ID: 1127647963

View in Genome Browser
Species Human (GRCh38)
Location 15:60976321-60976343
Sequence CATATTATGCAGATGGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 211}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127647963 Original CRISPR CATATTATGCAGATGGGGGA TGG (reversed) Intronic
900824834 1:4918168-4918190 CATCTTATGTAGATGGTGGCAGG + Intergenic
901261782 1:7876426-7876448 CATGTGCTGCAGAGGGGGGAGGG + Intergenic
903318221 1:22525592-22525614 CAGATTATGCAGATTTGGAAGGG + Intronic
904594975 1:31638256-31638278 CCCATTTTACAGATGGGGGAGGG + Intronic
904976096 1:34457820-34457842 CATATTATGGGGGTGGGGGGGGG - Intergenic
908875052 1:68663781-68663803 AATATGATGCATATGAGGGAAGG - Intergenic
914334018 1:146698937-146698959 CATTACATGCAGATGTGGGAGGG - Intergenic
914735136 1:150409164-150409186 ATTATTATGCAGAAGGGGAAAGG - Intronic
915907451 1:159889250-159889272 CATATATTAAAGATGGGGGAGGG + Intronic
916219079 1:162425115-162425137 CATATTATTCATAAGGGGGTGGG - Intergenic
916458530 1:164996421-164996443 CATATTTTGGAGCTGGGGAAGGG - Intergenic
918127566 1:181597776-181597798 CATTTTATGCAGATGGCAGCAGG + Intronic
919106964 1:193165749-193165771 AATTTTATGCATATGTGGGAGGG - Intronic
919988062 1:202689597-202689619 CTTAGTATGCAGATGAGGAAGGG - Intronic
920139916 1:203802525-203802547 CAGATAATAAAGATGGGGGAAGG + Exonic
922595393 1:226809152-226809174 CAGATGGTGCAGATGAGGGAGGG + Intergenic
1062902988 10:1159632-1159654 CGCTTTATGCAGATGAGGGATGG + Intergenic
1063350689 10:5352101-5352123 CACATTATGGAGATATGGGAGGG - Intergenic
1064301443 10:14126602-14126624 TATTCTATGCAGATGGGAGAAGG - Intronic
1065597437 10:27328548-27328570 CATTTAATCCAGATGGGAGATGG - Intergenic
1066164924 10:32776562-32776584 GATATTATGCATATTGTGGAAGG - Intronic
1072363305 10:94682358-94682380 CATATTTTCCAAATGGGGAAAGG - Intergenic
1072383934 10:94904400-94904422 CATATTTTTCAAATGGGGAAAGG - Intergenic
1073882584 10:108000343-108000365 CATATTATGGAGATGGGTGGGGG + Intergenic
1075178311 10:120186146-120186168 CCTATTCTGCTGAAGGGGGATGG + Intergenic
1076162431 10:128255826-128255848 CAAATTATGAAGGTGGTGGAGGG + Intergenic
1079962319 11:26940116-26940138 CATCTTATGTAGATGGTGGCAGG + Intergenic
1081015060 11:37866919-37866941 CATATCATACAGATGGCAGATGG + Intergenic
1081384124 11:42450698-42450720 CATATTCTGAAGATGTGGGTAGG + Intergenic
1081634830 11:44714158-44714180 CAGAATAAGCAGATGGGAGAAGG + Intergenic
1082963403 11:58940783-58940805 TATTTTATAGAGATGGGGGAGGG - Intronic
1083085856 11:60144395-60144417 CATATTATCCAGATAGTGTATGG + Intergenic
1084952521 11:72674443-72674465 CTGATAATGCAGAAGGGGGAGGG + Exonic
1086487155 11:87318613-87318635 AATATTATTCAGAAGGAGGATGG + Intronic
1086633974 11:89060332-89060354 CTTATTTTGAAAATGGGGGATGG + Intronic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1089400267 11:118160389-118160411 CACATCATGCTGATGGGGGGTGG + Intergenic
1092697093 12:11184335-11184357 CATTTTATGCATATGGGGAGGGG + Intergenic
1095051022 12:37554461-37554483 CAAATTATGGAGGTGGGGGTGGG + Intergenic
1096527669 12:52221551-52221573 CATATTATGCTAATGAGAGATGG + Intergenic
1097729644 12:63113464-63113486 TATATTCTGCAGTTTGGGGATGG - Intergenic
