927-22910949 GCTCTGTTTGGAGGGTGTGGTGG - Intergenic
1181437625 22:22919697-22919719 GCTCTGTTTGGAGGGTGTGGTGG - Intergenic
1183908513 22:41061230-41061252 TCTTTTTTTTGGGGGGGTGGAGG + Intergenic
1184980734 22:48094417-48094439 CCTCTCTTTTTTGGGGGTGGGGG - Intergenic
949443938 3:4113529-4113551 TCTTTCTTTTTTGGGGGTGGGGG - Intronic
949566119 3:5246332-5246354 TCTCTCTCGTGAGGGAGTCCAGG + Intergenic
949755781 3:7409426-7409448 TCTCTTTTTTTGGGGGGTGGGGG + Intronic
950047398 3:9957643-9957665 TCACTTTTTTGTGGGAGGGGAGG - Intergenic
950510202 3:13420999-13421021 ACTTTCTTTTGTGGGTGTGGGGG - Intergenic
951118343 3:18892131-18892153 TCTCTCTTTTGGTGGAGAAGAGG + Intergenic
951159442 3:19399254-19399276 GATCTCTTTGCAGGGAGTGGAGG + Intronic
952271728 3:31839464-31839486 TTTGTCTTTTTAGGGGGTGGTGG - Intronic
952635323 3:35522394-35522416 TTTCTCTTGTGAGGGTTTGGAGG - Intergenic
952861275 3:37814561-37814583 TTTCTTTTTTGGGGGGGTGGGGG - Intronic
954848490 3:53580174-53580196 GCTTTCTTTTGAGGGAGTTGTGG + Intronic
955540354 3:59969768-59969790 TCTCGCTTTTGAGGGGCTGCTGG - Intronic
955956107 3:64291889-64291911 TCTTTTTTTTGGGGGGGTGGGGG - Intronic
957306993 3:78470176-78470198 TGTCTCATTTCAGGTAGTGGTGG - Intergenic
957512752 3:81210929-81210951 TAACTCTTTTCAGTGAGTGGAGG - Intergenic
957726838 3:84077121-84077143 CCTCTCTCTTGAGGTTGTGGTGG - Intergenic
958727524 3:97923906-97923928 TCTCTCCTTTTAGGGGGTAGAGG + Intronic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
960376321 3:116906234-116906256 TCTCTCTTCAGAGGGAATGATGG - Intronic
960402982 3:117226623-117226645 TTTGTATTTTGAGGGGGTGGGGG - Intergenic
960661893 3:120069328-120069350 TCTCAATTTTGAGGAAGTTGGGG - Intronic
961247893 3:125472709-125472731 ATTCTCTTTTGGGGGATTGGAGG - Intronic
962043793 3:131734383-131734405 TCTCTCAATTGAGGGATTGGTGG + Intronic
962429816 3:135308606-135308628 TCTCTTCTCTGAGGGACTGGTGG - Intergenic
964487508 3:157200751-157200773 TCTATCTTTTGAGAGAGCGTTGG + Intergenic
964691648 3:159456301-159456323 TCTCTATGTTGAGGGAATGATGG + Intronic
965923254 3:173945208-173945230 TCTCCCTTTAGAGGGGGTGGTGG + Intronic
966043185 3:175517768-175517790 TCTCTCTCTTGAGAGAGAGAAGG + Intronic
966224948 3:177588107-177588129 TCTTTCTTTTTGGGGAGTAGGGG - Intergenic
966394021 3:179482762-179482784 TCTCTCTTTTGAGGTGAGGGAGG + Intergenic
966913956 3:184574848-184574870 TAGCTCTTTTGAGCCAGTGGGGG - Intronic
967036065 3:185649079-185649101 TCTCTGTTTTCAGGGAGTGGAGG + Intronic
968702120 4:2062155-2062177 TCCCTGGTGTGAGGGAGTGGAGG + Intronic
968722483 4:2217876-2217898 TCTCTGGGTTTAGGGAGTGGAGG - Intronic
968799427 4:2732587-2732609 TCTTTCTGCTGGGGGAGTGGGGG + Intergenic
969235172 4:5860402-5860424 TTTCTCATTTGAGGGTGTGCAGG - Intronic
972310149 4:37873920-37873942 TCTCTCTGTTGAGTGTGTGTGGG + Intergenic
