ID: 1127643800

View in Genome Browser
Species Human (GRCh38)
Location 15:60940094-60940116
Sequence AAAAATGCTGATAGGGTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 290}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127643800_1127643804 5 Left 1127643800 15:60940094-60940116 CCTCCAACCCTATCAGCATTTTT 0: 1
1: 0
2: 1
3: 25
4: 290
Right 1127643804 15:60940122-60940144 ATGTTTCACTCTAATAGTGATGG 0: 1
1: 0
2: 1
3: 19
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127643800 Original CRISPR AAAAATGCTGATAGGGTTGG AGG (reversed) Intronic
901073524 1:6536675-6536697 AAAAATGGAGTTAGGCTTGGTGG + Intronic
902063876 1:13667898-13667920 TAAAATTCTCATTGGGTTGGAGG + Intergenic
902853226 1:19178415-19178437 AAAAAGGCTGAGAGGGTCGAGGG - Intronic
903076408 1:20770600-20770622 AAAAATGAGGCTAGGGATGGTGG - Intronic
904083203 1:27885072-27885094 GAAAATGAGGATAGGGTTGGGGG - Intronic
904391061 1:30186444-30186466 ATAAATGGTTAGAGGGTTGGAGG - Intergenic
904841746 1:33376527-33376549 GAAAAGGCTGATAGGGTGAGAGG - Intronic
907226172 1:52948930-52948952 AAAAATGTTGTTGGGGTTGGGGG - Intronic
907315002 1:53562679-53562701 AATAGTGTTGATACGGTTGGAGG - Intronic
907321548 1:53605866-53605888 AGAAATGCTGGGAGGGTAGGTGG + Intronic
907399506 1:54216287-54216309 AAAAATGCTGATAGAGGAGCTGG - Exonic
908565935 1:65356282-65356304 AAAAATTCTGACAGGCATGGTGG + Intronic
912109450 1:106322993-106323015 GAAAATGTTGGTAGGGTTAGAGG + Intergenic
912149087 1:106834359-106834381 AAAAAGGCTTATAAGGTTAGAGG - Intergenic
912239698 1:107892842-107892864 TAAAATGGTTATAGGGATGGGGG - Intronic
913037998 1:114992349-114992371 AAAAATAAGGATAGAGTTGGAGG + Intronic
913562942 1:120041280-120041302 CAAAAGGCTGATGGAGTTGGAGG - Intronic
913635181 1:120752309-120752331 CAAAAGGCTGATGGAGTTGGAGG + Intergenic
913680875 1:121186384-121186406 CAAAATGTTGATGGGGTGGGGGG - Intronic
914011326 1:143781274-143781296 AAAAATTTTTATAGGGATGGGGG - Intergenic
914166508 1:145179862-145179884 AAAAATTTTTATAGGGATGGGGG + Intergenic
914283540 1:146200647-146200669 CAAAACGCTGATGGAGTTGGAGG - Intronic
914544570 1:148651383-148651405 CAAAAGGCTGATGGAGTTGGAGG - Intronic
914622057 1:149419630-149419652 CAAAAGGCTGATGGAGTTGGAGG + Intergenic
915592857 1:156880423-156880445 TAAAATGCAGCTAGGGATGGGGG - Intronic
916005566 1:160656397-160656419 AAAAAATCTCATAGGGTTGTTGG + Intergenic
916532219 1:165667916-165667938 AAAAATGTTGATAGTTTTGTAGG - Intronic
916845131 1:168642807-168642829 AAATATGTTGATAGGCTTTGGGG + Intergenic
917334232 1:173912030-173912052 AAAAATGGTGGTGGGTTTGGTGG + Intronic
920585698 1:207157932-207157954 AAGCCTGCAGATAGGGTTGGGGG + Intergenic
920801251 1:209189723-209189745 GAGAATGCTGATTGGGTTGCAGG + Intergenic
920828804 1:209447334-209447356 AATCATGCTGGCAGGGTTGGAGG - Intergenic
