ID: 1127631997

View in Genome Browser
Species Human (GRCh38)
Location 15:60836271-60836293
Sequence CTTTATGTGCAGATGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 281}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127631994_1127631997 4 Left 1127631994 15:60836244-60836266 CCTCAAAGATCTGGGCTGGCCAC 0: 1
1: 0
2: 1
3: 17
4: 122
Right 1127631997 15:60836271-60836293 CTTTATGTGCAGATGGAGAGAGG 0: 1
1: 0
2: 1
3: 24
4: 281
1127631993_1127631997 5 Left 1127631993 15:60836243-60836265 CCCTCAAAGATCTGGGCTGGCCA 0: 1
1: 0
2: 2
3: 7
4: 161
Right 1127631997 15:60836271-60836293 CTTTATGTGCAGATGGAGAGAGG 0: 1
1: 0
2: 1
3: 24
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127631997 Original CRISPR CTTTATGTGCAGATGGAGAG AGG Intronic
900165765 1:1243753-1243775 CTTTATGCCCAGACGGAGCGTGG - Intronic
901416577 1:9120648-9120670 CTTTAACTGCAGAAGGGGAGAGG + Intronic
904002633 1:27347622-27347644 CTGTATGTGGACAGGGAGAGAGG + Intronic
906818756 1:48906640-48906662 CATTGTATGCAGATGGAGCGAGG + Intronic
907644333 1:56226777-56226799 CTTAATATGCAGATGGACATTGG - Intergenic
910329004 1:86047236-86047258 GTTTATATCCAGATAGAGAGGGG - Intronic
911666543 1:100559283-100559305 CTTTATTTGCAGATGAAGCCTGG - Intergenic
913265190 1:117036423-117036445 TTTTATGGGGTGATGGAGAGGGG - Intronic
913823670 1:123112543-123112565 CTTTTTGTGCAATTGGAAAGTGG + Intergenic
913838910 1:123385445-123385467 CTTTTTGTGCAATTGGAAAGTGG + Intergenic
913881377 1:124147572-124147594 CTTTTTGTGCAATTGGAAAGTGG + Intergenic
913892068 1:124339066-124339088 CTTTTTGTGCAATTGGAAAGTGG + Intergenic
916073997 1:161189659-161189681 CTTCAAGTGCATATGGAGAGTGG + Exonic
916273795 1:162971916-162971938 ATTTAGTGGCAGATGGAGAGGGG + Intergenic
916830244 1:168483524-168483546 CTTTATTTGGAGCTGGAGTGGGG + Intergenic
919282533 1:195509738-195509760 ATTTATGTGGAGATGGTGAAAGG - Intergenic
920175069 1:204095585-204095607 TTTAATCTGCAGATGGACAGAGG - Intronic
921196581 1:212763021-212763043 CCTTATGGGCATATGGAGAAAGG + Intronic
921374890 1:214463625-214463647 CTTTGTAAGCAGGTGGAGAGAGG + Intronic
922146929 1:222955630-222955652 CTTTAGGGGAAGATGGAGAGGGG + Intronic
923288024 1:232515694-232515716 CTTTGTGGGCAGAAGCAGAGGGG - Intronic
923384475 1:233453002-233453024 TCTTATGGGGAGATGGAGAGGGG - Intergenic
1062909168 10:1201251-1201273 CTGCATTTGCAGAGGGAGAGAGG - Intronic
1063285105 10:4678580-4678602 TTTTATGGGGTGATGGAGAGGGG + Intergenic
1063963642 10:11327865-11327887 CTTTAATAGCAGATGGATAGAGG + Intronic
1066329162 10:34399253-34399275 ATTTATGCTCAGATAGAGAGTGG - Intronic
1066495476 10:35937910-35937932 TTTTATGTGGACATGGAGAAAGG - Intergenic
1068719915 10:60233239-60233261 CTTTATTTTCAGATAGAGAAAGG + Intronic
1070403764 10:76076467-76076489 CTGAATGTGAAGATAGAGAGTGG + Intronic
