ID: 1127642914

View in Genome Browser
Species Human (GRCh38)
Location 15:60932278-60932300
Sequence CTGCCTTGGAATCTGGTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 210}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127642914_1127642918 5 Left 1127642914 15:60932278-60932300 CCTTGGACCAGATTCCAAGGCAG 0: 1
1: 0
2: 0
3: 17
4: 210
Right 1127642918 15:60932306-60932328 TGTAAACTCAGCCACGATTAGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1127642914_1127642922 19 Left 1127642914 15:60932278-60932300 CCTTGGACCAGATTCCAAGGCAG 0: 1
1: 0
2: 0
3: 17
4: 210
Right 1127642922 15:60932320-60932342 CGATTAGGGCTGGGTCATTCTGG 0: 1
1: 0
2: 0
3: 2
4: 50
1127642914_1127642919 9 Left 1127642914 15:60932278-60932300 CCTTGGACCAGATTCCAAGGCAG 0: 1
1: 0
2: 0
3: 17
4: 210
Right 1127642919 15:60932310-60932332 AACTCAGCCACGATTAGGGCTGG 0: 1
1: 0
2: 0
3: 3
4: 69
1127642914_1127642920 10 Left 1127642914 15:60932278-60932300 CCTTGGACCAGATTCCAAGGCAG 0: 1
1: 0
2: 0
3: 17
4: 210
Right 1127642920 15:60932311-60932333 ACTCAGCCACGATTAGGGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 218
1127642914_1127642917 4 Left 1127642914 15:60932278-60932300 CCTTGGACCAGATTCCAAGGCAG 0: 1
1: 0
2: 0
3: 17
4: 210
Right 1127642917 15:60932305-60932327 TTGTAAACTCAGCCACGATTAGG 0: 1
1: 0
2: 0
3: 4
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127642914 Original CRISPR CTGCCTTGGAATCTGGTCCA AGG (reversed) Intronic
900186428 1:1335219-1335241 CTGCCTTGGAATGAGGCACAGGG - Exonic
901018948 1:6246255-6246277 CGGGCTTGGAATGTGGGCCAGGG - Intergenic
901538798 1:9901338-9901360 TCTCCTTGGAAACTGGTCCAAGG + Intronic
902711669 1:18244195-18244217 CTGCCCTTGAATCTGTCCCATGG - Intronic
903802233 1:25977774-25977796 CTGCCTTATAAACTGGTCCGAGG + Intronic
904962698 1:34347238-34347260 CTACCATGGAGTCTGGTCCATGG + Intergenic
906361329 1:45162491-45162513 CTGCTTTGGCTTATGGTCCATGG - Intronic
906481006 1:46198706-46198728 GTGCCCTGTGATCTGGTCCAAGG - Intronic
906645667 1:47472585-47472607 GTGCCTTGGAACCTGGTGCATGG + Intergenic
908256034 1:62304480-62304502 CTGGATTGGAAGCAGGTCCAGGG - Intronic
908848586 1:68350436-68350458 CTGCCTTGGTATCTGCTTCCAGG + Intergenic
909005123 1:70266861-70266883 CTACCTTGGTATATGTTCCATGG + Intronic
909047975 1:70733151-70733173 CTACTTTGGAATATGTTCCATGG + Intergenic
909566288 1:77056899-77056921 CTGCCTTGATTTCTGGTCCTTGG - Intronic
910151779 1:84156598-84156620 CTTTCTTGAAATCTAGTCCAGGG + Intronic
911039071 1:93578176-93578198 CTGCCTTGGAGGCTGCTGCACGG + Intronic
912554583 1:110506953-110506975 CAGCTTTGGCATCTGGCCCACGG + Intergenic
913291062 1:117272433-117272455 CAGCCTTGGAAACTCCTCCAGGG + Intergenic
916213983 1:162380646-162380668 AGGCCTTGGAATCTGGGTCAAGG - Intronic
917763851 1:178196689-178196711 CATCCTTGGATTCTGGTACATGG + Intronic
920882165 1:209890079-209890101 CTGCACTGGAATCTGGGCCTTGG - Intergenic