922077827 1:222265584-222265606 TAAAATGATGATGGTGTTGGGGG - Intergenic
923236029 1:232033993-232034015 AAAAATGCAGAATGGGGTGGGGG - Intronic
923824934 1:237489665-237489687 AAAAAGGCTTATATTGTTGGTGG + Intronic
924643497 1:245856116-245856138 AAAATTGCTAACAGGGTTGCAGG + Intronic
1063701138 10:8386519-8386541 AAAAATGGGGAGAGGGCTGGAGG + Intergenic
1065267126 10:23988433-23988455 AGAAATGTTGAAAGGGTGGGAGG - Intronic
1068294682 10:55054639-55054661 AGAAATGCTTATACTGTTGGTGG - Intronic
1070328037 10:75400589-75400611 AAAGATGCTGCTGGGGGTGGTGG - Intronic
1070908342 10:80094701-80094723 AAAAATGCTAGTAGGGTAGGTGG + Intergenic
1071190825 10:83097721-83097743 AAAAATGCAGAAAGGGCAGGAGG + Intergenic
1073275392 10:102305934-102305956 AAATAGGATGATAGGTTTGGGGG + Intronic
1073458570 10:103652447-103652469 AAAGATGCTGAGAGGGATGAGGG + Intronic
1073936493 10:108638936-108638958 AAAAATGTTGATGGTGTTTGTGG - Intergenic
1074475151 10:113766530-113766552 AAAAATGCTCATGAGGCTGGTGG - Intronic
1074524735 10:114253599-114253621 TAAAATGCTGAGAGGGGAGGAGG - Intronic
1075591641 10:123695898-123695920 GGAAATCCTGATGGGGTTGGTGG - Intergenic
1077270528 11:1677110-1677132 AAGAATGTTGATATTGTTGGTGG + Intergenic
1078141974 11:8699494-8699516 AAAAATGCTAATGGGGTTCAGGG + Intronic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1078899527 11:15628603-15628625 AAAAGTGCTGATGGTGTTGTGGG + Intergenic
1079593585 11:22212581-22212603 CACACTGCTGATAGGGTTGTGGG - Intronic
1080191965 11:29561514-29561536 AAAAATGCTGACAGTGTAGGGGG - Intergenic
1081338105 11:41892826-41892848 AAAAATGCACTTAGTGTTGGTGG - Intergenic
1081764550 11:45600461-45600483 AAGAAGGCTGATAAAGTTGGAGG - Intergenic
1082907489 11:58326050-58326072 AAAGATGCTGGTGGGGTTGTGGG - Intergenic
1084985099 11:72862690-72862712 AAAAATCCTGATAGGCTTTTTGG + Intronic
1085666508 11:78419090-78419112 AAAGATCTTGATTGGGTTGGGGG + Intergenic
1085813315 11:79707070-79707092 AAAATTGTTGAAAGGGTTAGTGG + Intergenic
1086416001 11:86589329-86589351 ATAAATGGGGGTAGGGTTGGGGG + Intronic
1086862023 11:91935429-91935451 AAAAATACTGATAGGAATAGGGG - Intergenic
1087108694 11:94438839-94438861 AAAACTGCTGAGAGGGTAAGAGG + Intronic
1089218824 11:116853655-116853677 TAAAATGCTGACAGAGTGGGAGG - Intronic
1090506603 11:127321514-127321536 TAAAATGCTGATAGTGTTATGGG - Intergenic
1091897327 12:4116053-4116075 AAACATGCTGAGATGGTGGGCGG - Intergenic
1092341952 12:7684575-7684597 AAACTTTCTGCTAGGGTTGGAGG - Intergenic
1092798111 12:12134147-12134169 AAAATTGTTGATCGGGTGGGTGG - Intronic
1093559897 12:20525450-20525472 AAACATTCTGATTTGGTTGGGGG + Intronic
1097430905 12:59505569-59505591 AAAAATGAAGAGAAGGTTGGAGG - Intergenic
1097449720 12:59721658-59721680 AAAAATTCTGATTGGAGTGGGGG - Intronic
1097513603 12:60574432-60574454 AGAACTGCTGATAAAGTTGGAGG + Intergenic
1098078667 12:66760147-66760169 AAAAATGCTGATAGTGTGCTGGG - Intronic