1072611565 10:97020662-97020684 CTTTATGTGCAGGGGTACAGCGG - Intronic
1072728885 10:97831521-97831543 CATTAGGAGCAGATGGAGGGAGG + Intergenic
1074188593 10:111116886-111116908 CTCGATGTGCAGAGGGAGGGAGG - Intergenic
1074259606 10:111838795-111838817 TTTTATGGGGTGATGGAGAGTGG + Intergenic
1075806306 10:125191332-125191354 CTTGCTGTGCAGATGGAAGGAGG + Intergenic
1076125372 10:127969971-127969993 ATTTCTGTGCAAAGGGAGAGAGG - Intronic
1076807614 10:132866833-132866855 CTTTATGGGCAAATGCAGAGGGG + Intronic
1077700487 11:4436968-4436990 CTTTAAATGCAGATGGTGAAGGG + Intergenic
1078050361 11:7960500-7960522 CTGCAGGGGCAGATGGAGAGAGG - Exonic
1078621549 11:12913207-12913229 CTTTACCTGCACATGGAGAGGGG - Intronic
1080140199 11:28908823-28908845 CAGTATGTGCATTTGGAGAGAGG + Intergenic
1080263527 11:30376508-30376530 CATTACGTGCAAAAGGAGAGAGG + Intergenic
1080417627 11:32083621-32083643 GGTTATGTGTAGATGGAGAAGGG - Intronic
1080905655 11:36542394-36542416 CTTTGTGTGTAGAAGGAAAGAGG - Intronic
1081141366 11:39505062-39505084 CTTTAAGACCAGGTGGAGAGAGG - Intergenic
1082612591 11:55319550-55319572 CTTTATATGTAGAGTGAGAGTGG + Intergenic
1084115837 11:67042583-67042605 CTTTATGTGCACATGGGTGGAGG - Intronic
1084198240 11:67538590-67538612 TTTTATGGGGTGATGGAGAGGGG - Intergenic
1084260791 11:67977320-67977342 CCTTATATCCAGAGGGAGAGAGG + Intergenic
1084364758 11:68690391-68690413 CTTTAGGTGGCGATGGGGAGAGG + Intronic
1084482831 11:69432035-69432057 ATTAATGTGCAGATGGATGGAGG + Intergenic
1084525750 11:69697065-69697087 CTTGATTGGCAGATGGAGACAGG + Intergenic
1085466437 11:76726940-76726962 CATTTTGTGCTGAAGGAGAGAGG - Intergenic
1086457277 11:86971798-86971820 TTTTTTGTGCAGATGGGGTGGGG + Intergenic
1086887351 11:92221655-92221677 CTTTCCTTGCAGATGGAAAGAGG + Intergenic
1086938457 11:92769566-92769588 CTTTACCTGCAGATGGATGGGGG + Intronic
1087422247 11:97944352-97944374 ATTTATGTGCCGATGGATACTGG + Intergenic
1087640977 11:100753423-100753445 CTTTGTGGGCAGATGAGGAGTGG - Intronic
1089047278 11:115513167-115513189 CTTTCCGTGCAGAAGCAGAGGGG + Intergenic
1090009244 11:123031573-123031595 CTGTGTATGCTGATGGAGAGTGG + Intergenic
1091672243 12:2460571-2460593 ACTTAAGTGCAGATGGAGACAGG - Intronic
1092881922 12:12893242-12893264 CGACGTGTGCAGATGGAGAGGGG - Intronic
1093185074 12:16010613-16010635 GTTTATGAACAGAAGGAGAGAGG + Intronic
1094288441 12:28819103-28819125 CTGTCTTTGCAGATGGACAGAGG + Intergenic
1095318275 12:40793318-40793340 CTTAATGTGCATATGGACACCGG - Intronic
1095582146 12:43812834-43812856 CTTTTTGTAGAGATGGGGAGTGG - Intergenic
1096759426 12:53827922-53827944 CTACATGTGCATATGGATAGTGG + Intergenic
1097736093 12:63182740-63182762 CTTTATGTGCAAATGAATGGAGG + Intergenic
1097889469 12:64762492-64762514 GTTTATGTGCATTTGGCGAGTGG + Intergenic