1098687021 12:73434594-73434616 CATCTTATGCTGATGGTGGCAGG + Intergenic
1101194422 12:102368464-102368486 CATATTATGCAGAGAGGGTCTGG - Intergenic
1101434729 12:104654882-104654904 CCTGTTCTGGAGATGGGGGAGGG - Intronic
1102621660 12:114200700-114200722 AAAATTGTACAGATGGGGGATGG - Intergenic
1102736145 12:115161907-115161929 CCCATGATGCAGATGGGGCAAGG - Intergenic
1103041686 12:117701045-117701067 CCTATTGTGCAGATGGAGGATGG - Intronic
1106057388 13:26251527-26251549 CAAATTAAGCACTTGGGGGATGG + Intergenic
1107662759 13:42656369-42656391 CCTCTTAAGCAGCTGGGGGAGGG + Intergenic
1107947749 13:45434869-45434891 CAAATTCTGCAGCTGAGGGATGG + Intergenic
1108254923 13:48600819-48600841 CATAGTCTTCAGATGGGGGGTGG + Intergenic
1109399942 13:61813302-61813324 CAGATTATGCAGATAGAGGTGGG + Intergenic
1109478337 13:62914852-62914874 CATATTATGTGGATGGTGGCAGG + Intergenic
1111109162 13:83684876-83684898 GATATTATGCTGATTGGGGTTGG + Intergenic
1111819442 13:93194991-93195013 CATCTTATGTAGATGGAGGCAGG - Intergenic
1112860415 13:103823876-103823898 CATTTTATGTAGATGGCGGCAGG + Intergenic
1114833593 14:26176072-26176094 CAAAGTAAGAAGATGGGGGAAGG + Intergenic
1115422190 14:33208432-33208454 CATTTTCTGAAGATGAGGGAAGG + Intronic
1115785708 14:36823568-36823590 CATATTTGGGAAATGGGGGAAGG + Intronic
1116207520 14:41887194-41887216 CATCTTGTGCAAATGGGAGAAGG - Exonic
1117027884 14:51640147-51640169 CATCTAATTCAGATTGGGGAAGG - Intronic
1118467513 14:66044304-66044326 CAAATGATGCAGATAGGGCACGG + Intergenic
1118583968 14:67333735-67333757 TATACTATGCTGATGAGGGAAGG - Exonic
1119187737 14:72655092-72655114 CATATTATGGAGTTTGGGGATGG - Intronic
1122167388 14:99838536-99838558 AAAATTATGCAGATGGAGAAGGG - Intronic
1123470574 15:20549266-20549288 CAAATTGTGGAGCTGGGGGAAGG - Intergenic
1123647486 15:22451434-22451456 CAAATTGTGGAGCTGGGGGAAGG + Intergenic
1123730874 15:23144244-23144266 CAAATTGTGGAGCTGGGGGAAGG - Intergenic
1123749013 15:23341670-23341692 CAAATTGTGGAGCTGGGGGAAGG - Intergenic
1124281384 15:28365553-28365575 CAAATTGTGGAGCTGGGGGAAGG - Intergenic
1124301318 15:28546068-28546090 CAAATTGTGGAGCTGGGGGAAGG + Intergenic
1124817346 15:33008291-33008313 CAAATTAAGCAGATGGGATAGGG + Intronic
1125000157 15:34761229-34761251 TATTTTATGCAGAAGTGGGATGG + Intergenic
1127647963 15:60976321-60976343 CATATTATGCAGATGGGGGATGG - Intronic
1136866436 16:33760697-33760719 CATATTTTGCAGTCAGGGGAAGG - Intergenic
1138010238 16:53372905-53372927 CAAATTGTGGAGCTGGGGGAAGG - Intergenic
1138657819 16:58500976-58500998 CTTATTTTGTAGGTGGGGGAAGG + Intronic
1138881241 16:61017051-61017073 CATATTCTGCAGTTGTTGGATGG - Intergenic
1139999601 16:71012312-71012334 CATTACATGCAGATGTGGGAGGG + Intronic
1140514285 16:75530920-75530942 ATTATAATGAAGATGGGGGAAGG + Exonic
1140646180 16:77032439-77032461 TATATTATGCTAATGGAGGATGG + Intergenic
1203105725 16_KI270728v1_random:1355506-1355528 CATATTTTGCAGTCAGGGGAAGG + Intergenic
1203127789 16_KI270728v1_random:1606862-1606884 CATATTTTGCAGTCAGGGGAAGG - Intergenic
1143795462 17:9332785-9332807 CTTATATTGCAGTTGGGGGAGGG - Intronic
1147209879 17:38866751-38866773 CATTTTGTGGAGATGGGGGCAGG - Intergenic