921303347 1:213771335-213771357 CTACCTTGGATTCTGATCCATGG - Intergenic
922149554 1:222986567-222986589 CTGCCTGGCGTTCTGGTCCAGGG - Intronic
924686880 1:246301987-246302009 CTCCCTGGGAGTCTGTTCCAAGG - Intronic
1066054056 10:31663757-31663779 CAGCCTTGGGATCTGACCCAGGG - Intergenic
1067847801 10:49737279-49737301 CTGTCTTGGAAAATGGTCCTGGG - Intronic
1068594332 10:58886646-58886668 CTGCCTTGCAATTTGGTAGAAGG + Intergenic
1068839623 10:61595998-61596020 ATGCCTTGGCATCTGTTCCCAGG + Intergenic
1070523697 10:77276664-77276686 CTCCCTGGGGATCTGGTTCAGGG - Intronic
1070652713 10:78249573-78249595 CTGCCTTGGTGTCTGGTCTTGGG + Intergenic
1070728324 10:78807663-78807685 CTGCCTTGGAGACTGTCCCAGGG - Intergenic
1071451196 10:85792663-85792685 CTGCCTTTGAACCTGCCCCATGG - Intronic
1074695266 10:116044888-116044910 CTACCCTGGAATCTGGGCAATGG + Intergenic
1076292026 10:129352855-129352877 CTGCCTTTGAACCTGCTCCTAGG + Intergenic
1076924484 10:133475586-133475608 CTTCCTGTGAATCTGGTGCAAGG + Intergenic
1076990775 11:272429-272451 CGGCCTTGGAGACAGGTCCAAGG + Intergenic
1079280786 11:19085229-19085251 CTGTTTGGGAATGTGGTCCAAGG - Intergenic
1080869907 11:36228194-36228216 CTGCCATGGAAGAGGGTCCAAGG - Intronic
1081411381 11:42762500-42762522 CTGCCCTGGAATGTAGCCCAGGG - Intergenic
1081468128 11:43344091-43344113 CTCCCTTGGAATCTGAACAAAGG + Intronic
1081580315 11:44347288-44347310 CTGCCTTGGATGCTTGCCCAAGG - Intergenic
1083286225 11:61660855-61660877 CTGCCTTGGGGTCTGGACCGGGG + Intergenic
1084636146 11:70394248-70394270 CAGCCTAGGAAGCTGGTCCACGG + Intergenic
1085022994 11:73220707-73220729 CTGTCTTGGAGTCTGGTCAGAGG + Intronic
1085380011 11:76107300-76107322 CAGACTTGGATTCTGGTCCCTGG + Intronic
1086241549 11:84699609-84699631 CTTGCTTAGAATCTGGTACAGGG + Intronic
1086753872 11:90533600-90533622 CTGTCTTTGCATCTGGCCCATGG + Intergenic
1088550568 11:111008911-111008933 CTGGCTTGGGAACGGGTCCAAGG + Intergenic
1089174850 11:116540887-116540909 CTGCCTGGGAATATGCCCCACGG - Intergenic
1091725647 12:2844898-2844920 CTGTCTTGGAATTTGGACAATGG + Intronic
1091802593 12:3334008-3334030 GTCCCTGGGAAGCTGGTCCACGG + Intergenic
1093021745 12:14210277-14210299 CTGCCTCAGAATTTGGTTCATGG - Intergenic
1093881763 12:24412706-24412728 CTCTCTTGGAATATGTTCCATGG + Intergenic
1095271480 12:40224705-40224727 CTGCGGTGGAATCTGGTCCCAGG + Intronic
1095482370 12:42649789-42649811 CTGCCTTAGAAGCTGGGGCATGG + Intergenic
1096477584 12:51917796-51917818 CTGCCCTGCAGCCTGGTCCAAGG - Intronic
1096478874 12:51924794-51924816 CTTCCTTGGAGGCTGGTGCAAGG - Intergenic
1096517640 12:52165889-52165911 CTGCCTTGGGTTCTGGTCCTGGG + Intergenic
1097182718 12:57180289-57180311 CTGCCGGGGAGTCTGGCCCAGGG - Intronic
1098170517 12:67742281-67742303 CTGACCTAGAGTCTGGTCCAGGG + Intergenic
1098394368 12:70002799-70002821 CTGCCCTGGAAACTAGTCAAAGG + Intergenic
1101532543 12:105587056-105587078 CTGGCTTGGAATCTCGTGCCAGG + Intergenic
