ID: 1127632830

View in Genome Browser
Species Human (GRCh38)
Location 15:60842299-60842321
Sequence CTTGGCTGCCCATGGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 322}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127632824_1127632830 -5 Left 1127632824 15:60842281-60842303 CCCTGCAGGAATATCTTCCTTGG 0: 1
1: 0
2: 1
3: 15
4: 200
Right 1127632830 15:60842299-60842321 CTTGGCTGCCCATGGGCTGCAGG 0: 1
1: 0
2: 2
3: 26
4: 322
1127632820_1127632830 23 Left 1127632820 15:60842253-60842275 CCCCAAACAGCAATTTATTTAAT 0: 1
1: 0
2: 2
3: 50
4: 596
Right 1127632830 15:60842299-60842321 CTTGGCTGCCCATGGGCTGCAGG 0: 1
1: 0
2: 2
3: 26
4: 322
1127632822_1127632830 21 Left 1127632822 15:60842255-60842277 CCAAACAGCAATTTATTTAATAT 0: 1
1: 0
2: 5
3: 41
4: 569
Right 1127632830 15:60842299-60842321 CTTGGCTGCCCATGGGCTGCAGG 0: 1
1: 0
2: 2
3: 26
4: 322
1127632821_1127632830 22 Left 1127632821 15:60842254-60842276 CCCAAACAGCAATTTATTTAATA 0: 1
1: 0
2: 3
3: 51
4: 563
Right 1127632830 15:60842299-60842321 CTTGGCTGCCCATGGGCTGCAGG 0: 1
1: 0
2: 2
3: 26
4: 322
1127632826_1127632830 -6 Left 1127632826 15:60842282-60842304 CCTGCAGGAATATCTTCCTTGGC 0: 1
1: 0
2: 1
3: 27
4: 169
Right 1127632830 15:60842299-60842321 CTTGGCTGCCCATGGGCTGCAGG 0: 1
1: 0
2: 2
3: 26
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127632830 Original CRISPR CTTGGCTGCCCATGGGCTGC AGG Intronic
900264117 1:1748908-1748930 CTGAGCGGCCCATGGGCTGTGGG + Intergenic
900344156 1:2203219-2203241 CTTGGCCCCACCTGGGCTGCAGG - Intronic
901023679 1:6267942-6267964 CCTGGTTGAACATGGGCTGCAGG - Intronic
901836236 1:11925913-11925935 CGTGGCTGCCAATCGGCTGTGGG - Exonic
901917522 1:12511354-12511376 CTTGTCTGGCCCAGGGCTGCAGG - Exonic
902400410 1:16154143-16154165 CTCGGCTGCCCATGGGGGGGTGG - Intronic
903470762 1:23585678-23585700 CTTGACGGCCCAGGGGCTGGGGG + Intronic
904287063 1:29459662-29459684 CTTGGCTGCCCCTGGGGCCCTGG + Intergenic
904457446 1:30656109-30656131 CTCAGCTGCCCATGAGCTGAAGG - Intergenic
904594628 1:31635503-31635525 CAGGGCTGCCCAGGAGCTGCAGG - Exonic
904678428 1:32212615-32212637 CCTCCCTGCCCAGGGGCTGCTGG + Exonic
905255334 1:36678073-36678095 CTTGGCTCCACATGGGCAGTGGG + Intergenic
905464627 1:38143544-38143566 CTGGGCTGACCAAGGGCTGGTGG - Intergenic
905884457 1:41484355-41484377 CCAGGCTCCCCACGGGCTGCTGG - Intronic
907158945 1:52357621-52357643 CCTGGCTGCGCTTGGCCTGCAGG + Exonic
907383986 1:54113928-54113950 CATGACTGCCCAGGGGCAGCAGG + Intergenic
907384287 1:54115965-54115987 CATGACTGCCCAGGGGCAGCAGG + Intergenic
907629049 1:56061741-56061763 CTTGGCTGCCCAAGGACCCCAGG + Intergenic
907812318 1:57883611-57883633 CTTGGCTGCCTAAGATCTGCAGG - Intronic
915546489 1:156601656-156601678 CTTGGCTGCTCAAGGATTGCAGG - Intergenic
916484353 1:165244826-165244848 CTTGGATGCCCAAGGTCTCCAGG - Intronic
916925821 1:169519731-169519753 CTTGGCTGCTGAAGGGCTGGAGG - Intronic
918174480 1:182030455-182030477 CTTGACCCCCAATGGGCTGCAGG + Intergenic
919806812 1:201385417-201385439 CAGGGCTGGCCCTGGGCTGCAGG - Intronic
920019555 1:202944553-202944575 CTTTGCTGCCCATGCATTGCTGG - Intronic
922025052 1:221742206-221742228 CTAGGCTGCCCATTGGTCGCGGG - Intergenic
922039692 1:221884662-221884684 TATGGCTACCCATGGGCTTCTGG + Intergenic
