ID: 1127644835

View in Genome Browser
Species Human (GRCh38)
Location 15:60947727-60947749
Sequence TACCCATGACTTCTGGAAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127644835_1127644840 8 Left 1127644835 15:60947727-60947749 CCGTTTTCCAGAAGTCATGGGTA 0: 1
1: 0
2: 0
3: 16
4: 171
Right 1127644840 15:60947758-60947780 CTAGTGCAAAGTGCAGTCTTGGG 0: 1
1: 0
2: 0
3: 6
4: 233
1127644835_1127644839 7 Left 1127644835 15:60947727-60947749 CCGTTTTCCAGAAGTCATGGGTA 0: 1
1: 0
2: 0
3: 16
4: 171
Right 1127644839 15:60947757-60947779 GCTAGTGCAAAGTGCAGTCTTGG 0: 1
1: 0
2: 1
3: 7
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127644835 Original CRISPR TACCCATGACTTCTGGAAAA CGG (reversed) Intronic
909855494 1:80524326-80524348 TACCCATGTATTCTGAAAGAAGG - Intergenic
911562644 1:99425279-99425301 TAACCAAGACTTCTTGAAAATGG + Intergenic
912780442 1:112541965-112541987 TACCCATGATTTCAGGAAACTGG + Exonic
918537003 1:185585453-185585475 AACCCATGGTTCCTGGAAAAAGG - Intergenic
918711258 1:187733616-187733638 TACACATGTCTTCTTGGAAAAGG + Intergenic
920107016 1:203560970-203560992 TCTCCATGACTTCTGGACTATGG - Intergenic
920254295 1:204644061-204644083 TGCCCATGCCTGCTGGGAAAGGG - Intronic
1062950739 10:1501182-1501204 TACCCATCACTTCTTTAAAAAGG - Intronic
1063494003 10:6490087-6490109 TATCCATGTCTTCTTGAACAGGG + Intronic
1063862377 10:10325090-10325112 TCCCCATTACTAATGGAAAAAGG - Intergenic
1063977815 10:11431030-11431052 TGCCCAGGGCTTCTGGAAATGGG - Intergenic
1064756951 10:18580089-18580111 TTGACATGACTTCTGGAATAAGG + Intronic
1066342762 10:34551973-34551995 TACCCAAGACTTGAGGTAAAAGG + Intronic
1066508412 10:36068048-36068070 TCCTCATGACTTCTGTAATAAGG - Intergenic
1067785773 10:49245479-49245501 TAACAATGACTTCTTCAAAATGG + Intergenic
1068749018 10:60570057-60570079 TCCCCATATTTTCTGGAAAAAGG - Intronic
1069269249 10:66504210-66504232 TACCAAGGACTGCTGGTAAAGGG - Intronic
1071743513 10:88389070-88389092 CCACCATGAGTTCTGGAAAAGGG + Intronic
1072634728 10:97170598-97170620 AACTCATGACTTTTGGAAGAGGG - Intronic
1072758489 10:98036763-98036785 AACCGATGGCATCTGGAAAAAGG + Intergenic
1073042584 10:100617635-100617657 TAGCCATGTCTTCTGGATGAGGG - Intergenic
1079648334 11:22895100-22895122 TAGCCTTGTCTTCTGGACAATGG - Intergenic
1081106771 11:39079570-39079592 AACCCATGAATTCTGGAAACAGG + Intergenic
1083427211 11:62594396-62594418 TGCCCCTGCCATCTGGAAAAGGG + Exonic
1083619705 11:64042730-64042752 TTCCCACTACTTCTGGACAAGGG + Intronic
1085117898 11:73946559-73946581 TGCCCATGGCTTCCGGAACAAGG - Intergenic
1091241283 11:134054002-134054024 TACACATGGATTTTGGAAAAAGG - Intergenic
1096108380 12:49012766-49012788 TACCCAGGACTTCTAAAACATGG + Intronic
1096240334 12:49956383-49956405 TAGACATGGCCTCTGGAAAAAGG + Exonic