1102932966 12:116876576-116876598 CTGCCTGGGAGTCGGGGCCAGGG - Intronic
1103269537 12:119661581-119661603 ATGTCTTGGTTTCTGGTCCAGGG - Intergenic
1104387969 12:128367130-128367152 CTGCCTTTCCTTCTGGTCCAGGG - Intronic
1105579701 13:21683684-21683706 CAGGCTTGGAAACTGCTCCAAGG + Intronic
1111195968 13:84874689-84874711 CTTCCTTGGATTCTGGCTCATGG - Intergenic
1112909003 13:104458905-104458927 CTGCCTTGGCATCTGCTTCTTGG + Intergenic
1113121407 13:106927253-106927275 CTGCCCTAGACTCTGTTCCAAGG - Intergenic
1115769252 14:36654061-36654083 CTGCCTTCCAATCGTGTCCATGG + Intergenic
1116692387 14:48125910-48125932 CTGCCTTGAAATCTGATCTCTGG - Intergenic
1119318379 14:73714214-73714236 CTGCCTTCGTTTCTGGTCCTCGG - Exonic
1120724776 14:87925864-87925886 CTGCCCTGGAATCTGGTAAGTGG - Intronic
1120923190 14:89773323-89773345 CTGCATGGGAAGCTGGTTCATGG + Intergenic
1121038020 14:90722706-90722728 CTTCCATGGTATCTGATCCAGGG + Intronic
1123097137 14:105772057-105772079 CTGCCTTGGAATATCGCCCCGGG + Intergenic
1125072077 15:35567275-35567297 TTGCCTAGCAATCAGGTCCAAGG + Intergenic
1125445071 15:39745588-39745610 CTGCCATGGCATCCTGTCCAGGG - Intronic
1125535460 15:40439493-40439515 CAGCCTTGGAGTGTGGCCCAGGG - Intergenic
1126119308 15:45237090-45237112 CTTCCTTGGATTCTGGCTCATGG + Intergenic
1127642914 15:60932278-60932300 CTGCCTTGGAATCTGGTCCAAGG - Intronic
1128122010 15:65157111-65157133 CTGCTTTGTAATCTGCTCTACGG + Intronic
1128611149 15:69074499-69074521 CAGCCTTGGCTTCGGGTCCAGGG - Intergenic
1128789987 15:70426117-70426139 GAGCCTGAGAATCTGGTCCAAGG - Intergenic
1129433568 15:75519469-75519491 CTGCCTTGGAATTTGTTAAAGGG - Intronic
1129511109 15:76123398-76123420 CTGCTTTAGAATCTGCTCCTAGG - Intronic
1130234833 15:82124476-82124498 GTCCCTTGGAGTCTGGTCTAGGG + Intergenic
1132139781 15:99382728-99382750 GTGACTTGGTATATGGTCCATGG + Intronic
1134109239 16:11504253-11504275 CTGCCTAGAAATCAAGTCCAGGG + Intronic
1134675847 16:16090121-16090143 CGGCCCTGGAATCTGGGGCAGGG + Intronic
1135076240 16:19396178-19396200 CTTCCTTGGATTCTGGCTCATGG + Intergenic
1135521360 16:23181151-23181173 ATGCCTTGGTTGCTGGTCCAAGG - Intergenic
1136142711 16:28297787-28297809 CTTCCTTGGGAGCTGGTCTAGGG + Intronic
1137267311 16:46879920-46879942 ATGCCTTGGCTTATGGTCCAGGG - Intergenic
1137280133 16:46969630-46969652 CTGCCTGGGAATCTCTGCCAAGG + Intronic
1137337017 16:47559664-47559686 CTGCCTGGGATTCTGGGCCTTGG - Intronic
1137587834 16:49674740-49674762 CTGCCTTCCCATCTGTTCCAAGG - Intronic
1138117116 16:54369624-54369646 CTTCCTTGTAATCTGGGCAAAGG - Intergenic
1139750270 16:69105918-69105940 TTGCCTTGGCAGCTGGTCCCAGG + Intronic
1141745040 16:85919947-85919969 CTTGCTTGGAATTTGGCCCAAGG + Intronic
1143270251 17:5669955-5669977 CTGCCTTGGACTCTGATGCAGGG - Intergenic
1143374442 17:6458954-6458976 CTGCCTTCGATGCTGGACCAAGG + Intronic
1143518602 17:7432600-7432622 CTGCCTGGGTGCCTGGTCCAGGG - Intergenic