1098970165 12:76846098-76846120 TATTATGTGCAGAGGTAGAGAGG + Intronic
1099801892 12:87467947-87467969 TTTTATGGGATGATGGAGAGGGG + Intergenic
1099947817 12:89265147-89265169 ATTTATGTGCAGCTGGAAAATGG - Intergenic
1101565622 12:105902213-105902235 ATGTAAGTGCTGATGGAGAGTGG - Intergenic
1101861437 12:108485570-108485592 CTTTGTGTGCACATGGGGAGGGG - Intergenic
1101915499 12:108892740-108892762 CTTGTTGGGCAGATGGAGTGGGG - Intronic
1102075898 12:110060029-110060051 TGTTAAGTGCAGATGGAAAGGGG - Intronic
1102892213 12:116568697-116568719 CTTTATGAGCAGAGGAGGAGAGG + Intergenic
1103038465 12:117675364-117675386 CCTGATTTGCAGATGGAGACTGG - Intronic
1103998171 12:124843277-124843299 CTTTCTGTGGAGATGGGGGGGGG + Intronic
1105516053 13:21091758-21091780 CTTTATGGGCAGCGGGAGAATGG - Intergenic
1106100456 13:26690892-26690914 ATTGATGAACAGATGGAGAGGGG - Intergenic
1106550091 13:30763555-30763577 CGTTATGGGCAGCTGCAGAGAGG + Intronic
1107102845 13:36612693-36612715 GTTTATATGCAGTTGTAGAGGGG + Intergenic
1108719075 13:53111522-53111544 ATTTTTGTGGATATGGAGAGGGG + Intergenic
1109163763 13:59008380-59008402 TTTTATGGGGTGATGGAGAGGGG + Intergenic
1109189376 13:59307098-59307120 CTTTATTAGCAGAGTGAGAGCGG - Intergenic
1111223696 13:85241349-85241371 GTTTTTGTGCAGAAGGACAGTGG - Intergenic
1113420953 13:110171067-110171089 ATTCATGTGCTGATGGAGTGAGG - Intronic
1117559844 14:56925839-56925861 TTTTTTGTGGAGGTGGAGAGTGG + Intergenic
1118170889 14:63387420-63387442 CTGTGTGTGCAGAAGGACAGTGG - Intronic
1120090925 14:80332733-80332755 CTTTATATATATATGGAGAGTGG - Intronic
1120132237 14:80821809-80821831 CTTTATCTGCAGTGGGAGAATGG - Intronic
1120660748 14:87248170-87248192 CTTTATATGGAAATGCAGAGGGG + Intergenic
1121222210 14:92294639-92294661 CTTTAATTGCAGATGCTGAGAGG - Intergenic
1125403253 15:39326752-39326774 AGTTATGAGCAGATGGAGGGAGG - Intergenic
1126468037 15:48978625-48978647 CTTTAGGTGAAGGTGGAGGGTGG + Intergenic
1127463196 15:59218805-59218827 CGATTTGTGCAGATGCAGAGAGG + Intronic
1127609594 15:60623674-60623696 CTTTATGTGAATATGGACAAAGG + Intronic
1127631997 15:60836271-60836293 CTTTATGTGCAGATGGAGAGAGG + Intronic
1128213534 15:65918250-65918272 ATTTATGTGCAAATGGAGAAGGG - Intronic
1130003641 15:80070629-80070651 GGTTATGTATAGATGGAGAGTGG + Intronic
1130137890 15:81197074-81197096 CCTGCTGGGCAGATGGAGAGAGG + Intronic
1130714488 15:86318266-86318288 CTTTATGTTAACATGGATAGTGG - Intronic
1133798634 16:9066913-9066935 TTTTATGCGGTGATGGAGAGGGG - Intergenic
1136054845 16:27680686-27680708 CTTTTTTTGCAGAGGGAGGGTGG + Intronic
1137692746 16:50440930-50440952 CTTCATGAGCACCTGGAGAGAGG - Intergenic
1138648171 16:58440214-58440236 TTTCATGTCCAGATGGGGAGTGG + Intergenic
1138821999 16:60271885-60271907 TTTTGTGTTCAGATGGGGAGGGG - Intergenic