1098496646 12:71143350-71143372 ACAAATGTGGAAAGGGTTGGGGG - Intronic
1099307676 12:80978164-80978186 AAAAATGCTGATTCTGATGGGGG + Intronic
1100245381 12:92752036-92752058 AAAACAGCTGATAGTGTGGGAGG + Intronic
1100840901 12:98610718-98610740 AAAAAAGTAGTTAGGGTTGGTGG + Intergenic
1100935706 12:99662789-99662811 AAAAATATTGATAGGGGAGGGGG - Intronic
1101376410 12:104175132-104175154 ATGAATGCTGTTAGGTTTGGAGG - Intergenic
1101462384 12:104909954-104909976 AAAGATGCTGTTAGAGTTGGGGG + Intronic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1102603401 12:114050547-114050569 AAGAAGGCTGATATGGCTGGGGG - Intergenic
1102758303 12:115363048-115363070 AAAAATGTTGAGATGTTTGGAGG - Exonic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1106441429 13:29776548-29776570 AAAAATGCAGCCAGGGATGGTGG - Intronic
1106641866 13:31593058-31593080 AAAAATGCAGCTGGGCTTGGTGG - Intergenic
1106764839 13:32903337-32903359 AAAATTGGTGATAGAGGTGGTGG + Intergenic
1109487254 13:63042444-63042466 AAAAATGCTGATAGTCTTTATGG + Intergenic
1109793512 13:67279634-67279656 ACAAGTGCTTATAGGGTTGAAGG + Intergenic
1111303937 13:86382239-86382261 GGAAATGCTGATTGGTTTGGTGG - Intergenic
1111580551 13:90217454-90217476 GAAAATGATGATAGGGATGACGG + Intergenic
1111780144 13:92712975-92712997 AAAAATTCTCACAGGTTTGGAGG - Intronic
1111968823 13:94889111-94889133 AAAAATGCTGAAAGGTATAGAGG - Intergenic
1112345979 13:98589821-98589843 AAAAATGCAGAGATGGTTTGAGG - Intergenic
1113126515 13:106985132-106985154 AAAGATGCTGAAAGGATAGGTGG - Intergenic
1113259362 13:108544734-108544756 AAGAATGCTGGTGGGGTAGGTGG - Intergenic
1116601122 14:46924707-46924729 ACAAATTCTGATACAGTTGGTGG + Intronic
1117925639 14:60776501-60776523 AAAAATGATGATAGGTATAGTGG + Intronic
1119042426 14:71287070-71287092 AGAGATGTTGATAGGGTTGGTGG - Intergenic
1119853942 14:77885501-77885523 AACAATGATGACAGGGCTGGAGG + Intronic
1121414521 14:93770018-93770040 AAGAATGCTGCTAGGTTTTGAGG - Intronic
1123814056 15:23958572-23958594 AAAGATGCTGATGAGGTTGCAGG - Intergenic
1124045307 15:26144013-26144035 AATAATGCTGAAAGGGCTGAAGG + Intergenic
1125129687 15:36268924-36268946 GAAAGTGGTGATGGGGTTGGGGG + Intergenic
1127550888 15:60037369-60037391 AATAAGGTTGATAAGGTTGGGGG - Intronic
1127643800 15:60940094-60940116 AAAAATGCTGATAGGGTTGGAGG - Intronic
1128909791 15:71503285-71503307 AAAAATGCTGGGAGGGTGGTTGG + Intronic
1130052436 15:80495078-80495100 AAAAAGGCTTACAGGGGTGGGGG - Intronic
1132800992 16:1753155-1753177 AAAAATGCTGAGAGAGGTGCAGG - Intronic
1133092746 16:3417314-3417336 CAAAATGCTGATAAGTGTGGTGG + Intronic
1133717452 16:8463528-8463550 AAGAAGGCTGATCGGGCTGGTGG + Intergenic
1134243795 16:12524868-12524890 AAAAATGCTGGCAGGGCTGGCGG - Intronic
1134300413 16:12985721-12985743 AAAAATGGTGAAAGGGTTCCAGG - Intronic