1143634056 17:8154366-8154388 CTGCCTCGGAATGTGGGGCAGGG + Intronic
1144009574 17:11133853-11133875 CTGCCTTGAATTCTACTCCAAGG + Intergenic
1144639611 17:16930330-16930352 CTGCGTGGGAGACTGGTCCAGGG - Intronic
1146290511 17:31603335-31603357 CTGCCCTGGATGCTGGTCCCTGG - Intergenic
1146519087 17:33512353-33512375 TAGCCTTGGAACCTGGTCCATGG - Intronic
1147326592 17:39672614-39672636 CAGCCTTGGAGTCTGTTCTAGGG - Exonic
1149374969 17:56034604-56034626 CTGCCCTGGAATATGGCCCAGGG - Intergenic
1151348865 17:73519764-73519786 CAGCCTTGGAATCTGTTCCTGGG - Intronic
1151413741 17:73948100-73948122 CTGTCTTGGCATCTGCTCCTTGG - Intergenic
1151739872 17:75973450-75973472 TTTCCCTGGAAACTGGTCCAGGG - Intronic
1152203362 17:78960006-78960028 CTGCCCTGGATTCTGGACCTTGG - Intergenic
1152643705 17:81459423-81459445 CTGCCTGAGAGTCTGGTCCCTGG - Intronic
1156163062 18:34383558-34383580 CTTCCTTGGAATTATGTCCATGG + Intergenic
1156172462 18:34502784-34502806 ATGCCTTGGTATATGTTCCAAGG + Intronic
1157732221 18:50013977-50013999 GTGTCTTGGATTCTTGTCCATGG - Intronic
1159167045 18:64716806-64716828 GTGCCTTGGAATGTAGTCAATGG - Intergenic
1159673462 18:71252007-71252029 CTGCCTGGTATTGTGGTCCAGGG - Intergenic
1162156231 19:8679664-8679686 CAGCCTTTGGTTCTGGTCCAGGG + Intergenic
1162524975 19:11201727-11201749 CTCCCTGGGGATCTGGTCTAGGG + Intronic
1163860995 19:19742788-19742810 CTGCCTGAGAGGCTGGTCCAGGG + Intergenic
1165182386 19:33983587-33983609 CTATCTTGGAATATGTTCCACGG - Intergenic
1166205823 19:41268226-41268248 CTGCCTGGTAATATTGTCCATGG - Exonic
1168563565 19:57403895-57403917 CTGCCTTGGAAGCTGGTATCTGG - Intronic
925363849 2:3297561-3297583 CTCCCTTGCATTCTAGTCCAAGG + Intronic
925882265 2:8362804-8362826 CTTCCTTGGAATCTGATGTAAGG + Intergenic
928071140 2:28218358-28218380 CTGGCTTGGATCCTGGTCCAGGG - Intronic
928433589 2:31239582-31239604 CTGACTTGGACTGTGTTCCATGG - Intronic
931242607 2:60466617-60466639 CTGGCTTTGAATCTGGTCTCAGG + Intronic
932118664 2:69077936-69077958 CTGCCTAGGCATCTGGTCTGGGG + Intronic
932332411 2:70905211-70905233 CTGCCTTGGGGGCTGGTCCTCGG - Intronic
933419548 2:82028647-82028669 CTTCCTTGGATTCTGGCTCATGG - Intergenic
935587534 2:104815490-104815512 CTCCCTTGGAAACAGGTCTAAGG + Intergenic
936439410 2:112538150-112538172 CTGGCTTACAATCTGGTCCTGGG - Exonic
938614351 2:132981948-132981970 CTGCCTAGGAATCTGACCCTGGG + Intronic
942317968 2:174711814-174711836 ATGGGTTGGCATCTGGTCCAGGG + Intergenic
946330534 2:219006364-219006386 CTTTCTGGGAGTCTGGTCCAGGG + Intronic
946586965 2:221200390-221200412 CAGCCTTGCATTCTGTTCCACGG - Intergenic
947433844 2:230055082-230055104 CTGGCTTTAAACCTGGTCCATGG - Intronic
947667578 2:231916811-231916833 CTGCCTTGGCTTTTGGTTCATGG + Intergenic
947891619 2:233627110-233627132 CTGCCTTGCATTCTGGTGCTTGG + Intronic
1173469837 20:43314517-43314539 CTGGCCTGGTATGTGGTCCAGGG + Intergenic
1174298054 20:49562673-49562695 ATGCCTTGGGATCTGACCCAGGG - Intronic