1139476745 16:67206640-67206662 CTTTATGTGGGGATTCAGAGGGG - Intergenic
1142525436 17:537105-537127 CTTGATGTGCAGAATGACAGAGG + Exonic
1143378521 17:6481087-6481109 CTCTCTCTGCAGGTGGAGAGTGG - Intronic
1143968377 17:10773839-10773861 CTTTATGGGAATATGGAGAGTGG + Intergenic
1144169935 17:12649789-12649811 GGGTATGTGCAGAAGGAGAGGGG + Intergenic
1145011333 17:19369981-19370003 CTTTTCCTGCAGATTGAGAGAGG + Intronic
1147846862 17:43410642-43410664 CTTGATGTGCAGACTGAGATGGG + Intergenic
1149786558 17:59440465-59440487 CTTTTTGTAGAGATGGGGAGGGG - Intergenic
1152283910 17:79401536-79401558 CCTTCAGTGCAGAGGGAGAGGGG + Intronic
1156070380 18:33199992-33200014 CTTTGGGTGCTGATGGTGAGAGG - Intronic
1156136246 18:34042322-34042344 CTTTACTTGCAGATAGAAAGGGG - Intronic
1156498182 18:37539875-37539897 CTTGCTGTGAGGATGGAGAGAGG + Intronic
1156561283 18:38128568-38128590 TTTTATGTGGAGATGGAAAATGG + Intergenic
1156777512 18:40810625-40810647 CTTTATGAGCAGAAGTGGAGGGG + Intergenic
1156936046 18:42708534-42708556 CCTTATGTGGAGATTGAGGGAGG + Intergenic
1157006961 18:43594730-43594752 CTTTCTGTGCACATGCATAGCGG + Intergenic
1157627790 18:49065879-49065901 TTTTATATGCAAATGGAAAGAGG + Intronic
1158224833 18:55190055-55190077 TTTTATGGGATGATGGAGAGGGG + Intergenic
1160349761 18:78166713-78166735 CAGTATATGTAGATGGAGAGGGG + Intergenic
1160598017 18:79990778-79990800 ATTTATCTGGAGATGGATAGTGG - Intronic
1160841366 19:1148242-1148264 CTTTCTATGCAGGAGGAGAGTGG - Intronic
1162106151 19:8371044-8371066 CTTTCTGGGCAGATGGAGGCTGG + Exonic
1162724988 19:12684829-12684851 CCGTATGTGAAGATGCAGAGAGG + Intergenic
1164660602 19:29963023-29963045 CTTTATGTGCAGCTGGGGGTAGG - Intronic
1164826867 19:31290369-31290391 CTTTTTGTGCAAACAGAGAGAGG + Intronic
1166237829 19:41469290-41469312 TTTAATATCCAGATGGAGAGAGG - Intergenic
1166350854 19:42197445-42197467 CTTGATGTGCAGGAGGGGAGTGG - Intergenic
928136523 2:28692108-28692130 ATTTATGGGAAGAGGGAGAGCGG + Intergenic
928404714 2:31005907-31005929 CTTTTTATGCACGTGGAGAGTGG + Intronic
928482070 2:31693057-31693079 CTTTATGGGCAGGCTGAGAGAGG - Intergenic
928930099 2:36615532-36615554 TTTTATGGGGCGATGGAGAGGGG - Intronic
929480060 2:42297450-42297472 CTGTTTGTGCATATGTAGAGAGG - Intronic
929766248 2:44846228-44846250 CTTTATTTGGAGATGGAGTCTGG + Intergenic
931586501 2:63835491-63835513 CTTTCTGTTTTGATGGAGAGGGG + Intergenic
932353780 2:71051845-71051867 CCTTATATCCAGAGGGAGAGGGG - Intergenic
932656057 2:73611992-73612014 CTTTATGTGGTGTTGGAGAGGGG + Intergenic
933195861 2:79388816-79388838 GTTTATGTTAAGATGGGGAGAGG - Intronic
935035203 2:99364481-99364503 CTTAATGTTCAGAAGGAGAATGG + Intronic
937716663 2:125039810-125039832 TCTTATGAGCAGATGGGGAGGGG - Intergenic
940041640 2:149367728-149367750 CTTTATGTGCATTTACAGAGTGG - Intronic