1097676892 12:62612692-62612714 TGACCATGACTTTTGGAGAAGGG - Intergenic
1098086605 12:66851265-66851287 TACACAGGACATCTGGAAAGTGG + Intergenic
1098414873 12:70221730-70221752 TACACATGACTTTTTGAAACTGG + Intergenic
1098442826 12:70536084-70536106 CAAGGATGACTTCTGGAAAATGG - Exonic
1099990421 12:89714947-89714969 TAGCCAAGACAACTGGAAAAAGG - Intergenic
1100064580 12:90626545-90626567 AATTCATGACTTCTAGAAAAAGG - Intergenic
1108087316 13:46807298-46807320 TACCCATGATATTTGGAAATTGG - Intergenic
1108691815 13:52865901-52865923 AACCCATGTCCTCTGTAAAATGG - Intergenic
1111222500 13:85222171-85222193 TACCCATGACTTCAAAAATATGG + Intergenic
1114678988 14:24467636-24467658 CACCCAGGACTTTTGGAAGATGG + Intergenic
1114942404 14:27630127-27630149 TACCCGTGTGTTCTGTAAAAGGG - Intergenic
1116361414 14:44003309-44003331 TTCCCCTGACTTCAGGAAAAAGG - Intergenic
1118915534 14:70099977-70099999 TACCCATGGCTTCTAGAATGTGG + Intronic
1124577965 15:30926199-30926221 TCCCCCTGACTTCTGTACAAAGG - Intronic
1125208105 15:37177910-37177932 GACCCATTAATTCTGGATAAAGG - Intergenic
1127644835 15:60947727-60947749 TACCCATGACTTCTGGAAAACGG - Intronic
1128943804 15:71808561-71808583 TTCCCATCTCTTCTGGAACACGG - Intronic
1129703434 15:77781190-77781212 TACCCATGCCTTCAGGGAACCGG - Intronic
1129830520 15:78666847-78666869 AACCCATGACTTGGGGGAAAGGG + Intronic
1130376129 15:83330554-83330576 TAGCCATTACTTCTTGAGAAGGG + Intergenic
1133623676 16:7550279-7550301 TACCCTTGAGTTCCGGAGAAGGG + Intronic
1135224284 16:20642043-20642065 TGCCCATGGTTTCTGGAACAAGG + Intronic
1141184580 16:81778565-81778587 TTCCCATGAGATCAGGAAAACGG + Intronic
1141243318 16:82283457-82283479 TAGCCATTTCTTCAGGAAAAAGG - Intergenic
1142052251 16:87966394-87966416 TCCCCAGGACTTCTGAGAAATGG + Intronic
1142300501 16:89255080-89255102 TATTCATGTCTTCTGGAAATGGG + Intergenic
1144145002 17:12388838-12388860 TACCCATCACTTCTTGACTACGG - Intergenic
1145970565 17:28954051-28954073 TAACCATGGGCTCTGGAAAAAGG - Intronic
1147795829 17:43042118-43042140 TATCAAAGACTACTGGAAAATGG - Intergenic
1149452647 17:56761781-56761803 TAACTAGGACTGCTGGAAAAGGG - Intergenic
1150948897 17:69779398-69779420 TGATCATGACTTCTGGGAAATGG + Intergenic
1151120112 17:71783594-71783616 TACCGATGACTTCTTCTAAACGG - Intergenic
1154012373 18:10586632-10586654 TTCCCATGATTCCTGGAAAATGG + Intergenic
1155346435 18:24861955-24861977 TTCCAGTGACTTCTGGATAAGGG - Intergenic
1155848443 18:30738782-30738804 TACTCATTACCTTTGGAAAAGGG + Intergenic
1157005563 18:43579743-43579765 TAGCCAAGATTTCTAGAAAAAGG - Intergenic
1159975985 18:74712477-74712499 TCGCCATGACTACTGGGAAAAGG - Intronic
1165579258 19:36848273-36848295 ACCCCATGACTTCTGGGAAAAGG + Intronic
1166625900 19:44355953-44355975 TAGCCTTGACTTCTTGAAAAAGG - Intronic
925567428 2:5271373-5271395 TACCAATTTCGTCTGGAAAAGGG - Intergenic