1179591541 21:42412405-42412427 CTGCCTTGGGGTCTGCTCCCTGG - Intronic
1180996285 22:19967288-19967310 CTGCCTTCCAGTCTGGGCCAGGG - Intronic
1181305611 22:21915824-21915846 CTGCCTAGGACAGTGGTCCAAGG + Intergenic
1181727263 22:24820222-24820244 ATGCCTTGGAATCAGGCCCCGGG + Intronic
1182766382 22:32760898-32760920 CTGCCCAGGCAGCTGGTCCAGGG + Intronic
1183377872 22:37475621-37475643 CTGCCCTGGATGCTTGTCCAAGG + Intronic
950041709 3:9923967-9923989 CTGTACTGGAATCAGGTCCAGGG + Exonic
950224709 3:11224301-11224323 CAGCCTTGGAGTCTGGGTCAGGG + Intronic
955403874 3:58613104-58613126 CTGCCCTGAAATCTAGCCCAAGG + Intronic
961642323 3:128372362-128372384 CTGCCATGGCAGCTGGTCAAGGG + Intronic
961796487 3:129412593-129412615 CTGCCTTCCCACCTGGTCCATGG + Intronic
963067570 3:141275446-141275468 CTCCCTTGGAGTCTGGGCCAGGG - Intronic
967155959 3:186692427-186692449 CTGCCTCTGAATCATGTCCAGGG + Intergenic
967875775 3:194267644-194267666 CTGCCAGGGAATCTCGCCCACGG + Intergenic
967977079 3:195041386-195041408 CTGCCCTGGCATCTGCCCCAGGG + Intergenic
968977400 4:3829143-3829165 CTGCATTTGAACCAGGTCCAGGG + Intergenic
969402833 4:6968275-6968297 CTGCCCTGGAATCATTTCCATGG - Intronic
970227311 4:13873098-13873120 CTGCCTAGGAAGCTGCACCATGG - Intergenic
970553638 4:17209494-17209516 ATGCCATGAAATGTGGTCCAAGG - Intergenic
971994206 4:33943170-33943192 CTGCCTTGAAATGTAGTCCTTGG + Intergenic
976383467 4:84427628-84427650 CTGGCATGGATTCTGGTACATGG - Intergenic
979383327 4:120034629-120034651 CAGCCTTGGACTCCAGTCCAAGG + Intergenic
979825527 4:125228769-125228791 CTTCCTTGGAATGTGATCCACGG + Intergenic
983660500 4:170126609-170126631 CTTCCTTGGATTCTGGCTCATGG + Intergenic
985203823 4:187511137-187511159 CTGCCTTGCAAAGTGGTGCACGG - Intergenic
985301874 4:188498639-188498661 CTGGCTTGGAAGATGGTCCTAGG + Intergenic
985800802 5:2004517-2004539 CTGCTTTGGAATGTGGACCTTGG - Intergenic
986204833 5:5613787-5613809 CTGCGTTAGAACCTGGTCCTAGG + Intergenic
986856379 5:11873675-11873697 CTGCTTTGGTATCTAGCCCAAGG - Intronic
989180301 5:38569630-38569652 CTCCCATGGAAACTGGTCCCTGG + Intronic
991022432 5:61993681-61993703 CTGCCTCTGAGTCTGTTCCAAGG + Intergenic
992809297 5:80370717-80370739 CTGCCTTGTAATCCTGTCCCAGG - Intergenic
997232253 5:132253610-132253632 CCGCCCTGGAATCTGGCTCAGGG + Intronic
998183598 5:139962218-139962240 CTGCCATGTGATCTGCTCCAGGG - Intronic
1000107957 5:158078725-158078747 CTGCCTTGGAGGCTGGGTCATGG + Intergenic
1001294060 5:170486417-170486439 CTGCCTTGCACTCCGGTGCAAGG + Intronic
1001813588 5:174649200-174649222 CTGCTCTGTAATCTGTTCCATGG - Intergenic
1002128445 5:177064535-177064557 TTGCATTGGAATCTGGCCCAGGG - Exonic
1002533841 5:179865304-179865326 CTACCTTCGAATGTGGGCCAAGG - Exonic
1003873948 6:10421006-10421028 CTGCCTTAGAATCTTGGTCAAGG + Intergenic
1004173053 6:13313876-13313898 CTGCCTTGGAAAGTTCTCCAAGG + Intronic
1004457457 6:15804153-15804175 CTGGCCAAGAATCTGGTCCAGGG + Intergenic