940209626 2:151243046-151243068 CATTTTGTGCACATGGAGTGGGG + Intergenic
941416296 2:165225540-165225562 CCTTAGGAGGAGATGGAGAGAGG + Intergenic
943663371 2:190583179-190583201 CTTGATGGGCAGAAGGAGAGAGG + Intergenic
945279149 2:208018884-208018906 CTTTATATGTAGATATAGAGTGG - Intronic
945323446 2:208454450-208454472 CTTTGTGTGCACAGAGAGAGAGG - Intronic
945437271 2:209833312-209833334 CTTCATGAGCAGAGAGAGAGGGG + Intronic
946511512 2:220361844-220361866 TTTTATATGCAAATGGAAAGAGG - Intergenic
946623808 2:221589752-221589774 CCTAGTGTCCAGATGGAGAGAGG + Intergenic
948632812 2:239312872-239312894 CTTCATCTGCAGAGGGAGACCGG + Intronic
1168809162 20:692704-692726 TTTTTTGTGCAGTTGCAGAGAGG + Intergenic
1170715488 20:18827633-18827655 CTTTATAAGCAGAGGAAGAGAGG + Intronic
1171030253 20:21670236-21670258 CTTTATGGGGCGATGGTGAGGGG + Intergenic
1175370143 20:58482861-58482883 CTGTAAGTGCAGATGGAAGGAGG - Intronic
1176295245 21:5068694-5068716 CTGAATGTGCACATGGACAGCGG + Intergenic
1176412689 21:6457531-6457553 CTTCAAGTGCAGGGGGAGAGAGG + Intergenic
1177013195 21:15753100-15753122 TTTTATGGGGTGATGGAGAGGGG + Intronic
1177144849 21:17396332-17396354 ATTTATGTGGATGTGGAGAGAGG + Intergenic
1177639406 21:23827017-23827039 TTTTATGAGGTGATGGAGAGGGG - Intergenic
1178085562 21:29108254-29108276 TTTTGTGTGCGCATGGAGAGAGG - Intronic
1178224316 21:30698266-30698288 CTTTATTTGCAGAGGAGGAGGGG - Intergenic
1178903415 21:36615861-36615883 CTTTATGTCCAGATGGAGAAAGG - Intergenic
1179688183 21:43065853-43065875 CTTCAAGTGCAGGGGGAGAGAGG + Intronic
1179861804 21:44193434-44193456 CTGAATGTGCACATGGACAGCGG - Intergenic
1183012544 22:34958762-34958784 CTTCATGTGCAGAGAGAAAGTGG + Intergenic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1185051265 22:48555531-48555553 CTTTATGGGAAGAGGGAGAGAGG + Intronic
949892245 3:8741971-8741993 CACTGTGTGCAGTTGGAGAGAGG - Intronic
949984601 3:9530451-9530473 CATTCTGTGAAGATTGAGAGAGG - Intronic
950671750 3:14531526-14531548 CTCTATGTGCTGACAGAGAGGGG + Intronic
951483125 3:23182868-23182890 ATTTATGTGCAAATGGAAAGGGG + Intergenic
952930522 3:38357002-38357024 CTTCATGCGCAGATGCACAGAGG + Intronic
952980456 3:38729920-38729942 CTTTATGTGATGGGGGAGAGCGG + Intronic
953317847 3:41945117-41945139 CTTAATGTTCTGATGGAGACAGG - Intronic
954639493 3:52089555-52089577 CTAGATGTGCTGATGCAGAGAGG + Intronic
957901811 3:86504108-86504130 CTTTGTTTGCATATAGAGAGTGG + Intergenic
959861535 3:111221542-111221564 CTTTAATTGGGGATGGAGAGTGG - Intronic
960567265 3:119146853-119146875 CCTTCTGTGCAGATTGACAGTGG + Exonic
961278353 3:125745008-125745030 CCTTATATCCAGAGGGAGAGAGG - Intergenic
961804023 3:129475969-129475991 CTATATTTGCAGAGGGAGGGGGG + Intronic
961981345 3:131082466-131082488 CTTTCTGTGCTGATGGAAATGGG + Intronic