973155908 4:46952035-46952057 TCTCTCTTTTGAGGGTGGGTTGG - Intronic
974439498 4:61898435-61898457 TCTCTCTTGTGAGAGAGAGAGGG + Intronic
975048777 4:69832919-69832941 TCTCTATATTGAGGGAGTGCTGG + Intronic
975630841 4:76400596-76400618 TCTTTTTTTTGGGGGGGTGGTGG - Intronic
975854491 4:78608741-78608763 CTTTTCTTTTGGGGGAGTGGGGG + Intronic
978077859 4:104555393-104555415 TGTCTTTTTTGGGGGAGTTGGGG + Intergenic
978146009 4:105372396-105372418 TCTTTCTTCTGGTGGAGTGGTGG - Intronic
979410567 4:120373481-120373503 TCTTTTTTTTGGGGGGGTGGCGG + Intergenic
979679420 4:123443528-123443550 TCTCTTTTTTGAGGGGGTGGAGG - Intergenic
980994359 4:139766164-139766186 TCTTTCTTTTTGGGGGGTGGGGG + Intronic
981378806 4:144047645-144047667 CATCTCTTTTGAGTGAGTGTAGG + Intergenic
982103951 4:151995272-151995294 TCCCTCATTTAAGGGACTGGTGG + Intergenic
982537423 4:156624516-156624538 TGTCTCTTTTAAGGCAGTGAAGG + Intergenic
982910023 4:161128308-161128330 GCTCTCTTTCGAGCAAGTGGTGG + Intergenic
984655748 4:182316586-182316608 TTCCTTTTTTGTGGGAGTGGGGG - Intronic
984842681 4:184082611-184082633 TCTCTCTTTTTAGGATGTCGGGG - Intergenic
988640622 5:33037381-33037403 CCTCTCATTTGAGGGAATGTTGG - Intergenic
989826617 5:45864226-45864248 TCACTCTTTTGAGTTAGAGGTGG - Intergenic
991162778 5:63524482-63524504 TCTCTATTTTTAGGTGGTGGAGG - Intergenic
992130420 5:73686309-73686331 TGTCTGTTTTGAGGTAGGGGAGG - Intronic
992141521 5:73801728-73801750 TCTCTTTTTTTGGGGAGTTGGGG + Intronic
992529015 5:77637752-77637774 TCTCTGATTTGAGGGGGAGGCGG - Intronic
992828574 5:80572071-80572093 TTTCTCATTGGAGGGAGTGGTGG + Intergenic
992886658 5:81166577-81166599 TGTCACATGTGAGGGAGTGGCGG + Intronic
992889228 5:81188688-81188710 CCACTCGTTTGAGGGAGAGGAGG + Intronic
993036699 5:82767015-82767037 TTTTTTTTTTGTGGGAGTGGTGG + Intergenic
993299830 5:86194571-86194593 TCTCTTTTTTTGGGGGGTGGGGG + Intergenic
993507807 5:88732793-88732815 TCTCCCTTCAGAGGCAGTGGAGG - Intronic
994028417 5:95113038-95113060 TCTCTCTCTGGAGGGAGCTGGGG - Intronic
995616601 5:113971554-113971576 CCTCTCTTTTGTGTGACTGGTGG + Intergenic
996268200 5:121569242-121569264 TCTCCCTTTTTGGGGAGTGGTGG + Intergenic
997524718 5:134544808-134544830 TGTGTTTTTTGGGGGAGTGGGGG - Intronic
997971606 5:138407420-138407442 TCTCTCTAGTGAGAGAGAGGGGG - Intronic
999164380 5:149535513-149535535 TATCCCTTTTTAAGGAGTGGAGG - Intronic
1000731664 5:164842572-164842594 TCTCACACTTGATGGAGTGGAGG - Intergenic
1001088599 5:168720371-168720393 TCTGTCTTTTGGGGTGGTGGGGG - Intronic
1001229421 5:169973196-169973218 TCTATTGTTTAAGGGAGTGGAGG - Intronic
1001274278 5:170339047-170339069 TCCCTCTAGTGAGGCAGTGGGGG + Intergenic
1002422805 5:179158384-179158406 TCTGTCTATAGAGTGAGTGGAGG + Intronic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1004626478 6:17381820-17381842 TCTCTCTTTTTGGAGGGTGGAGG + Intergenic