922345562 1:224693458-224693480 CTTGGCTGCGCTTGGGCAGGGGG + Intronic
922734720 1:227972866-227972888 CTGGGCCGCACGTGGGCTGCTGG - Intergenic
922774466 1:228208378-228208400 CTAGGCTGGCCTGGGGCTGCGGG + Intronic
922891167 1:229062784-229062806 CTGTGCTTCCCATGGGCTGCAGG + Intergenic
924090275 1:240493881-240493903 GATGGCTGCCCAGGGGCAGCTGG + Intronic
924627642 1:245709121-245709143 CTAGCCTGCCAAGGGGCTGCTGG - Intronic
1065009347 10:21407524-21407546 CTTAGCTGTCCATGGACTGCAGG - Intergenic
1066010278 10:31188282-31188304 CTCAGCTGCCCAAGGGCTGGAGG + Intergenic
1066602751 10:37125570-37125592 CTGAGCTGCGCATGCGCTGCTGG + Intergenic
1067552218 10:47244086-47244108 CTTGGCTGGCCAAGGCCAGCAGG - Intergenic
1069719523 10:70540755-70540777 CTGGGCTGCACATAGACTGCTGG - Intronic
1070158164 10:73849153-73849175 CTAGGCTTCCTCTGGGCTGCAGG - Intronic
1071278334 10:84076806-84076828 CAAGGCAGCCCAGGGGCTGCAGG + Intergenic
1072685380 10:97533501-97533523 CTTGCCTGGCCTTGGGCTGGTGG + Intronic
1073069267 10:100782950-100782972 TGTGGCCTCCCATGGGCTGCTGG - Intronic
1074689400 10:115990808-115990830 CTGGGATTCCCATGGGCAGCTGG + Intergenic
1075456030 10:122585609-122585631 CTCTGCAGCCCATGGGCTGAGGG - Intronic
1075458158 10:122598312-122598334 CTCTGCAGCCCATGGGCTGAGGG - Intronic
1076024701 10:127101686-127101708 GCTGGCTCCCCTTGGGCTGCCGG - Intronic
1076421367 10:130334765-130334787 CTTCGCTGACCATGGGCTCCGGG - Intergenic
1076674402 10:132140687-132140709 CTTGGCTGGGCATGGGCTGCCGG + Intronic
1077485055 11:2834799-2834821 CTTGGCTGCCCCAGGAATGCAGG + Intronic
1078164210 11:8868901-8868923 CTGGGCGGCCCATGGGCCGCAGG - Intronic
1080295911 11:30727225-30727247 CTGGGCTGCACGTGGCCTGCTGG + Intergenic
1081811176 11:45914933-45914955 CTTGCCTGTCCATGGGTTCCGGG - Intronic
1081856114 11:46304960-46304982 ACAGGCTGCCCATGGGCTCCAGG - Intronic
1082037701 11:47658625-47658647 CTTGGCCTCCCAAAGGCTGCCGG + Intergenic
1083252786 11:61478975-61478997 CTTGCCTTCCCATGGGGGGCTGG + Intronic
1083296145 11:61716702-61716724 CCTGGCTCCCCATGGCCTGCAGG - Intronic
1083611375 11:64005955-64005977 CTTGGCTGCCAATGCCCTCCAGG - Intronic
1083775761 11:64893712-64893734 CCTGGCTGCCCACGGACAGCTGG - Intergenic
1083862229 11:65427430-65427452 CTTTCCTTCCCATGAGCTGCAGG + Intergenic
1083967671 11:66052462-66052484 CTGGGCTGCCCAGGAGCTTCAGG + Exonic
1084374421 11:68766276-68766298 CTAGGCTGCCCAAGGGGTCCAGG + Intronic
1084714877 11:70867336-70867358 CTTGGCTCCACACGGGCAGCAGG + Intronic
1085020003 11:73200615-73200637 CTTTGCTGCCTAGGGTCTGCAGG + Intergenic
1085693619 11:78685776-78685798 CTTGCCTGACCAAGGACTGCAGG - Intronic
1086236996 11:84643769-84643791 CTTGTATGCCCATTGGCTGCAGG - Intronic
1091266017 11:134271690-134271712 CTGGGCTGCCCCTGTGCAGCCGG - Intergenic
1094051593 12:26226631-26226653 CTTGGCTGGGCATCGGCTGCAGG + Intronic
1094635797 12:32226614-32226636 GTGGGATGCCCATGGCCTGCTGG - Intronic
1097184935 12:57191466-57191488 CGATGATGCCCATGGGCTGCTGG - Exonic
1097261040 12:57720423-57720445 ATTGTCCGCCCATGGGCTGAAGG + Exonic
1101201206 12:102438270-102438292 CTGGCCTGCACATTGGCTGCTGG + Intronic
1102770734 12:115473657-115473679 GTTTTCTGCACATGGGCTGCAGG + Intergenic