963579720 3:147110153-147110175 CTTTATGTGTAGAAGTGGAGAGG + Intergenic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
964174854 3:153815499-153815521 TTTTATGTACAGATTGAGATAGG - Intergenic
965384006 3:168024192-168024214 CTCAATGTGCAGAGGGAGAGAGG + Intronic
966120288 3:176512674-176512696 CTTTATGGAAAGGTGGAGAGAGG - Intergenic
966509810 3:180749322-180749344 CTTTAAGAGCAGAAGGAGGGTGG + Intronic
967575894 3:191092086-191092108 GTGTGTGTGCAGATAGAGAGAGG - Intergenic
968148043 3:196316013-196316035 CTTTGTTTAAAGATGGAGAGGGG + Intronic
970735921 4:19167753-19167775 TTTTATCTGAAAATGGAGAGAGG + Intergenic
971465702 4:26957751-26957773 CTAGATGTGCAGAAGGGGAGGGG - Intronic
972232588 4:37093010-37093032 CTCCATGTGTAGAGGGAGAGGGG + Intergenic
972981220 4:44704258-44704280 CTTCATGTCCAGTAGGAGAGGGG + Intronic
975389443 4:73799679-73799701 CTCTATGTGGGGAAGGAGAGTGG + Intergenic
975867367 4:78737865-78737887 TTTTATGTCCAGAAGAAGAGAGG - Intergenic
978045084 4:104115476-104115498 CTTTATTAGCAGATTGAGAATGG - Intergenic
978672786 4:111271188-111271210 CTTTATCTGCTGATAGAGATGGG + Intergenic
980097822 4:128511580-128511602 CCTTATATGCAGAGGTAGAGGGG + Intergenic
980518218 4:133893362-133893384 CTTTACTTGAAGATGAAGAGTGG - Intergenic
981077187 4:140603398-140603420 CATTGTGAGCAGATGGGGAGGGG - Intergenic
984496609 4:180505999-180506021 CTTTATGTGTAGATGGAAAAGGG - Intergenic
985066917 4:186131382-186131404 CTTTGTGTGTACATGGAGAGTGG - Intronic
986572709 5:9181718-9181740 GAGTATGTGGAGATGGAGAGGGG + Intronic
987172144 5:15270093-15270115 GTTTATGTCCTGATGCAGAGAGG - Intergenic
988171349 5:27660625-27660647 ATATATGTGCAAATGGGGAGGGG + Intergenic
989456484 5:41650045-41650067 CTATCTTTGCAGATGGACAGAGG + Intergenic
989648244 5:43659877-43659899 GTTTATCTCCAGATGGAGAGAGG - Intronic
990009792 5:50983088-50983110 CTTAATCTGCATTTGGAGAGAGG + Intergenic
990220339 5:53581473-53581495 GTTTATGTACAGCTGGAGATTGG - Intronic
991215132 5:64151434-64151456 CTTTGTTGGCAGATGGGGAGGGG - Intergenic
992573609 5:78086991-78087013 CTATATGTGCAGATTGATATAGG - Intronic
993149881 5:84147580-84147602 CTTTATGTGGAAGTGGAGAGTGG + Intronic
993523605 5:88936842-88936864 GTTTATTTGAAGATGAAGAGAGG - Intergenic
993799617 5:92316672-92316694 ATTTTTGTGCAAATGGAGAAAGG + Intergenic
993983882 5:94574063-94574085 CCCTATGGGCAGATGGAGATAGG + Intronic
997077171 5:130692874-130692896 CGTTTTGTGCACATGGAGATAGG - Intergenic
997823356 5:137085420-137085442 CTCTCTGTGCAGATGGTGAGTGG - Intronic
999226991 5:150033788-150033810 GTTTATTTGTATATGGAGAGAGG + Intronic
999714834 5:154352322-154352344 CTTTATGTCCACTTGCAGAGGGG - Intronic
999874590 5:155788757-155788779 CTTTATTTGCAGAGGCAGATAGG + Intergenic
1000942485 5:167379048-167379070 CTTTGGGTGGACATGGAGAGGGG - Intronic
1001736102 5:174003623-174003645 TTTAATGTGAAGATGGACAGAGG + Intronic