1134909557 16:18012248-18012270 GCAAATGCTGACAGGGTTGTGGG - Intergenic
1135478875 16:22804017-22804039 AAAAGTGATGGAAGGGTTGGAGG + Intergenic
1135744850 16:25008149-25008171 CAAAATGGTGATAGGGATTGTGG - Intronic
1136120423 16:28129458-28129480 AATAATGCTGAAAGGTTTGGAGG + Intronic
1138240366 16:55422766-55422788 AATAATGCTGATAGAGTTATTGG - Intronic
1140578314 16:76199007-76199029 ATAAAAGCTGATAGGGCTGGGGG + Intergenic
1141823621 16:86464171-86464193 GAAAATGGTGATAGTGATGGTGG + Intergenic
1142360330 16:89623151-89623173 AAAAATGCTGCTGGGCGTGGTGG + Intronic
1143744721 17:8983730-8983752 GAAAATGCTGATTGGGGTGATGG + Intergenic
1147438735 17:40433799-40433821 AAAGGTGCTGATTGGGTTTGGGG + Intergenic
1147464540 17:40600580-40600602 AAAAATGCTGGAAGGCTCGGGGG - Intergenic
1148453772 17:47799316-47799338 AAAATAGCTGAAAGGGTTTGGGG + Intergenic
1150294309 17:63999513-63999535 ACAAGTGCACATAGGGTTGGGGG + Intronic
1156147271 18:34199317-34199339 TAAAATGCTGATTAGGTTGGAGG - Intronic
1156569886 18:38241243-38241265 AAAGATGATGCTAGGGGTGGTGG - Intergenic
1158581952 18:58691536-58691558 AAAAATGCTGAGAGAGTAGCTGG - Intronic
1158754219 18:60302709-60302731 TATAATGCTGATAGTGTTGATGG + Intergenic
1159123583 18:64197651-64197673 AAAAATGTTGTAAGGGCTGGGGG + Intergenic
1159382701 18:67682917-67682939 AAGAATGCTTATACTGTTGGTGG + Intergenic
1161328991 19:3677681-3677703 AAACAAGCTGAGAGGGATGGCGG + Intronic
1168181598 19:54665696-54665718 ACAACTGCTGTGAGGGTTGGAGG + Intronic
924973349 2:151364-151386 AAAAATGGAGAAAGGGTTGCTGG - Intergenic
925816432 2:7755573-7755595 AGAAATTCTGAAAGGGGTGGAGG + Intergenic
926234033 2:11026107-11026129 GAAACTGCTGGGAGGGTTGGAGG + Intergenic
927685210 2:25165855-25165877 CAAAATGATTGTAGGGTTGGCGG - Intronic
929111024 2:38405177-38405199 AAAGATGCTGAGATGGTGGGAGG + Intergenic
930191141 2:48461540-48461562 AAAATTGTTGATTGGGGTGGGGG + Intronic
930417763 2:51110565-51110587 AAACATGCTGCTAGGGAAGGTGG + Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
931045656 2:58349754-58349776 CAAAATGTTGATAATGTTGGGGG - Intergenic
936595437 2:113842721-113842743 ACAAATGATGGTATGGTTGGTGG + Intergenic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
937138866 2:119580725-119580747 AGAAATGCTGAGTGGGTTGCAGG + Intronic
937970927 2:127548566-127548588 GAAAAAGCTGCTAGGCTTGGTGG - Intronic
938758629 2:134403492-134403514 AACAGTGATGATTGGGTTGGGGG - Intronic
944580349 2:201126735-201126757 AAAACTGCTGAGAGGACTGGAGG - Intronic
944737059 2:202576883-202576905 AAAAATGCTGATGGATGTGGTGG + Intergenic
945195592 2:207234589-207234611 AGAAATGGTGATAGGGATGGTGG - Intergenic
945197573 2:207251514-207251536 AGAAATGCTGAGAGGGCCGGAGG - Intergenic
946793820 2:223328598-223328620 AAAAATGCTGTTTGTGTGGGAGG - Intergenic
948284587 2:236773875-236773897 AAAAATTCTGAGAGGTTTGCTGG + Intergenic