1102825346 12:115943871-115943893 CTTCCCTGCCCATGAGCTGATGG - Intergenic
1103561784 12:121796648-121796670 CTTGGCTGCCCATGAGCACTCGG + Intronic
1103721540 12:122978129-122978151 CTTGGCTGTCACTGGCCTGCTGG + Intronic
1103979931 12:124730332-124730354 CTCGCCTGCTCATGGGCTGTTGG + Intergenic
1104760791 12:131296645-131296667 CTGGGGTGCCCCTGGGCTGACGG - Intergenic
1104866941 12:131961366-131961388 TTGGGCTGGCCAGGGGCTGCAGG - Exonic
1104885490 12:132104734-132104756 TTGGGCTGGCCAGGGGCTGCAGG - Exonic
1112011772 13:95299504-95299526 TTTGGCAGCCCATGGGCCTCAGG - Intronic
1113432282 13:110261490-110261512 CTAGGGAGCCCTTGGGCTGCTGG - Intronic
1113544791 13:111139833-111139855 CTGGGAAGCCCATGGGCAGCTGG + Intronic
1116986478 14:51225173-51225195 CTGTGTTGCCCATAGGCTGCTGG - Intergenic
1118760367 14:68877265-68877287 CCTGTCAGCCCATGGCCTGCTGG + Intronic
1119807315 14:77490779-77490801 CTTGGCTGCCCAGAGGCCTCAGG - Intronic
1119872237 14:78027764-78027786 CTTGGATGCCAAGGGGATGCCGG - Intergenic
1122839066 14:104445958-104445980 TTTGGCTGTCCCTGGGATGCTGG + Intergenic
1122898974 14:104774289-104774311 CTTGGCACCTCAGGGGCTGCCGG - Intronic
1124688887 15:31805198-31805220 CTTGGCAGCCTCTGGGCTGATGG - Intronic
1124712738 15:32029503-32029525 CTCGGATGCCCGGGGGCTGCAGG + Intergenic
1124966555 15:34436827-34436849 CCTTGTTGCCCCTGGGCTGCAGG - Intronic
1126066787 15:44831870-44831892 CTGGGCTGCATGTGGGCTGCAGG - Intergenic
1126093044 15:45068685-45068707 CTGGGCTGCATGTGGGCTGCAGG + Intronic
1126233421 15:46354208-46354230 CGTTGCTGCCCTTGGGCTGGGGG + Intergenic
1126679600 15:51190458-51190480 ATGGGCTGCCCAGGGGCTGAGGG - Intergenic
1127632830 15:60842299-60842321 CTTGGCTGCCCATGGGCTGCAGG + Intronic
1128523584 15:68391516-68391538 GTTGGCTGCTCTTGGGCTGCAGG + Intronic
1128748973 15:70134943-70134965 CTTGGCTTCCCTTGGCCTGCAGG + Intergenic
1130204005 15:81859215-81859237 CTTGGTTGCCCGAGTGCTGCTGG + Intergenic
1132341015 15:101078709-101078731 CTTGGCTGTCTTTGGGATGCAGG + Intergenic
1132496519 16:265955-265977 CATGGCTGCCCTTGGGCCTCAGG - Exonic
1132508355 16:324052-324074 CTGGGCTCCCCATGGTCTGCAGG - Intronic
1132511330 16:343136-343158 CTTGACTGCTCTGGGGCTGCTGG - Intronic
1132543159 16:520895-520917 CTTGGCTCCTCATGGTCTGACGG - Exonic
1132571694 16:647056-647078 CTGGGCTGCTGATGGGATGCAGG + Intronic
1132603023 16:782295-782317 CTAGGGGACCCATGGGCTGCTGG + Intronic
1132623684 16:880084-880106 CTTGGCCGCCTGTGGGCAGCAGG - Intronic
1132685693 16:1161161-1161183 CTCGTCTGACCCTGGGCTGCTGG + Intronic
1132835804 16:1952834-1952856 CTGGGCCGTCCAAGGGCTGCTGG - Intronic
1132854907 16:2040392-2040414 CTTGGCTGCCCCTGAGGTGCTGG + Intronic
1133110947 16:3548107-3548129 TTGGCCTGCCCAGGGGCTGCAGG - Intronic
1133972640 16:10578763-10578785 CCTGGCTCCCCATGGGATGGAGG + Intronic
1134268816 16:12715860-12715882 CTGGGCTGCATACGGGCTGCAGG - Intronic
1134531870 16:14989836-14989858 CGTGGCTGCCAATCGGCTGTGGG - Intronic
1135542505 16:23342735-23342757 CTGGGCTGCCTGTGGCCTGCAGG + Intronic
1137559355 16:49492933-49492955 CTGCGGTGCCCATGGGGTGCAGG - Intronic
1137574273 16:49588255-49588277 CATGGATGCCCATGGTCTTCTGG - Intronic
1138148894 16:54637096-54637118 CTTGTCCCCCCATGGGCTGAGGG - Intergenic
1139190217 16:64854801-64854823 CTTGGTTCCCCAAGGGCTGATGG - Intergenic