1001924080 5:175623554-175623576 TTTTATGGGGTGATGGAGAGGGG - Intergenic
1001975990 5:175999111-175999133 ATATATGTGCAAATGGAAAGAGG + Intronic
1002537910 5:179888245-179888267 CTTTTGGTGCTGATGGACAGGGG + Exonic
1004581290 6:16956047-16956069 CTGTATGTGTAGGTGGAGGGAGG + Intergenic
1004893994 6:20128954-20128976 CTGTAGGTTCACATGGAGAGGGG + Intronic
1005823650 6:29618713-29618735 CAATATGTGGAAATGGAGAGTGG - Intronic
1007481897 6:42155681-42155703 CTCTCTGGGGAGATGGAGAGAGG + Intronic
1008413334 6:51209522-51209544 CATTATTTGCAGATTGAGAATGG - Intergenic
1009047610 6:58248847-58248869 CATAATATGCAGAGGGAGAGAGG + Intergenic
1009788379 6:68367413-68367435 ATTTATGTGGAGAAGGAGACGGG - Intergenic
1009858671 6:69296009-69296031 CTATATTTGCATATGAAGAGTGG + Intronic
1010802422 6:80192295-80192317 CTCTATGTGCTGATGTAGAATGG + Intronic
1011759159 6:90541517-90541539 TTTTAAGGGCAGATGGACAGTGG + Intronic
1012774120 6:103480795-103480817 CCTTATATCCAGGTGGAGAGAGG - Intergenic
1014125329 6:117770324-117770346 CTTTATATGGAGAGAGAGAGAGG - Intergenic
1014712702 6:124826295-124826317 GTTTGTGTGCAGTGGGAGAGAGG - Intergenic
1015648596 6:135426045-135426067 ATTTATGTGAAGATTTAGAGTGG + Intronic
1015951160 6:138554003-138554025 CAGTATGTCCAGATGGAGGGAGG + Intronic
1015957163 6:138610765-138610787 CTTTATTTTCAGATGCAGGGAGG - Intronic
1016428061 6:143955468-143955490 ATTTATGTGGAGATGCAGTGAGG + Intronic
1016799758 6:148156693-148156715 CTCTATCTGGAGTTGGAGAGTGG + Intergenic
1017336134 6:153262486-153262508 CTGTAAGTGCACATGGAGAGTGG - Intergenic
1017536393 6:155351316-155351338 CTTTGTTTGCTGATGAAGAGAGG + Intergenic
1020203245 7:6096356-6096378 TTTTATGGGGTGATGGAGAGGGG + Intergenic
1021054790 7:16034493-16034515 TTTTATGGGGTGATGGAGAGGGG + Intergenic
1021840157 7:24715887-24715909 CTTCATTTGCAGAATGAGAGAGG + Intronic
1022039066 7:26562812-26562834 CTTTACTTGCAGATGGAGGTTGG - Intergenic
1022121714 7:27314714-27314736 ATTTCTGTGCAGAGGGAGAAAGG + Intergenic
1023738934 7:43260663-43260685 GTATCTGTGAAGATGGAGAGAGG + Intronic
1024377796 7:48658828-48658850 CTTCATGAGCAAATGAAGAGTGG - Intergenic
1027665466 7:81039190-81039212 CTTTATTAGCAGCTTGAGAGCGG - Intergenic
1029697889 7:102226380-102226402 CTCTAGGGGAAGATGGAGAGAGG - Intronic
1034708556 7:153170546-153170568 CTTTGTGTAGAGATGGGGAGGGG + Intergenic
1035324841 7:158058452-158058474 CACTGTGTGCAGATGGAGTGTGG - Intronic
1035324879 7:158058785-158058807 CACTGTGTGCAGATGGAGTGTGG - Intronic
1035324932 7:158059266-158059288 CACTGTGTGCAGATGGAGTGTGG - Intronic
1035324934 7:158059303-158059325 CACTGTGTGCAGATGGAGTGTGG - Intronic
1035324949 7:158059451-158059473 CACTGTGTGCAGATGGAGTGTGG - Intronic
1035324951 7:158059488-158059510 CACTGTGTGCAGATGGAGTGTGG - Intronic