925622058 2:5803803-5803825 AATCCATGACTTCTCCAAAAAGG - Intergenic
926543982 2:14215939-14215961 GTCCCATGACTTCAGGGAAATGG - Intergenic
926640707 2:15232987-15233009 TACACATAACATCTGTAAAATGG - Intronic
927148920 2:20184800-20184822 GACCGATGACTTCCTGAAAAGGG - Intergenic
929768613 2:44872118-44872140 TACTCAGGAATTCTGGAAAGGGG - Intergenic
931473904 2:62568865-62568887 TAGGCTTTACTTCTGGAAAAGGG + Intergenic
934715879 2:96543036-96543058 TACCCAGGATTTCTGGAGACTGG + Intronic
937322927 2:120971691-120971713 TCCCCAAGACTTCTGGGAAATGG - Intronic
937368158 2:121280061-121280083 TGCCCACGTGTTCTGGAAAAGGG + Intronic
937821428 2:126314970-126314992 TAACCATGACTGCAGCAAAAGGG - Intergenic
938547545 2:132348195-132348217 TAGCCTTGACTTCTTGAAAAAGG + Intergenic
939488754 2:142851054-142851076 AACCCCTGACTTCTGAAAGATGG + Intergenic
942132733 2:172897032-172897054 TGCCCAGAATTTCTGGAAAATGG + Intronic
943139664 2:183965525-183965547 TAGCCTTGATTTCTGCAAAAGGG + Intergenic
947173513 2:227337029-227337051 TCCTCATCACTTCTGGAAAGAGG + Intronic
947833967 2:233161998-233162020 TACCCATCATCTCAGGAAAAGGG - Intronic
948398414 2:237664160-237664182 TCCCCATGACTTCACTAAAACGG - Intronic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1171876411 20:30580950-30580972 TAGCCTTGACTTCTTGAAAAAGG + Intergenic
1172412068 20:34732027-34732049 AAGGCATGACTTTTGGAAAATGG + Intronic
1174446495 20:50594552-50594574 TACCCAGGACAGCTGGAAATAGG - Exonic
1174541705 20:51294766-51294788 TAGCCATCATTTTTGGAAAAAGG - Intergenic
1175769991 20:61617491-61617513 CTCCTATGACTTCTTGAAAACGG - Intronic
1180610293 22:17092068-17092090 TACCCATCACATCTGGGAAGGGG + Intronic
1182558335 22:31140902-31140924 TTCCCAAGGCTTCTGGGAAAGGG + Intergenic
1183521447 22:38298202-38298224 TTCACATCTCTTCTGGAAAAGGG - Intronic
1183771224 22:39927682-39927704 CACCCATGACTACTTGATAATGG + Intronic
949181189 3:1133650-1133672 TACCCATGTCTGTAGGAAAATGG - Intronic
952163849 3:30724091-30724113 TACCCATGACATCGGCGAAAGGG - Intergenic
952608189 3:35174509-35174531 TACACATCACTTATTGAAAAGGG + Intergenic
953217834 3:40937664-40937686 TTCTCATGACTTCTGCAAGATGG - Intergenic
956628639 3:71292012-71292034 TACCCAAGACTTTTAAAAAATGG - Intronic
958050647 3:88340168-88340190 TACCCATTTCTTTTGAAAAAAGG - Intergenic
960089685 3:113626733-113626755 TACTCATGGCTTCTGAGAAAGGG - Intronic
960989215 3:123299975-123299997 CAGCCCTGACATCTGGAAAACGG - Intronic
961838209 3:129682774-129682796 TACTCTTGATTACTGGAAAAAGG - Intronic
963142798 3:141961674-141961696 TACCCATAACTTTTTGAAACTGG + Intronic
963334182 3:143953536-143953558 TTCCCATCACATCTGGAATATGG - Intergenic
963438106 3:145298188-145298210 TACCCATGGATTCTGTAGAATGG - Intergenic
964470466 3:157047996-157048018 TACTCATGACATAAGGAAAATGG + Intergenic