1142134312 16:88444602-88444624 CTGAGCTCCCCATGGGCTCCAGG - Intergenic
1142810102 17:2391983-2392005 CTGGGCTGCCCCTGGGCTCTTGG + Intronic
1143103259 17:4515401-4515423 CTCTGCTGCCCATAGGCTGGGGG + Intronic
1143432676 17:6898618-6898640 CCTGGCTGACCGTGGGCTCCTGG + Intronic
1144586750 17:16491960-16491982 CCAGGCTGCCCTTGGTCTGCCGG + Exonic
1144740058 17:17576713-17576735 CTGGGCAGCCCAATGGCTGCTGG + Intronic
1144776679 17:17788288-17788310 GTTGGGTGCCCATAGGCTTCTGG - Intronic
1144870826 17:18369649-18369671 CTTTGCTGCCCATGAGCTTTGGG + Intergenic
1144913324 17:18701237-18701259 CTTGGCTGCCCATAGCTTGAAGG - Intronic
1146157281 17:30535149-30535171 CCTGGCTGCCTGTGGCCTGCTGG + Intergenic
1146303407 17:31709696-31709718 CTTGGCTGCCAAGGGGCACCCGG - Intergenic
1146397955 17:32483825-32483847 CTGGGCTGCCCGTGGACTGCCGG - Intergenic
1146666910 17:34711258-34711280 CTTGGTTCCCCAAGGGCTTCCGG + Intergenic
1146668932 17:34723500-34723522 CTTTGCCTCCCATGGGCTCCTGG - Intergenic
1146678720 17:34791884-34791906 CTGCCCTCCCCATGGGCTGCAGG + Intergenic
1146937616 17:36822113-36822135 CTGGGGTGCCCCAGGGCTGCTGG - Intergenic
1146976922 17:37121328-37121350 CTGGGCTGCCTGTGGGCTGGAGG - Intronic
1147615122 17:41822950-41822972 CTGAGCTGACCCTGGGCTGCTGG + Exonic
1147915303 17:43882141-43882163 GTCAGCTGCCCCTGGGCTGCAGG + Intronic
1148797340 17:50203335-50203357 CCTGGCTGCCCACGGCCAGCCGG - Intergenic
1150086327 17:62274998-62275020 CACGGCTGCCCAAGGGCAGCAGG + Intronic
1151662394 17:75525729-75525751 CGCGCCTGCCCACGGGCTGCTGG - Exonic
1151745859 17:76011435-76011457 CAGAGCTGCCCAGGGGCTGCAGG + Intronic
1151751859 17:76043672-76043694 CCTGACTGCCCAGGAGCTGCAGG - Intronic
1152988723 18:343175-343197 CTTGGCTGCCCCTTTGCTTCTGG + Intronic
1153493515 18:5673940-5673962 CAGAGCTGCCCAAGGGCTGCTGG - Intergenic
1153599941 18:6770735-6770757 CTCAGCTGCCCAAGGGCTGGAGG - Intronic
1157604953 18:48920592-48920614 ATGGGCTTCCCAAGGGCTGCCGG - Exonic
1157818156 18:50745911-50745933 CTTGGCTTCCCAGGGGCTTAAGG - Intergenic
1158181322 18:54717806-54717828 CGTGGCTGCCTATCGGCTCCTGG - Intergenic
1159178823 18:64874647-64874669 ATTGGCTCCCAATGGGCTACTGG - Intergenic
1161686206 19:5703919-5703941 CTCAGCTGCCCTTGGGCTGGTGG - Intronic
1161888907 19:7019469-7019491 CTTGGCTGCTGCAGGGCTGCAGG + Intergenic
1161890461 19:7032552-7032574 CTTGGCTGCTGCAGGGCTGCAGG - Exonic
1161890987 19:7038181-7038203 CTTGGCTGCTGCAGGGCTGCAGG + Exonic
1161892547 19:7051280-7051302 CTTGGCTGCTGCAGGGCTGCAGG - Exonic
1161893072 19:7056642-7056664 CTTGGCTGCTGCAGGGCTGCAGG + Exonic
1162831432 19:13286884-13286906 CTTGGCGGCCCAGGTCCTGCTGG + Exonic
1163699590 19:18780663-18780685 CCTGGCCCCCCATGGGCTTCTGG - Exonic
1164560614 19:29289516-29289538 CATGGCTTCCCATGAGCAGCTGG - Intergenic
1164635380 19:29787680-29787702 CTGGGCTGCTCCAGGGCTGCGGG - Intergenic
1165316397 19:35059048-35059070 GTTGGCTGCTCAGGAGCTGCAGG - Intronic
1165695006 19:37894365-37894387 CTTGGCTGGGCAAGGGCAGCGGG + Exonic
1165838707 19:38774186-38774208 CTCGGCTGCCCAGGAGATGCAGG + Intergenic
1166784201 19:45357972-45357994 CTGGGCAGCCCATGCGGTGCTGG - Intronic
1167072102 19:47227498-47227520 CCTCGCTCCCCTTGGGCTGCCGG + Intronic
