ID: 1127639619

View in Genome Browser
Species Human (GRCh38)
Location 15:60903756-60903778
Sequence AATTATGCAAAATCGGAGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127639613_1127639619 1 Left 1127639613 15:60903732-60903754 CCTTCCCAGGGACCATGAATTTA 0: 1
1: 0
2: 1
3: 21
4: 142
Right 1127639619 15:60903756-60903778 AATTATGCAAAATCGGAGGTCGG 0: 1
1: 0
2: 0
3: 8
4: 94
1127639615_1127639619 -4 Left 1127639615 15:60903737-60903759 CCAGGGACCATGAATTTAAAATT 0: 1
1: 0
2: 1
3: 19
4: 220
Right 1127639619 15:60903756-60903778 AATTATGCAAAATCGGAGGTCGG 0: 1
1: 0
2: 0
3: 8
4: 94
1127639614_1127639619 -3 Left 1127639614 15:60903736-60903758 CCCAGGGACCATGAATTTAAAAT 0: 1
1: 0
2: 0
3: 19
4: 196
Right 1127639619 15:60903756-60903778 AATTATGCAAAATCGGAGGTCGG 0: 1
1: 0
2: 0
3: 8
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127639619 Original CRISPR AATTATGCAAAATCGGAGGT CGG Intronic
900096031 1:940446-940468 AATTACCCGAAAGCGGAGGTGGG - Intronic
907031373 1:51175581-51175603 AATAATGCAAAACCAGAGGTAGG - Intergenic
907086423 1:51679325-51679347 AATTATGGAAAACAGGATGTTGG - Intronic
907703830 1:56815698-56815720 AATTATAAAATATAGGAGGTGGG - Intronic
908817118 1:68045819-68045841 AATTATCCAATATGGGAGGGGGG - Intergenic
918392318 1:184079252-184079274 ATTTAAGCAAAATCAGAGATTGG + Intergenic
921495188 1:215830501-215830523 AGTTATGCAAATTTGGAGGCAGG + Intronic
921693497 1:218180447-218180469 AATTCTGGAAAATCGGAGTGGGG + Intergenic
921990153 1:221357201-221357223 AATTCTGCATAATCTGAGATTGG - Intergenic
922015617 1:221643511-221643533 AATTATGTAAAATCAGAACTTGG - Intergenic
1066113176 10:32215384-32215406 AATTATGCAAAATTGAAAATAGG - Intergenic
1067218133 10:44320120-44320142 ATTTCTGCAAAAGAGGAGGTTGG - Intergenic
1068831272 10:61498013-61498035 AAGGAAGCAAAATAGGAGGTAGG - Intergenic
1075538647 10:123294068-123294090 AAATATGCACTATCAGAGGTCGG + Intergenic
1081375720 11:42355760-42355782 AATAAAGCAAAGTCTGAGGTAGG + Intergenic
1082057059 11:47826925-47826947 AATGATGCAAAATCAGTGGTGGG + Intronic
1085515478 11:77109408-77109430 AATTAGTCACTATCGGAGGTGGG - Intronic
1087587219 11:100137799-100137821 AATTATGCAAAAGATGATGTGGG + Intronic
1088618741 11:111660605-111660627 CATTATGGAAAATCTGAGGAAGG - Intronic
1092763035 12:11826688-11826710 AATAATGTAAAATCCCAGGTGGG + Intronic
1093143060 12:15532692-15532714 GATTATGCAAAGTTGGAAGTTGG - Intronic
1099909634 12:88813801-88813823 AATTAAGCAAATAGGGAGGTTGG - Intergenic
1101358048 12:103999251-103999273 AATTATACATAAGCGGAGTTTGG + Intronic
1104802411 12:131563357-131563379 TATTATGTATAATGGGAGGTAGG - Intergenic
1106920189 13:34554958-34554980 AATCAAACAAAATTGGAGGTAGG + Intergenic