964524279 3:157601267-157601289 TACCCATGTTTTCGGGAAAAAGG - Intronic
965408874 3:168304585-168304607 TCCAAATAACTTCTGGAAAATGG + Intergenic
965906615 3:173715421-173715443 CACCCATCACTTATGGAACAAGG - Intronic
966427726 3:179798328-179798350 TCCCCATGACTCCTGAAAAATGG - Exonic
969326968 4:6449716-6449738 GTCCCAAGAGTTCTGGAAAATGG + Intronic
969659937 4:8520941-8520963 TACCCAAGCTTTCTAGAAAATGG + Intergenic
971156729 4:24091331-24091353 TACCCATGACTTTTTTCAAAAGG + Intergenic
971622036 4:28867854-28867876 TAACGATGACTTTTTGAAAACGG - Intergenic
972857929 4:43130557-43130579 TACCCAAGACTATTGTAAAAGGG - Intergenic
975220154 4:71805113-71805135 AACCCATGATTCCTGGAAGAAGG - Intergenic
975220725 4:71809628-71809650 AACCCATGATTCCTGGAAGAAGG - Intergenic
976053337 4:81032697-81032719 TATGCAAGACTCCTGGAAAAAGG + Intronic
976621820 4:87136128-87136150 TAACAATGACTTTTGGTAAAGGG + Exonic
978282705 4:107036522-107036544 CACCCACAACTACTGGAAAAGGG + Intronic
978956414 4:114618478-114618500 TACACATGAGTTCTGAAAAGTGG - Intronic
979446259 4:120815661-120815683 TGCCCTTGACTTCTGGGAAATGG - Intronic
979491341 4:121331529-121331551 TCTCCATGACTTCTGTAAAGAGG + Intronic
980174083 4:129324271-129324293 AATCCATGTCTGCTGGAAAAGGG - Intergenic
981167535 4:141579703-141579725 TAACCATCATTTCTGGAACAAGG + Intergenic
981692027 4:147519915-147519937 CACCGAGGACTTCTGCAAAAAGG - Exonic
982778624 4:159467111-159467133 TCCCCAGGAGTGCTGGAAAAGGG - Intergenic
984075009 4:175165963-175165985 TATCCATGAAATCTTGAAAAAGG + Intergenic
987018357 5:13844163-13844185 TAAGCATGACATCTGGAACATGG + Intronic
988695995 5:33623355-33623377 AACCCATGACTGGTGGAAAGTGG + Intronic
989208912 5:38840716-38840738 TTCTGATGACTTCTGGAAGAAGG + Intergenic
991319355 5:65352389-65352411 AAACCATTACTTCTGGAAATTGG - Intronic
994831403 5:104787474-104787496 AACCCAGGGCTTCTGGTAAAAGG + Intergenic
997645418 5:135478267-135478289 TGCAGATGACTTCTGGGAAAGGG + Intergenic
999284909 5:150388556-150388578 TACCAATGACAACAGGAAAAGGG + Intronic
1004691323 6:17994742-17994764 TACCCCTTACTTCTGTCAAAAGG - Intergenic
1004828000 6:19445244-19445266 TAACCATGCCTTCTGCATAAAGG - Intergenic
1005586572 6:27282305-27282327 TTCCCAGTTCTTCTGGAAAAAGG - Intergenic
1005919724 6:30390007-30390029 GACCTATGACTTCTGGGAATCGG + Intergenic
1006763790 6:36486961-36486983 TTCCCATGACATCTGGATGAAGG - Exonic
1007183486 6:39947913-39947935 TACCTTTGACCTCTGGAGAAAGG + Intergenic
1007863744 6:44944243-44944265 TTACCATGACTACTGAAAAAAGG + Intronic
1010092564 6:72002397-72002419 TACCCCAGAAGTCTGGAAAAGGG + Intronic
1010457352 6:76073191-76073213 TACCCATGCCTTCTTTCAAAGGG + Intergenic
1014009161 6:116457455-116457477 TACCAATGCCTGCTGGAAGATGG - Intergenic
1014722034 6:124928573-124928595 TACCAAAAACTTTTGGAAAAAGG + Intergenic