1168267913 19:55232276-55232298 TTGGGCTGACCCTGGGCTGCAGG - Intronic
1168592239 19:57646946-57646968 ATAAGCTGCCCATGGGCTTCTGG + Intergenic
925033050 2:666272-666294 CTTGGCTGCCTGAAGGCTGCAGG + Intergenic
925276395 2:2651206-2651228 CCGGGCTTCCCATGGCCTGCAGG + Intergenic
925556534 2:5136920-5136942 CTTCTCTGCCCTTTGGCTGCAGG + Intergenic
927211519 2:20641843-20641865 CTTAGCTGCCCAGGAGCTGTGGG - Intronic
927293087 2:21423540-21423562 CTTGACTTCCCATGGACTGCAGG - Intergenic
927462017 2:23307411-23307433 CATTGCTGCCCTTGGGCTGTTGG - Intergenic
929549637 2:42881250-42881272 CAGGCCTGTCCATGGGCTGCAGG - Intergenic
929576182 2:43054314-43054336 CTTGTGTGCCCACGGGCTGGAGG + Intergenic
929647423 2:43641410-43641432 CTGGGCTGCCTGTGGCCTGCAGG - Intronic
929808476 2:45169247-45169269 CCTAGATGCCCATCGGCTGCGGG - Intergenic
931667366 2:64618940-64618962 CTGGGCTGCACGTGGCCTGCAGG - Intergenic
932493287 2:72134533-72134555 CTTCTCTCCCCATGGCCTGCAGG - Intronic
934519500 2:95010972-95010994 CAGGGCTGCCAATGGGCTGTAGG - Intergenic
937941696 2:127291182-127291204 CTTGGCTGCGAATTGCCTGCAGG - Intronic
940890782 2:159033446-159033468 TGTGATTGCCCATGGGCTGCGGG + Intronic
942446803 2:176083521-176083543 TTTCGCTGCCCGTGTGCTGCAGG + Exonic
942711099 2:178837433-178837455 CTGGGCATCCCCTGGGCTGCTGG + Exonic
946229374 2:218282139-218282161 CATGGCTGCTCACGGGCTGAGGG + Exonic
947712509 2:232324112-232324134 CTGGGCAACCCATGGGGTGCAGG - Intronic
947731472 2:232433792-232433814 CCGGGCAGCCCATGGGGTGCAGG - Intergenic
948748565 2:240113399-240113421 CTTGGGTGCCCGGAGGCTGCTGG + Intergenic
948825118 2:240570290-240570312 CTTGGCTTCCTATGGCCTACTGG + Intronic
1168903154 20:1382979-1383001 CTTTGCTGCCCAGGAGCTGCTGG - Intronic
1169959090 20:11138807-11138829 GTGGGCTGCCCCTGGGCTGGGGG + Intergenic
1170004186 20:11647195-11647217 CATGGCTGCCCATGGACTAATGG + Intergenic
1171372267 20:24669472-24669494 CTTGGCTGTCCAAGGGGTGGGGG + Intergenic
1172889385 20:38253155-38253177 CTTCTCTGACCTTGGGCTGCAGG - Intronic
1173644787 20:44626590-44626612 CTTCCCTTCCCAGGGGCTGCCGG - Exonic
1174182174 20:48681736-48681758 CCTACCTGCCCATGTGCTGCTGG - Intronic
1175777725 20:61663632-61663654 CTTGGCTGCCCAGGGGAAGCGGG + Intronic
1176171769 20:63699422-63699444 CTGGGCTGCTCAGGGGCTGGTGG - Exonic
1176290321 21:5040495-5040517 CCTGGCTGTCCAAGGGCTGAGGG - Intronic
1176338852 21:5624124-5624146 CTTGGCATCCTATGGACTGCAGG - Intergenic
1176340260 21:5687197-5687219 CTTGGCATCCTATGGACTGCAGG - Intergenic
1176472514 21:7119350-7119372 CTTGGCATCCTATGGACTGCAGG - Intergenic
1176504567 21:7637259-7637281 CTTGGCATCCTATGGACTGCAGG + Intergenic
1178638400 21:34325820-34325842 CTGGGCTGCATATGGCCTGCGGG - Intergenic
1178756389 21:35354139-35354161 CGTGGATGCCCAGGGGCTGAGGG - Intronic
1178757937 21:35370641-35370663 CCTGGAGGCCCCTGGGCTGCAGG + Intronic
1178920638 21:36736055-36736077 CGTGGCTGCCCGAGGGATGCGGG + Intronic
1178941788 21:36912787-36912809 CTTTGCTCCCCCTGGTCTGCAGG - Intronic
1179392104 21:41003460-41003482 CTTGGCATCCCTGGGGCTGCAGG - Intergenic
1179833423 21:44012444-44012466 CGGGGCTGCCCATGGGGCGCGGG + Exonic
1179866934 21:44223146-44223168 CCTGGCTGTCCAAGGGCTGAGGG + Intronic
1179908773 21:44437271-44437293 CCTCCCTGCCCAGGGGCTGCAGG - Intronic