948526886 2:238576271-238576293 AAAGATGCTGAGAGGGTGAGTGG - Intergenic
948541628 2:238695098-238695120 AATAATGCTAACAGTGTTGGCGG - Intergenic
1169660613 20:7974615-7974637 AAAAAGGCTAATGGGGTCGGCGG - Intergenic
1169898345 20:10528038-10528060 AAAAATGTTGACAGGCCTGGTGG + Intronic
1171260195 20:23725204-23725226 AAAAGTGCTGATGGTGATGGTGG - Intergenic
1172381989 20:34502228-34502250 AAATATGCTGCTAGGTATGGTGG + Intronic
1174677253 20:52370347-52370369 AAAAATGCTTATAGCTGTGGAGG - Intergenic
1175713169 20:61237248-61237270 AAAGATGCTGACTGGGTTAGTGG + Intergenic
1177438966 21:21093767-21093789 AAAGATGCTGCTGGGTTTGGAGG - Intronic
1177503721 21:21994387-21994409 AACAATCCTGACAGGGTTGTGGG - Intergenic
1178158169 21:29879236-29879258 AAAAATGCTGTTGGAATTGGTGG + Intronic
1179055585 21:37929008-37929030 GAAAATGCTGAAGGGTTTGGGGG + Intergenic
1183000823 22:34857238-34857260 AAAAATGCAAAAAGGGTAGGGGG - Intergenic
1183741616 22:39671593-39671615 AAAAACCCTGATGGAGTTGGAGG + Intronic
1184168741 22:42746042-42746064 AAAAAAGCTGCTGGGGGTGGTGG + Intergenic
949392803 3:3581305-3581327 GTAAATGTTGTTAGGGTTGGAGG - Intergenic
950190086 3:10970532-10970554 AGACATGCTGATGGGGTAGGGGG + Intergenic
952319401 3:32261981-32262003 AAAATTTTTGGTAGGGTTGGAGG + Intronic
953436624 3:42882314-42882336 AAGAATGGTGATGGTGTTGGTGG - Intronic
953728541 3:45423944-45423966 AAAAATACTTATAGGCTTGCAGG + Intronic
954276373 3:49544396-49544418 AAAATTACTGAAAGAGTTGGTGG - Intergenic
957294025 3:78312733-78312755 AATAATGCTCAGAGTGTTGGAGG - Intergenic
957319663 3:78613383-78613405 AAAATTGCTGGTAGAGTTGGGGG + Intronic
958163232 3:89845540-89845562 AAAAATGGTGAAAGGGAGGGAGG + Intergenic
958642133 3:96817756-96817778 AAAAATGGGGATTGGGGTGGGGG - Intronic
958896975 3:99840175-99840197 GAAAAAGCTGATAGGATTAGGGG + Intronic
960247849 3:115419228-115419250 AAGAATGCTGATGGGGTTTTGGG - Intergenic
960584221 3:119305799-119305821 AGAAACGCTGCTTGGGTTGGGGG + Intronic
960614465 3:119584273-119584295 AAAAATGCGGCTAGGCATGGTGG + Intronic
960630027 3:119720750-119720772 AAAAATCTTGGTAGGGTTGGAGG - Intronic
960854200 3:122086234-122086256 AAAAATGCTGAGAAGTTTGCTGG - Intronic
962520123 3:136190639-136190661 AAAAATCCTGTTAGGATTGGAGG - Intronic
963078893 3:141372941-141372963 ATGAATGGTGTTAGGGTTGGGGG + Intronic
963353345 3:144179569-144179591 AAAAATTTTGAGAGGGATGGAGG - Intergenic
964466657 3:157000136-157000158 AAGAATACTGAGGGGGTTGGGGG - Intronic
966303699 3:178507378-178507400 AAAAATGGTGGTGGGATTGGGGG - Intronic
967731605 3:192912170-192912192 AAATATCCTGCTAGAGTTGGTGG + Intronic
969905497 4:10390720-10390742 ACAAATGCTGATAAGGGTGTAGG - Intergenic
970007569 4:11426369-11426391 AAAAATCTTGTGAGGGTTGGGGG - Intronic
970032354 4:11691013-11691035 ACAAATGCTGTTAGGGTTGCTGG - Intergenic
970971274 4:21987189-21987211 AAAAATAATGAAATGGTTGGTGG - Intergenic