1035325018 7:158060150-158060172 CACCATGTGCAGATGGAGTGTGG - Intronic
1035325026 7:158060261-158060283 CACTGTGTGCAGATGGAGTGTGG - Intronic
1035351525 7:158250464-158250486 GGTTAAGAGCAGATGGAGAGGGG - Intronic
1036105017 8:5829424-5829446 CTTTAGGTGCAGAGGGAAATGGG + Intergenic
1036780166 8:11641313-11641335 CTTTTAGTGGAGATGGAGATGGG - Intergenic
1037093115 8:14947059-14947081 CTTTTTTTTCAGATGGGGAGAGG - Intronic
1037365400 8:18116542-18116564 CTTTAGGTGCAGGTGCAGATGGG - Intergenic
1038274947 8:26113609-26113631 CTGTGGGTGGAGATGGAGAGTGG + Intergenic
1039273278 8:35906676-35906698 CTGTCTTTGCAGATGGACAGAGG - Intergenic
1040101988 8:43513670-43513692 CTTTATGTCCAGATGCAGAAAGG + Intergenic
1045548449 8:103149313-103149335 CTTTCTATGGAGATGGAGATTGG - Intronic
1046499083 8:115052538-115052560 CTTTTGGTGGAGATGGAGAATGG + Intergenic
1048871748 8:138804638-138804660 CTCTTTGTGCTGATGGAGAGCGG - Intronic
1048953532 8:139515283-139515305 CTATAGGTGCAGATGTAGAGAGG - Intergenic
1050353269 9:4760378-4760400 CTTTATGTCCACAAGAAGAGCGG - Intergenic
1052916829 9:33929520-33929542 CTTTATGTATTGATGGAGAGTGG + Intronic
1052984589 9:34477194-34477216 TTTTATGTGGAGATGGGGTGTGG + Intronic
1056668917 9:88606617-88606639 TTTAATGTGCACATGGAGAAAGG - Intergenic
1057431199 9:94996004-94996026 CTGCATGTGGAGGTGGAGAGTGG - Intronic
1057927680 9:99167740-99167762 ATTTATGTGAAAATGGAGAGGGG - Intergenic
1058056650 9:100455573-100455595 CTAGATGTGCAGAGGAAGAGAGG + Intronic
1058075778 9:100649279-100649301 ATTTTTGTACAAATGGAGAGGGG + Intergenic
1058734687 9:107883494-107883516 CTTTATGAGAAGCTGGGGAGGGG + Intergenic
1059682169 9:116596781-116596803 CTTTCTGTGCAGATGAAAATGGG + Intronic
1186648236 X:11530571-11530593 CTTAATTTGCAGACTGAGAGAGG + Intronic
1186778466 X:12889472-12889494 CATTCTGTGCAGATTGAGTGTGG + Exonic
1189354110 X:40298585-40298607 GTTCCTGGGCAGATGGAGAGGGG - Intergenic
1191077343 X:56469143-56469165 CTGTGTGGGCAGATGGGGAGGGG - Intergenic
1191185127 X:57603304-57603326 CTTTCTCTGCAGCAGGAGAGGGG + Intergenic
1192075275 X:67988807-67988829 ATGTATGTGTATATGGAGAGAGG + Intergenic
1193834809 X:86329054-86329076 GTGTATGTGCGGATGGGGAGGGG + Intronic
1194335853 X:92645020-92645042 CTTCATGGGCATATAGAGAGCGG - Intergenic
1194567941 X:95517026-95517048 CTTTGTTTCCAGATGGAGAAGGG + Intergenic
1196047083 X:111267710-111267732 CTTAATGGGGAGAGGGAGAGAGG + Intronic
1196835216 X:119807735-119807757 TTTTCTTTGGAGATGGAGAGAGG - Intergenic
1196837034 X:119823196-119823218 TTTTCTTTGGAGATGGAGAGAGG - Intergenic
1196838416 X:119835181-119835203 TTTTCTTTGGAGATGGAGAGAGG - Intronic
1198643958 X:138786364-138786386 CTTCAGGTGCAGATACAGAGTGG - Intronic
1200103717 X:153701111-153701133 CTTTGGGTGCAGCTGGGGAGGGG - Intronic
1200644289 Y:5761771-5761793 CTTCATGGGCATATAGAGAGCGG - Intergenic