1181484078 22:23219558-23219580 CTGAGTTGCCCATGGGCTGAAGG + Intronic
1182620217 22:31614739-31614761 CTGGGCTGACCAGGGGCTGCAGG - Intronic
1183278871 22:36921761-36921783 CTAAGCTCCCCGTGGGCTGCTGG - Intronic
1183329489 22:37211820-37211842 CTTACCTGCCCATGGGGTGAGGG + Exonic
1183398896 22:37589423-37589445 CTGGGGAGACCATGGGCTGCAGG + Intergenic
1183581217 22:38727744-38727766 CTTGTCTGCCCAGGGCCTGGGGG + Intronic
1183862814 22:40681848-40681870 CGAAGCTGCCCCTGGGCTGCAGG - Exonic
1184390881 22:44202403-44202425 CTGGGGTGCCCCTGGGCTGCAGG + Intronic
1184457316 22:44618536-44618558 CGTGGCTGGCCTGGGGCTGCTGG + Intergenic
949689694 3:6621483-6621505 CTTAGCTGTCCATGGACTACAGG + Intergenic
950004130 3:9680552-9680574 CGTGCCCGGCCATGGGCTGCAGG - Intronic
950186184 3:10947107-10947129 CTTGGCTTCCCAGGGGAGGCTGG - Intergenic
952958684 3:38576471-38576493 CGTGTCTGCCCATGGAGTGCTGG - Intronic
953731904 3:45457073-45457095 CTTTGCTGCCTGTAGGCTGCAGG + Intronic
954387735 3:50253113-50253135 CTGGGCTGACCATGGTGTGCAGG + Exonic
954408495 3:50358859-50358881 CCTGGCCACCCATGGGCTGATGG - Exonic
954409848 3:50365688-50365710 CTCGGCTCCCCGTGCGCTGCAGG - Exonic
954430832 3:50470149-50470171 CCTGGCTGCACATGGGCCCCTGG - Intronic
954664871 3:52246274-52246296 CTTGGAAGCCCCTGGGCTGCAGG - Exonic
954999023 3:54909557-54909579 CTGCACAGCCCATGGGCTGCAGG - Intronic
960946459 3:122970121-122970143 CTTGGCTGCCCACCTGCTGTGGG - Intronic
960987902 3:123292437-123292459 CTGTGCTGCCCATGGCCTGGTGG + Intronic
961438064 3:126932884-126932906 CCTGGCTGCCGCTGGGCTGAGGG + Intronic
961513732 3:127420156-127420178 CCCTCCTGCCCATGGGCTGCAGG - Intergenic
961745643 3:129062090-129062112 CCTCGCTGCCCATGGCCCGCTGG + Exonic
962312985 3:134339030-134339052 CTTGGCTGCCCCTGGATTGGGGG + Intergenic
962928924 3:140019875-140019897 CTTGGGTACCCAGGGGATGCTGG + Intronic
963045946 3:141102866-141102888 CTTGGCTGCCCTAGGGCTTGAGG - Intronic
964305440 3:155334533-155334555 CTAGGCTGCCTGTGGGCTTCTGG - Intergenic
964395851 3:156244773-156244795 CTTGGCTGCCAAGGGTCTGAGGG + Intronic
967336072 3:188346051-188346073 CTTGGCTGCACATTCGCTGCAGG - Intronic
968504569 4:965895-965917 TGTGGCTGGCCGTGGGCTGCTGG - Intronic
968746346 4:2362546-2362568 CATGGCTGCCCATGGACGTCTGG - Intronic
969202719 4:5618477-5618499 CGTGGCTGCCCCTGAGCTGCAGG - Exonic
969272658 4:6113313-6113335 GTTGGCAGACCATGGTCTGCAGG - Intronic
969429376 4:7145268-7145290 CTCAGCTGCCCAGGGGCAGCAGG - Intergenic
969576296 4:8038000-8038022 CTGGGCTCCCCAGGAGCTGCCGG + Intronic
970320960 4:14874971-14874993 CTTGGCTGCCCATCTTCTTCTGG - Intergenic
971570225 4:28202945-28202967 ATTGGATGCAGATGGGCTGCTGG - Intergenic
972406490 4:38751435-38751457 CTTGTCTGCCCATCTGCTTCTGG - Intergenic
972632888 4:40857204-40857226 CGCGGCCGCCCATTGGCTGCTGG + Intronic
972778499 4:42265525-42265547 GTAGGCAGCCCATGGGCTGTGGG + Intergenic
973230834 4:47837494-47837516 CTTGGCTGCACACTGGCGGCAGG - Intronic
975116154 4:70683453-70683475 CTGGGCTGCATATGGCCTGCAGG - Intronic
977559604 4:98518927-98518949 GTTGGCTTCCCATGGCTTGCTGG - Intronic
978184390 4:105839826-105839848 ATAGGCTGCCCATGGTCTCCTGG + Intronic
979378043 4:119972199-119972221 CTGGGCTGCACGTGGCCTGCAGG + Intergenic