971597874 4:28554872-28554894 ATAAATTATGATAAGGTTGGTGG - Intergenic
973743551 4:53941564-53941586 AAAAATGCTGGCAAGGTTGCAGG + Intronic
975656128 4:76642786-76642808 CAAAATGCTGATCTGGGTGGGGG + Intronic
976019302 4:80601410-80601432 ATAAATGCTGTTAGAGTTTGAGG + Intronic
976231484 4:82848009-82848031 CAAATTGCTGATAGGATTGATGG - Intronic
977177344 4:93833760-93833782 AAAAGTGCTGGTGGGGTGGGAGG - Intergenic
978002592 4:103574331-103574353 ATAAATGCAGTTTGGGTTGGAGG - Intergenic
978753178 4:112275088-112275110 AAAAATGGTCACAGGGGTGGGGG - Exonic
981403769 4:144342960-144342982 AAAAATGAGGATAGGCTTAGAGG - Intergenic
982207204 4:153005706-153005728 ATAAATGATGCCAGGGTTGGAGG + Intergenic
983013244 4:162576610-162576632 AAAAATGTTGATAGTGGTAGAGG + Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983634620 4:169884565-169884587 ATAAATGCTGAGAGAGATGGTGG - Intergenic
983636319 4:169901034-169901056 AAAAATGCTGAGAGGAGTTGGGG - Intergenic
983811242 4:172065146-172065168 GATAATTTTGATAGGGTTGGGGG + Intronic
983997298 4:174198919-174198941 AGAAATGCTGATTGGTTTGTTGG + Intergenic
984320363 4:178188047-178188069 AAAAAATCTGATTGGGATGGTGG + Intergenic
986430945 5:7680345-7680367 CAAAATGCTGATAGCGCTGAGGG + Intronic
986500045 5:8389187-8389209 AAAACTGCTGATGAGGTTGTGGG + Intergenic
987156348 5:15093724-15093746 AACAATCTTGATATGGTTGGAGG + Intergenic
987613777 5:20245640-20245662 AAAAATGCTCATAAAGTTGAAGG + Intronic
988629599 5:32914739-32914761 AACAATCCTGGTGGGGTTGGGGG - Intergenic
989382746 5:40825298-40825320 AAAGATGCTGACAGTGTTGCTGG - Exonic
990639614 5:57767411-57767433 AAAAAGGCAAATATGGTTGGGGG - Intergenic
991102659 5:62810150-62810172 AACAAAGCTGAAATGGTTGGTGG - Intergenic
992985042 5:82220091-82220113 ACAAATGCTGATTCAGTTGGTGG - Intronic
993435489 5:87887860-87887882 AAAAATGCGGAAAGAGTTTGAGG - Intergenic
995148956 5:108819900-108819922 GAAAAGGTTGATTGGGTTGGAGG + Intronic
995196097 5:109370197-109370219 AAAATGGTTGATATGGTTGGAGG - Intronic
995247336 5:109949453-109949475 ATAAAAGCTGAGAGGGTGGGTGG + Intergenic
995394926 5:111677337-111677359 ATAAATGCTTTTAGGGTTGGGGG - Intronic
995511269 5:112912120-112912142 AAAGGTGGGGATAGGGTTGGGGG - Intronic
996995093 5:129686340-129686362 TAAAATGGTGATAGGATTGATGG + Intronic
997329521 5:133049567-133049589 AAAAAGATTGATAGGGCTGGTGG + Intergenic
997935879 5:138110571-138110593 AAAAATGCAGATGAGGTTAGTGG + Intergenic
998721971 5:144962718-144962740 AGAAATGCAGAAAGGGTTGCGGG - Intergenic
999422903 5:151460122-151460144 GCCAATGCTGATAAGGTTGGAGG - Intronic
999917360 5:156277443-156277465 AAAAATGCAAAGAGGGTTGTGGG + Intronic
1004895050 6:20140183-20140205 GAGAATGCTGAAAGGATTGGGGG - Intronic
1007801476 6:44397465-44397487 AAATATTCTGAAATGGTTGGGGG - Intronic
1008375988 6:50792710-50792732 CAATATGCTTGTAGGGTTGGAGG - Intergenic