1108530770 13:51325157-51325179 ATTTATGCAAAATAGCAGGTGGG - Intergenic
1109765929 13:66897322-66897344 AATTATGAAAAAAGAGAGGTTGG + Intronic
1110303379 13:73955928-73955950 AAATGTGGAAAAGCGGAGGTGGG - Intronic
1113062177 13:106334288-106334310 AATTATTCAAAAAAGGAGATGGG - Intergenic
1116751619 14:48893037-48893059 AATTATACAAAATATGAGATTGG + Intergenic
1117487058 14:56208500-56208522 AATGATGCAAAAGCAGTGGTGGG + Intronic
1119162097 14:72461169-72461191 AATTATTCAAATTCTGAGTTGGG - Intronic
1125917187 15:43498828-43498850 AATTATCCAAGATTGGAGCTGGG + Intronic
1127639619 15:60903756-60903778 AATTATGCAAAATCGGAGGTCGG + Intronic
1127732691 15:61815252-61815274 AAATAAGCAAAATAGGAGGTGGG + Intergenic
1128170430 15:65506807-65506829 ATTTATGTAAAATCAAAGGTTGG - Intronic
1137423845 16:48359832-48359854 AATTATCCAGAATCAGTGGTGGG + Intronic
1138756106 16:59487523-59487545 AATTCTGTAAAATATGAGGTTGG + Intergenic
1145088922 17:19970104-19970126 AATTATGGAAGATGGCAGGTAGG - Intronic
1148876670 17:50691514-50691536 AAATATGAAAAATCAGAGGGAGG - Exonic
1149351619 17:55794114-55794136 TATGATGCAAAAAAGGAGGTTGG - Intronic
1149388697 17:56168585-56168607 AATTATCCAAAATGGTAAGTTGG - Intronic
1155227591 18:23742782-23742804 AATTATGCAAAATAAAAAGTTGG + Intronic
1156721309 18:40073288-40073310 AATTTTGCAGAAACTGAGGTGGG + Intergenic
1158112915 18:53961734-53961756 ATTTATTAAAAATCTGAGGTTGG - Intergenic
1159239289 18:65720449-65720471 ATTTATGCAAAAAAGGATGTTGG - Intergenic
1159244175 18:65783421-65783443 ACATATGCAACATAGGAGGTTGG + Intronic
1161115156 19:2492714-2492736 AATGATGGAAAATCACAGGTGGG - Intergenic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
1168716282 19:58529763-58529785 AAATATGCAGAATCTGGGGTGGG - Intronic
926023937 2:9522944-9522966 ACTTAAGCATAATCGGAGGGGGG + Intronic
935865025 2:107378167-107378189 AATAATGCAAAACTGGAGATGGG + Intergenic
937336327 2:121064548-121064570 AATTATGCTCCAACGGAGGTGGG - Intergenic
939366288 2:141236486-141236508 AAGTATGCAAAATCACAGGCAGG + Intronic
946940544 2:224765557-224765579 AAATGTGCAAATTCAGAGGTTGG + Exonic
1169778467 20:9282677-9282699 AATTCTGCAAAATTTGAGGGTGG - Intronic
1173615706 20:44401584-44401606 AATGATACAAAATGGTAGGTTGG + Intronic
1174315282 20:49695144-49695166 GATTATGAAAAATTGGAGTTAGG - Intronic
1176911775 21:14574192-14574214 AATTATGGACAATCTGAGGTGGG - Intronic
1182909935 22:33974401-33974423 AATTATGCAAAACAGTAGGGAGG + Intergenic
1183191603 22:36325129-36325151 AAGAATGGAAAATCGGGGGTAGG + Intronic
1184317574 22:43708472-43708494 AATAATACAAAATAAGAGGTAGG + Intronic
952623641 3:35377029-35377051 AATTCTACCAAATTGGAGGTTGG - Intergenic
961212694 3:125138098-125138120 AATAATGTAAAATCGGGGGAGGG + Intronic