981042663 4:140237762-140237784 CCTGGCTGCACATTGGCTGCTGG - Intergenic
985536838 5:469682-469704 CATGGCTGCCCATGGGCCGCAGG + Intronic
989523401 5:42425867-42425889 GTTGGCTTTCCATGGGCTTCAGG - Intronic
989602374 5:43212091-43212113 CTTGGATGCGCCTGGTCTGCTGG + Intronic
990375462 5:55166184-55166206 CTCTGCTGCCCATGTGGTGCTGG - Intronic
997649429 5:135504604-135504626 CTTGTCCTCCCATGGGCTTCAGG - Intergenic
998606686 5:143642616-143642638 CTGAACTGCCCATGGGCTGAGGG + Intergenic
999108458 5:149094116-149094138 CATGCCTGCCCTTGGGCTCCAGG - Intergenic
1000021204 5:157320868-157320890 CATGGCTGGCCATGGGCAGTGGG + Intronic
1000761454 5:165230295-165230317 CTTGTCTTCCCTTGGGCAGCCGG + Intergenic
1001209155 5:169794091-169794113 CAGGGCTGCCCTCGGGCTGCAGG + Intronic
1002054278 5:176589784-176589806 CTTGGCTGGGTATGGGCTTCTGG - Intronic
1002071501 5:176681153-176681175 CGTGGCTGCCCAGGGGTGGCAGG + Intergenic
1002300393 5:178254452-178254474 CTGGGGTACCCATGAGCTGCTGG + Intronic
1002304455 5:178275015-178275037 CTGGGCTGCACATGAGCAGCAGG + Intronic
1002372879 5:178768884-178768906 CATGGCTGCCTGGGGGCTGCAGG + Intergenic
1002452969 5:179330227-179330249 CCTGGCTCCCCAAGGCCTGCAGG - Intronic
1005371464 6:25138069-25138091 CTTGCCTGCCCATCGTCTGCCGG + Intergenic
1005885355 6:30093327-30093349 CGGGGCTGCCCATAGGCTGAGGG + Intergenic
1006286939 6:33103979-33104001 TTAGGCTGCCCATGGGCCCCGGG - Intergenic
1007162576 6:39803839-39803861 TTTTCCTGCCCAGGGGCTGCTGG + Intronic
1011617301 6:89208881-89208903 CCTGGCAGCCCTTTGGCTGCAGG - Intronic
1012714222 6:102648533-102648555 CTGGGCTGCCAATGGAGTGCTGG + Intergenic
1012849852 6:104433361-104433383 AATGGCTGCCCATGGGATCCAGG + Intergenic
1014236922 6:118968345-118968367 CTGGGCTGCATATGGCCTGCAGG + Intronic
1015451242 6:133368741-133368763 CTGGGCTGACCATGTGCTGCAGG + Intronic
1018663719 6:166114011-166114033 AATGACTGCCCCTGGGCTGCGGG + Intergenic
1018738066 6:166704585-166704607 CTTGGATGCCCATCGGCCCCAGG + Intronic
1019144191 6:169966383-169966405 CTTGGGAGCACATGGGCAGCAGG - Intergenic
1019166614 6:170101563-170101585 CTCGGCTTCCCATGGCCTCCCGG - Intergenic
1019433544 7:1010615-1010637 CCTGGCTCCCCCTGGGCTGCAGG + Intronic
1019667173 7:2257706-2257728 CTTGGCTGCTCCTTGGCTGGGGG - Intronic
1021248966 7:18300100-18300122 CTGGGCTGCACATGGCCCGCAGG - Intronic
1022381676 7:29866369-29866391 CTTGTCTCCCTATTGGCTGCAGG - Intronic
1022487642 7:30791959-30791981 CTGGGCTGCATGTGGGCTGCGGG + Intronic
1022537664 7:31107842-31107864 CTTGACTCACCATGGGCTGCTGG + Exonic
1022946172 7:35286636-35286658 CATGACTGCCCATGGGATGTGGG + Intergenic
1023556853 7:41432273-41432295 CTTGCCTCCTCATAGGCTGCTGG - Intergenic
1024074820 7:45812990-45813012 CTGGGCTGCACGCGGGCTGCCGG - Intergenic
1024618838 7:51139633-51139655 TTTGGCTTCCCATGGGTTGAAGG - Intronic
1028584322 7:92438067-92438089 GATGGCTACCCGTGGGCTGCAGG + Intergenic
1029460149 7:100689623-100689645 CTCGGCTTGTCATGGGCTGCTGG - Intergenic
1031743751 7:125468260-125468282 CGCGGCTGCCCATGGCATGCAGG + Intergenic
1032051538 7:128653500-128653522 CTGGGCCGCACGTGGGCTGCTGG - Intergenic
1032752573 7:134856360-134856382 CGTGGCTACCCATTGGCTACAGG - Intronic
1032850560 7:135791595-135791617 CTTGCCTGCCAATGGTTTGCTGG - Intergenic