1015008533 6:128313971-128313993 TACCCATCTCATCTTGAAAAAGG + Intronic
1015113539 6:129619916-129619938 TAACCTTTACTTCTGTAAAATGG + Intronic
1015953479 6:138576861-138576883 TACCCATCACTGCTGACAAAGGG + Intronic
1017237390 6:152130903-152130925 TACCCATGAATTAAGGAAACTGG + Intronic
1018520617 6:164646356-164646378 TACCCAAGACTTATGGACAGTGG - Intergenic
1020152828 7:5696717-5696739 CACCTAGGTCTTCTGGAAAATGG + Intronic
1022612816 7:31894378-31894400 TTCCCATGAAGTCTGAAAAATGG + Intronic
1022641776 7:32193079-32193101 TAACCATGTCATCTGCAAAAGGG + Intronic
1024843096 7:53610514-53610536 TACCCATGTCTCCAGGAAGAGGG - Intergenic
1027396390 7:77759452-77759474 TATCCATCACTTCTGGCAGATGG - Intronic
1027756988 7:82226442-82226464 TACCCATCCCTTCTAGAGAAAGG + Intronic
1028101463 7:86826004-86826026 TATCCATGACTTTTTTAAAAAGG - Intronic
1030414579 7:109226478-109226500 TGCCTATGACTTCAGGAATAAGG - Intergenic
1031785428 7:126025170-126025192 TAGCCATGACTTCTGAAACTGGG - Intergenic
1033085719 7:138339809-138339831 TGCCCATGATTTCTGGAACAAGG + Intergenic
1033570348 7:142621722-142621744 ATCCCATCACCTCTGGAAAATGG - Intergenic
1034504072 7:151472141-151472163 TACCACTGACTGCTGGCAAATGG + Intronic
1034781315 7:153885345-153885367 CACATATGAATTCTGGAAAAGGG - Intergenic
1035822390 8:2607465-2607487 CTCCCATGACTTGTGGAGAAAGG + Intergenic
1044514045 8:93117854-93117876 CACCCATGTCTTCTGTAAACTGG - Intergenic
1045441251 8:102214256-102214278 AACACAGAACTTCTGGAAAATGG + Intronic
1047835251 8:128682413-128682435 TACCAATGAATTTTGGAAACTGG - Intergenic
1048576928 8:135699898-135699920 TACCAATAACCTATGGAAAAAGG - Intergenic
1050020365 9:1277875-1277897 AACCCAAAACTTGTGGAAAATGG - Intergenic
1055592712 9:77834278-77834300 TAGCCAGGGCTTCTTGAAAATGG - Intronic
1058284087 9:103153902-103153924 TAGCCATGTCTTCTGGGGAATGG + Intergenic
1062191093 9:135248276-135248298 ACACCATGGCTTCTGGAAAAGGG - Intergenic
1185717309 X:2353267-2353289 TACACATGGCTTCAGGAAGATGG - Intronic
1186295172 X:8141393-8141415 TAACGAAGATTTCTGGAAAAAGG + Intergenic
1186571790 X:10722917-10722939 TACCCATAACTTCAGCAAAGAGG - Intronic
1186711971 X:12207725-12207747 TACCAAAAACTTCTGGAAATCGG + Intronic
1188799749 X:34514081-34514103 TACCCATGAAATTTGGAATATGG - Intergenic
1190756374 X:53405350-53405372 CACTCCTGACTTCTGGAATAGGG + Exonic
1191104977 X:56767148-56767170 TAATCATGGCTACTGGAAAACGG - Intergenic
1192217876 X:69176692-69176714 TGCCCATGACTTCTGGAGACAGG + Intergenic
1192718216 X:73665420-73665442 AACCCATGATTCCTGGAAGAAGG - Intronic
1193397784 X:81005647-81005669 TATCCATGGCTTCTGTAACAAGG + Intergenic
1195203615 X:102573320-102573342 TACCCATGACCAGAGGAAAATGG - Intergenic
1199107871 X:143892988-143893010 GACCCATGTCTCCTGGAATATGG - Intergenic