1009051724 6:58283724-58283746 AGAAATGTTGAAAGGCTTGGAGG + Intergenic
1009281146 6:61753399-61753421 AGAAATGCTCATATGGTTTGGGG - Intronic
1010809086 6:80278549-80278571 AAGAATGGGGAAAGGGTTGGAGG - Intronic
1011789020 6:90878122-90878144 TCAAATGCTGTAAGGGTTGGGGG + Intergenic
1015223127 6:130827345-130827367 ATGAATGCTGATAGGATTGCTGG - Intergenic
1017440725 6:154462270-154462292 AAGAATACTGACAGGGTGGGGGG - Intronic
1017440834 6:154463038-154463060 AAGAATACTGACAGGGTGGGGGG - Intronic
1018897518 6:168030646-168030668 AAGAATCCTGATGGCGTTGGGGG + Intronic
1019223926 6:170495521-170495543 AAAAATGAGGATGGGGTTGGAGG + Intergenic
1019223960 6:170495678-170495700 AAAAATGAGGACGGGGTTGGAGG + Intergenic
1019224005 6:170495878-170495900 AAAAATGAGGATGGGGTTGGAGG + Intergenic
1019224041 6:170496038-170496060 AAAAAGGAGGATGGGGTTGGAGG + Intergenic
1019224131 6:170496438-170496460 AAAAATGAGGATGGGGTTGGAGG + Intergenic
1021143414 7:17055226-17055248 GAAAATGTTCATAGTGTTGGGGG - Intergenic
1021787546 7:24166370-24166392 ATAAATGGTGGGAGGGTTGGAGG + Intergenic
1022989352 7:35693324-35693346 AAAAATGTTGAAAGGGGTTGTGG + Intronic
1023709089 7:42973079-42973101 AAAAATGATGAGGGGCTTGGAGG - Intergenic
1024183330 7:46920072-46920094 AAAAAGGCTGAGAGAGTTGGTGG - Intergenic
1027144144 7:75682246-75682268 AAAAATGATGATAGGCTGGTGGG - Intronic
1027442330 7:78232700-78232722 AAAGATTCTTATAGGGCTGGTGG + Intronic
1027952025 7:84828989-84829011 AGAAATGCTGAGATGGCTGGAGG - Intergenic
1030318750 7:108142874-108142896 AAAGATGCTGTGAGGGTGGGTGG + Intergenic
1030810727 7:113969105-113969127 TCAAATGAGGATAGGGTTGGGGG + Intronic
1031499640 7:122497860-122497882 AAAATTACTGATAGGATTGCTGG - Intronic
1032441241 7:131944667-131944689 AAAAATGCTGTTGGTGGTGGAGG - Intergenic
1033457741 7:141517788-141517810 GAAGATGCTGAGAGGGCTGGGGG + Intergenic
1034275000 7:149820129-149820151 AAAAATTGTGACAGGGCTGGTGG - Intergenic
1034716845 7:153251390-153251412 AAAAATGGTAACAAGGTTGGGGG + Intergenic
1034759023 7:153653719-153653741 AGAAATGCTGACAGGGAGGGAGG + Intergenic
1036392759 8:8338849-8338871 AAGAATGCTGAAAGGGTGAGAGG + Intronic
1036714660 8:11109621-11109643 AAAAATGGTGGTAGGGTTGGGGG - Intronic
1037240327 8:16770093-16770115 TAAAATACTGTTAGGTTTGGCGG + Intergenic
1038382510 8:27109825-27109847 TAAAATGCTGATGGGGATGAGGG - Intergenic
1039769780 8:40673689-40673711 AAAAATGCTTAAATGGTTGCTGG + Intronic
1040846327 8:51845763-51845785 AAAAATGCTGCTACGATTGCAGG - Exonic
1041221270 8:55654139-55654161 AAAGATGCTGATAGATTTGATGG + Intergenic
1044752229 8:95427478-95427500 AAAAAGGCTGGCAGGGGTGGAGG - Intergenic
1045503894 8:102764847-102764869 AAAACTACTGAGAGTGTTGGAGG - Intergenic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046630217 8:116616419-116616441 AAAAATCCTGGGAGGGCTGGAGG - Intergenic