1035234459 7:157487455-157487477 CGTGGGTAGCCATGGGCTGCAGG - Intergenic
1039060073 8:33566198-33566220 GTTGGTTTCCCACGGGCTGCTGG - Intronic
1039571427 8:38589668-38589690 ATGGGCTGCCCATGGCCTGTGGG + Intergenic
1042020568 8:64369383-64369405 CTTCGCGGCCGAGGGGCTGCCGG + Intergenic
1043049137 8:75362386-75362408 TTTGGCTCCCCATGGTCTCCAGG - Intergenic
1043513886 8:80977967-80977989 CCTGGCTTCCCAAGGGCTGAGGG + Intronic
1045065111 8:98437427-98437449 CCTGGGTGCCCAGGGACTGCTGG - Intronic
1045509602 8:102804748-102804770 CTTGCCTCCCAGTGGGCTGCTGG + Intergenic
1047117351 8:121858838-121858860 CTTTGCTGGCCATGAGCTGAGGG - Intergenic
1047743086 8:127822894-127822916 CTTGGCTCTCCATGGGTTACAGG - Intergenic
1047752417 8:127891802-127891824 TCTGCCTTCCCATGGGCTGCAGG - Intergenic
1048251280 8:132868688-132868710 CTAGGCTGCCTCTGGGCTTCTGG + Intronic
1048297194 8:133223142-133223164 CCTTGCTGCCCTGGGGCTGCTGG - Intronic
1048867293 8:138770344-138770366 GTGGGCTGTCCAGGGGCTGCTGG - Intronic
1048894451 8:138977419-138977441 CTGGGCTGCACATGGGATACTGG + Intergenic
1049229718 8:141475621-141475643 CTCCGCTTCCCTTGGGCTGCTGG + Intergenic
1049437771 8:142595598-142595620 CTTGGCTGGCCAAGGGCGCCTGG - Intergenic
1049710116 8:144059622-144059644 CTTGGGTGCCAATGTGCAGCAGG + Exonic
1050459317 9:5863656-5863678 CTTGCCTGCCCTTGGGAAGCTGG + Intergenic
1051278974 9:15422723-15422745 CGGGCCTGCCCATGGCCTGCCGG + Exonic
1055168010 9:73220036-73220058 CTTGAATGCCCATGTGTTGCAGG + Intergenic
1055315255 9:75028185-75028207 CCCGGCTGCCCGAGGGCTGCGGG - Exonic
1056062502 9:82898072-82898094 CTGAGCTGTCCATGGGCTGGGGG + Intergenic
1056456555 9:86766272-86766294 CTTGCCAGTTCATGGGCTGCTGG - Intergenic
1056804092 9:89714482-89714504 CTTGGCTCCTCATTGGCTGTTGG + Intergenic
1057165155 9:92919956-92919978 CTTGGCTGTCCAGGGCCTCCTGG + Intergenic
1057276877 9:93680761-93680783 TTTGGATGCCCCTGGGCTGTGGG + Intergenic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1058668660 9:107342473-107342495 CTCCCCTGCCCAGGGGCTGCAGG - Intergenic
1059413961 9:114151855-114151877 CTCAGCTGCCCATGAGCTCCTGG + Intergenic
1061218651 9:129236400-129236422 CTGGGCAGCCCTGGGGCTGCAGG + Intergenic
1061806368 9:133139719-133139741 CCTGGCTCCCCAAGGGCAGCGGG + Intronic
1062044846 9:134420214-134420236 CTCGCCTGCCCATCGGCTGCAGG - Intronic
1062157883 9:135063813-135063835 CCTGGATGCCCATTTGCTGCAGG - Intergenic
1203422807 Un_GL000195v1:10796-10818 CTTGGCATCCTATGGACTGCAGG + Intergenic
1187366355 X:18668806-18668828 CGTGGTTGCCCAGGGGCTGGGGG + Intronic
1188777583 X:34240040-34240062 CTTGTCTGCCCATTGGCTCAGGG - Intergenic
1189269897 X:39743806-39743828 CATGGCTGTCCACTGGCTGCTGG - Intergenic
1192859966 X:75057184-75057206 ATTGGCTGCCTATGGGATGTGGG - Intronic
1194482363 X:94442010-94442032 CTTCAGTGCCCATGGGTTGCTGG - Intergenic
1199770520 X:150972484-150972506 CATGGCTTCCCATTGCCTGCTGG + Intergenic
1199772355 X:150983227-150983249 CTCGCCTGGCCATTGGCTGCGGG - Intronic
1199967891 X:152834876-152834898 ATTGTCTGCCCATGGACTGAAGG + Intronic
1200067768 X:153512377-153512399 CCTGGCTGCCCCTGTGCAGCAGG - Intergenic
1200071670 X:153532302-153532324 CTGGGCTGCCCAGGGCCTGGAGG + Intronic
1200202879 X:154294840-154294862 CTTGGGTTCCCATGTTCTGCTGG - Intronic