1004678011 6:17863232-17863254 TCTCACATTTAAGGGGGTGGAGG + Intronic
1005132466 6:22524935-22524957 TCTCTCTTTTATGGGAGAAGAGG - Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007574384 6:42915819-42915841 TGTCTCTTCAGAGGGAGTGCAGG + Intergenic
1010013107 6:71072941-71072963 TCTATCTATTCAGGGAGAGGAGG + Intergenic
1010364957 6:75040303-75040325 TCTCTCTTGTGAGAGAGAGGGGG - Intergenic
1011276010 6:85632249-85632271 TTTCTCTTTTGAGTGTCTGGAGG - Intronic
1013254035 6:108365858-108365880 TCTCTTTTTTGAGGGGGTGTGGG + Intronic
1013674669 6:112444641-112444663 GCTCTTTTTTGGGGGAGTGGGGG - Intergenic
1014353049 6:120367710-120367732 TCTCTTATTTCCGGGAGTGGTGG + Intergenic
1017091954 6:150767129-150767151 TCTTTATTTTGAGGGAGTGTAGG + Intronic
1017758778 6:157552246-157552268 TAGCTCTTTTGAGTGAGTGAGGG + Intronic
1019077238 6:169397522-169397544 TTTTTCTTTTGTGGGGGTGGTGG + Intergenic
1020862078 7:13506154-13506176 TCTTCATTTTGGGGGAGTGGAGG + Intergenic
1021133013 7:16934028-16934050 TCTCTCTGTTGTGGGTTTGGGGG + Intergenic
1022077247 7:26984140-26984162 TCTCTCTCTTGGGGGAGAAGTGG - Intronic
1022193193 7:28037113-28037135 TGTCTCTTTTCAGGCAGAGGTGG - Intronic
1024423614 7:49199979-49200001 TCTGTATGTTGAGGGAGTGCTGG - Intergenic
1025604251 7:63027824-63027846 TCTCACTTTTTGGGGGGTGGGGG + Intergenic
1026256324 7:68715368-68715390 ACACTCTTTTGAGGGAAAGGAGG - Intergenic
1026955493 7:74373881-74373903 TGGGGCTTTTGAGGGAGTGGAGG + Intronic
1030174860 7:106641925-106641947 TCTATATTTTGATGGGGTGGTGG + Intergenic
1030398606 7:109019598-109019620 TCTGTCTTTTGGGAGAGTGAAGG + Intergenic
1030732141 7:113002884-113002906 TATCTCATTTGAGTGAGTTGAGG - Intergenic
1031126179 7:117775660-117775682 TTTTTCTTTTAAAGGAGTGGAGG + Intronic
1031532932 7:122898600-122898622 TCTCTCTTTGGAGAGACTGAAGG + Intergenic
1032311534 7:130791727-130791749 TCTCTCTTTTGAGAAAGAGAGGG - Intergenic
1034130838 7:148715551-148715573 TCTCTCCTTTTTGGGAGGGGTGG + Intronic
1034259451 7:149745675-149745697 GCTCTCTGTTGAGGGGCTGGTGG + Intergenic
1034856315 7:154551310-154551332 TCTCTCTTTTTTGGGGGAGGTGG + Intronic
1036498658 8:9293973-9293995 TCTCTCTCCTGAGAGTGTGGGGG - Intergenic
1037782222 8:21877730-21877752 TTTCTCTGTTGAAGGAGAGGTGG + Intergenic
1037982112 8:23261666-23261688 TGCCTCCTTTGAGGGACTGGGGG + Exonic
1038260992 8:25993791-25993813 TATGTCTTTTGGGGGGGTGGGGG + Intronic
1040486954 8:47882686-47882708 TCACTCTGTTGCAGGAGTGGTGG - Intronic
1040560010 8:48515245-48515267 TCTGTCTTTCATGGGAGTGGTGG - Intergenic
1041100514 8:54392129-54392151 TCTCTCTTATGAAGGACTGAGGG - Intergenic
1041383359 8:57275251-57275273 TCTCTCTTCTGAGAGTCTGGAGG - Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1044729467 8:95218542-95218564 TCCCTCTTTGGTGGGTGTGGTGG + Intergenic