1046669049 8:117037414-117037436 AAAATTGTCCATAGGGTTGGAGG + Intronic
1047303700 8:123636422-123636444 AAGAATGCTAATGGGGTTGAGGG - Intergenic
1047565848 8:126042482-126042504 AATAGTGCTGATGGGGTAGGAGG + Intergenic
1047772090 8:128037755-128037777 ACAAATGCTGCTCGCGTTGGTGG + Intergenic
1050001722 9:1084384-1084406 AAAATTGCTGAGCGTGTTGGTGG + Intergenic
1050137482 9:2482008-2482030 AAAAATGGTGGGAGGGTTGGTGG + Intergenic
1050757776 9:9029336-9029358 AAAAGTGCTGATTGGTTAGGAGG + Intronic
1050796671 9:9554464-9554486 AAAAATGTTGACATGGTTCGGGG + Intronic
1052042845 9:23759347-23759369 AAAAATGCTGATCTCATTGGAGG + Intronic
1052196176 9:25717548-25717570 GAACATGCAGATAGGGATGGTGG - Intergenic
1055815506 9:80200465-80200487 ATAAGTGCTGATGGGTTTGGAGG + Intergenic
1056497272 9:87170621-87170643 AATAATTCTGATAGGCTTTGGGG + Intergenic
1058947092 9:109867666-109867688 AAAAAGGCTGGTTTGGTTGGCGG - Intronic
1060284697 9:122238867-122238889 AAAAATGGTGGTAGTGTTGGAGG + Exonic
1061224310 9:129271852-129271874 AAAGATTCAGATAGGTTTGGGGG - Intergenic
1061384106 9:130278084-130278106 AACAATGATGATAGTGGTGGTGG - Intergenic
1061597009 9:131637340-131637362 TTAAATGCTGCTGGGGTTGGAGG + Intronic
1061741613 9:132710705-132710727 AAATATGGTGACAGGGCTGGGGG - Intergenic
1185590363 X:1272387-1272409 AAAAAAGGTTATAGGGTTGGGGG + Intronic
1186163566 X:6803473-6803495 AGAAGTGGTGATGGGGTTGGAGG - Intergenic
1186190469 X:7062827-7062849 AACAATACTGCTAGGGTAGGGGG - Intronic
1187277532 X:17828876-17828898 AAAGATACTGGGAGGGTTGGTGG + Intronic
1188033676 X:25292897-25292919 ACAAAGGATGATAGGGTAGGTGG - Intergenic
1188098868 X:26057433-26057455 AAAGAAGCTGAAAGGGTAGGTGG - Intergenic
1189369186 X:40414277-40414299 GGAAATGCTGGAAGGGTTGGGGG + Intergenic
1189586706 X:42469097-42469119 AAAAATGCTGATGGGAATGCAGG + Intergenic
1190227094 X:48554571-48554593 AAAAAAAAGGATAGGGTTGGTGG + Intronic
1192118273 X:68432166-68432188 TAAAATAGGGATAGGGTTGGGGG - Intronic
1192430200 X:71106639-71106661 AAATAGGCCTATAGGGTTGGTGG + Intronic
1193202191 X:78704626-78704648 CAAAATGGTGATGGTGTTGGTGG + Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194162801 X:90475805-90475827 ACAAAAGCTGATAGAATTGGGGG + Intergenic
1194655243 X:96565109-96565131 AAAAATGCAGATTGTGGTGGGGG - Intergenic
1194746936 X:97638378-97638400 CAAACTTCTGGTAGGGTTGGTGG + Intergenic
1197768621 X:130074956-130074978 AAAAATGCTTAAAGGGCTGGTGG - Intronic
1198830111 X:140741447-140741469 AGAAATGCACATAGGGTTAGAGG + Intergenic
1199883203 X:151993118-151993140 ATAAATCCTGATATGATTGGTGG - Intergenic
1199918551 X:152371618-152371640 AAAAATTGAGAAAGGGTTGGAGG - Intronic
1200509077 Y:4053536-4053558 ACAAAAGCTGATAGAATTGGGGG + Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1200826643 Y:7651554-7651576 AAAAATACTGATATGGATGGGGG - Intergenic