965862358 3:173161901-173161923 ATTTATGCAAAATGGCAGGGTGG - Intergenic
973590050 4:52432164-52432186 AATTATGCCAAAGAGGAGGAAGG + Intergenic
981518594 4:145636604-145636626 AAATGTGCAAAATCAGAGTTGGG - Intronic
982442829 4:155456949-155456971 TATTATGGAAAAGGGGAGGTGGG + Intergenic
983091369 4:163506579-163506601 AATCATGCAAAATCAAAGCTGGG - Intronic
984461251 4:180039956-180039978 TAATATTTAAAATCGGAGGTTGG - Intergenic
986785868 5:11113334-11113356 AATTATGCACAACCGGCTGTGGG - Intronic
988977202 5:36527086-36527108 AATTATGGAAAATGTGAGGAAGG + Intergenic
999219612 5:149963709-149963731 AAATATGCAAAATAGCAGGCCGG - Intronic
1000194402 5:158943882-158943904 GATTATGCAAAATCAGCAGTTGG + Intronic
1008563091 6:52740941-52740963 AAATATCCAAAAACGGAGGGTGG - Intergenic
1008664138 6:53699228-53699250 GATTTTGCAAAATCGTAGCTTGG + Intergenic
1008704953 6:54146205-54146227 AAATATGCAAGAAAGGAGGTTGG - Intronic
1008803752 6:55402506-55402528 AATTATGCAAAATGTGACTTGGG - Intergenic
1008977274 6:57442468-57442490 AATTATGCAAAACAGCAGATGGG + Intronic
1009165408 6:60335417-60335439 AATTATGCAAAACAGCAGATGGG + Intergenic
1014513377 6:122352985-122353007 ACTTATTCAAAATTGAAGGTTGG - Intergenic
1014529945 6:122546792-122546814 AAATATGCAAAATCAGAGATAGG + Intronic
1017196766 6:151709905-151709927 AATTTTAGAAAATAGGAGGTGGG - Intronic
1019790749 7:3012009-3012031 AATTATGCAAAGGGGCAGGTAGG - Intronic
1022508413 7:30920954-30920976 AATTTTGCAAAATCCAAGGTAGG - Intronic
1026867557 7:73832842-73832864 AATTGTGAAAAATTGGAGCTGGG + Intergenic
1028676443 7:93468631-93468653 AATTCTGCAAGAGTGGAGGTGGG - Intronic
1028765704 7:94556632-94556654 AAATATTTAAAATAGGAGGTGGG - Exonic
1031671938 7:124559331-124559353 GATCATGCAAAATCAGTGGTGGG + Intergenic
1031882906 7:127217149-127217171 AAGCATGCAAAATAGGAGGGTGG + Intronic
1035004813 7:155648207-155648229 AAATATACAAAAGTGGAGGTGGG - Intronic
1045468833 8:102493075-102493097 AATTATGGATAATTGGAGGAGGG - Intergenic
1048635225 8:136288038-136288060 AATTTAGCAAAATTGGATGTTGG - Intergenic
1049735106 8:144200665-144200687 AATTTTGCAAAATAGTAAGTAGG - Intronic
1050743914 9:8856006-8856028 AATTATGGAATGTGGGAGGTAGG + Intronic
1058841029 9:108909198-108909220 AATTAAGCAAAATAAGGGGTAGG - Intronic
1185863294 X:3599718-3599740 AGTTATGAAAAATAGGAGCTTGG + Intergenic
1186916407 X:14227071-14227093 AATTATGAAAGATCTGAGGGTGG + Intergenic
1192399629 X:70821840-70821862 CATTATGCAAAATAGTAGGAAGG + Intronic
1194401033 X:93438046-93438068 AATTAGGGAAAAGGGGAGGTAGG - Intergenic
1196936109 X:120732905-120732927 AATTATGTAAAAGCGGCCGTGGG + Intergenic
1197832079 X:130653782-130653804 AATAATGGAAAATAAGAGGTGGG + Intronic
1198380893 X:136082386-136082408 AATTATGCAAAAATAGAGATGGG + Intergenic