1045092492 8:98760711-98760733 TCTTTTTTTTGAGGGGGTGGGGG + Intronic
1046082939 8:109394502-109394524 TCACTCTGTTGCGGGGGTGGTGG + Intronic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1046754869 8:117962760-117962782 TCTCTTTTTTTTGGGGGTGGGGG - Intronic
1050214909 9:3311886-3311908 TTTCTTTTTTGGGGGAGTAGGGG - Intronic
1050863917 9:10473673-10473695 TTTCTGTTTGGAAGGAGTGGTGG - Intronic
1053785744 9:41651781-41651803 TCTCTGTTTGGAGGCACTGGTGG - Intergenic
1054159293 9:61662402-61662424 TCTCTGTTTGGAGGCACTGGTGG + Exonic
1054174461 9:61865747-61865769 TCTCTGTTTGGAGGCACTGGTGG - Intergenic
1054449318 9:65394792-65394814 TCTCTGTTTGGAGGCACTGGTGG - Intergenic
1054479067 9:65593407-65593429 TCTCTGTTTGGAGGCACTGGTGG + Intergenic
1054663077 9:67715044-67715066 TCTCTGTTTGGAGGCACTGGTGG + Intergenic
1055670449 9:78600280-78600302 TCCCTCTATTGAAGGGGTGGTGG + Intergenic
1056396511 9:86186307-86186329 TCTTTCTCCTTAGGGAGTGGTGG + Intergenic
1058049942 9:100395448-100395470 TCTCTCTTTTGCGAGAGAGAGGG + Intergenic
1058246931 9:102638465-102638487 TCTCTCTTTTTAAGGAGGAGGGG - Intergenic
1058708615 9:107658916-107658938 TTTCTTTTTTGGGGGGGTGGGGG - Intergenic
1058733653 9:107874618-107874640 CCTCTCTTTTCAGGGGGAGGGGG + Intergenic
1058763419 9:108158942-108158964 TGTCTCTTTTCGGGGGGTGGGGG + Intergenic
1059043784 9:110842501-110842523 GCTCTGTCTTGAAGGAGTGGAGG + Intergenic
1060101888 9:120847932-120847954 TCTCTCTTTTGAGGGTGTAAGGG - Intergenic
1061811700 9:133166086-133166108 ACTATCTTTTGAGGAGGTGGTGG + Intergenic
1061995931 9:134185796-134185818 TCTCTTTTTTCAGGGACGGGAGG - Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1188495134 X:30775528-30775550 TCTCTTTTTTGGGGGGGGGGGGG - Intergenic
1188495136 X:30775530-30775552 TCTCTCTTTTTTGGGGGGGGGGG - Intergenic
1190596282 X:52054706-52054728 GATCTTTTTTGAGGGTGTGGGGG + Intergenic
1190612542 X:52199367-52199389 GATCTTTTTTGAGGGTGTGGGGG - Intergenic
1192543347 X:71993398-71993420 TCTATCTTTTGAGTAACTGGGGG + Intergenic
1193194077 X:78609250-78609272 TCTCTTTTTTGGGGGCGGGGAGG + Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1194934403 X:99930787-99930809 TCTCATTTTTGAGTGAGTTGTGG + Intergenic
1196657139 X:118230068-118230090 TCTTTTTTTTGAGGGGGAGGAGG - Intergenic
1197176598 X:123492890-123492912 TCTCTCTTAGGAGAGAATGGTGG + Intergenic
1199606840 X:149585092-149585114 TTTCTTTTTTGAGAGCGTGGAGG + Intronic
1199632283 X:149784276-149784298 TTTCTTTTTTGAGAGCGTGGAGG - Intronic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201147566 Y:11073206-11073228 TCTCCATGTTGAGGGCGTGGCGG - Intergenic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1201540970 Y:15104056-15104078 TCTTTTTTTTGGGGGGGTGGGGG + Intergenic