1006035449 6:31207925-31207947 CTCCCTTACAATCTAGTCCAGGG + Intergenic
1007207212 6:40162719-40162741 CTGCCTTGAAAACTGGGCAAGGG - Intergenic
1007225767 6:40312884-40312906 CTGCCTAGGAAACTGGTCCCTGG - Intergenic
1008063594 6:47024641-47024663 CTCACATGGAATCTGGACCAAGG + Intronic
1008222958 6:48876753-48876775 CTTCCTTGGACTCTGGCTCATGG - Intergenic
1009598085 6:65762324-65762346 CTACCTTTGAATCTGTTACATGG - Intergenic
1010378856 6:75204941-75204963 CTCCCTGGGACTCTGGGCCAGGG - Intronic
1011332834 6:86228665-86228687 CTGCTTTGGCATGTGCTCCATGG + Intergenic
1012003084 6:93679084-93679106 CTGCCATGGAACCTGGTGAATGG + Intergenic
1012250651 6:96976389-96976411 CTCCCTTGGCATCTGAGCCAAGG + Intronic
1017591940 6:155987285-155987307 CTGCCCAGGACTCTGTTCCAGGG + Intergenic
1018029809 6:159832931-159832953 AAGCCTTGGAGGCTGGTCCATGG + Intergenic
1019215364 6:170439499-170439521 CTTCCTGGGACTGTGGTCCATGG - Intergenic
1021425214 7:20491916-20491938 CTGCTATGTAATCCGGTCCAAGG - Intergenic
1021814774 7:24436433-24436455 CTGCCTTGAAATTTGGCTCAAGG + Intergenic
1022130164 7:27397551-27397573 CTGCCTGGGACTCTGATCAATGG + Intergenic
1027652340 7:80884664-80884686 CTGCCATGGAAGCTAGTGCAAGG + Intronic
1028636438 7:92994517-92994539 ATTCCTTGGAATCTGGTTCTGGG + Intergenic
1031634954 7:124091347-124091369 CTTCCTTAAAATCTAGTCCAGGG + Intergenic
1031992388 7:128206793-128206815 CTGCTGTGCAATCTGGTCCAGGG - Intergenic
1032006390 7:128305286-128305308 CTATCTTGTATTCTGGTCCATGG - Exonic
1034434378 7:151056220-151056242 CTCCCCTGGAACCTGGACCAAGG + Intronic
1036226096 8:6958757-6958779 CTGACATGGAATCAGCTCCATGG - Intergenic
1040683000 8:49836645-49836667 CTGCCATGGAATCTGTTCAGTGG - Intergenic
1042315565 8:67422839-67422861 GTTCCTTGGCATCTGGTGCATGG + Intronic
1045329961 8:101147071-101147093 CAGCCTTGGTATCTTCTCCAAGG - Intergenic
1049550595 8:143256510-143256532 CTGCCTTGGATACTTCTCCAAGG + Intronic
1050934634 9:11379931-11379953 CTGCTTTGGACTCTGGTCGTTGG + Intergenic
1055118625 9:72632891-72632913 CTGCCTCATAATCTGGTCCCTGG - Intronic
1058324106 9:103673938-103673960 CTGCCTAGAAATCTGCCCCATGG + Intergenic
1058711028 9:107679271-107679293 CTGACTTGGAAGCTTGTCCAAGG + Intergenic
1059947299 9:119423190-119423212 CTGCCTGGGAACATGGTGCATGG + Intergenic
1060237617 9:121877045-121877067 CTGCCTGGGAACGTGATCCAGGG - Intronic
1061231626 9:129319069-129319091 CTGCATTCGAAGCTGGTACAGGG - Intergenic
1061260088 9:129475426-129475448 CTGCCCTGGGAGCCGGTCCAGGG - Intergenic
1189993388 X:46615380-46615402 CTCCCTGGGAATGTGGTTCAAGG - Intronic
1190298012 X:49039883-49039905 CTGCCTGGGCCTCTGGTCCCAGG + Intronic
1193701755 X:84771298-84771320 ATGCTTTAGAATCTGGTGCATGG + Intergenic
1194974224 X:100377228-100377250 CTGCATTGGAACCTGGTAAAAGG + Intronic
1196477410 X:116104785-116104807 CTCCCTTGGAATCTGAACAAAGG - Intergenic
1202113553 Y:21449171-21449193 CTTCCTTGGACTCTGGCTCATGG + Intergenic