1147541733 17:41365714-41365736 CGTATCATACAGATGAGGGAAGG - Intronic
1151140494 17:71987067-71987089 CATATTACTCAGCTGGGGGTTGG - Intergenic
1155843398 18:30674789-30674811 CAAATTTTGAAGATGGAGGAAGG - Intergenic
1156603306 18:38636221-38636243 CCTAAAATGCAGTTGGGGGAAGG + Intergenic
1156740997 18:40327631-40327653 CATATTAGGCATAAGGGGTATGG + Intergenic
1159211869 18:65333483-65333505 GATGTTATTCAGATGGTGGAAGG - Intergenic
1160467493 18:79093731-79093753 AATTCTAAGCAGATGGGGGAGGG - Intronic
1160994244 19:1875089-1875111 CCTCTTATGCTGGTGGGGGAGGG + Intergenic
1164911452 19:32015603-32015625 CATACTATACATGTGGGGGAAGG - Intergenic
1165399489 19:35588806-35588828 CACATGAGGCAGTTGGGGGAAGG - Intergenic
1165762643 19:38330727-38330749 TACATTTTACAGATGGGGGAAGG + Intergenic
1165984810 19:39758709-39758731 GATATTATGCAGAAGATGGAAGG + Intergenic
1167853662 19:52220962-52220984 CATATACTGCAGAAGGGTGAGGG - Exonic
925076060 2:1016680-1016702 CATATTTAGCAGGTGGGAGATGG + Intronic
925691098 2:6524164-6524186 TCCATTAAGCAGATGGGGGAGGG + Intergenic
926561341 2:14420635-14420657 CATATGATGGAAATGGAGGAGGG - Intergenic
926638021 2:15204852-15204874 CCTGTCATGCAGTTGGGGGAAGG + Intronic
927255829 2:21040145-21040167 CATCTTATGTAGATGGTGGCTGG - Intronic
928238948 2:29569872-29569894 CTTATAATGCAGAGGAGGGAAGG - Intronic
929214715 2:39399873-39399895 CATAATATTTATATGGGGGAGGG + Intronic
929603182 2:43217717-43217739 CATGTTATGCAGATGGAAGTCGG - Intergenic
930327627 2:49940093-49940115 CATTTTTTGAAGGTGGGGGAGGG + Intronic
931645194 2:64415938-64415960 CATATTAAGAGGATGGGAGACGG - Intergenic
932079123 2:68695352-68695374 CAGGTTATCAAGATGGGGGAGGG - Intronic
932363627 2:71130824-71130846 CAAATTGTGGAGCTGGGGGAAGG + Intronic
935094417 2:99930681-99930703 CCTGCTATGCAGATGGGGGGAGG + Intronic
935599384 2:104907114-104907136 CATGTTAGAGAGATGGGGGAAGG - Intergenic
935713608 2:105920000-105920022 GAAATTATGCAGAGGAGGGATGG + Intergenic
937312425 2:120910330-120910352 TAATTTATGCAAATGGGGGAGGG + Intronic
937829277 2:126402195-126402217 CAAATTATGCAGAGGGTCGATGG + Intergenic
937876884 2:126832710-126832732 CTTATTAGGCAGATGTGAGAGGG - Intergenic
939259761 2:139792213-139792235 ACTATTATGGAGGTGGGGGATGG + Intergenic
939982896 2:148802117-148802139 CATATGATGCAGAGAGGAGACGG - Intergenic
940479108 2:154205671-154205693 CATCTTATGCAGATGCTGGCAGG + Intronic
942217499 2:173736621-173736643 CATATTATTTAGTTGGGTGAAGG - Intergenic
944407060 2:199396821-199396843 CATTTTATGCAGATTAGGTATGG - Intronic
1170332194 20:15225462-15225484 GAAACTATGAAGATGGGGGAGGG - Intronic
1172358950 20:34298994-34299016 CATATAAGGCAGAAGGGGCAGGG - Intronic
1173042023 20:39473458-39473480 CATATTTTTCAGAGGAGGGAAGG - Intergenic
1173640597 20:44599156-44599178 CTTATTATGAAGCTGGGGGCAGG + Intronic
1173661858 20:44740112-44740134 CATATTATGCTGACTGGGAAAGG + Intergenic
1175627445 20:60500918-60500940 GAGGTTATGCAGATGGGGAAAGG + Intergenic
1177088009 21:16731220-16731242 CCTATTATGGGGTTGGGGGAGGG - Intergenic
1178428367 21:32497793-32497815 CATCTTATGCGGATGGCGGCAGG + Intronic
1179486390 21:41713514-41713536 CAGCTTCTGCAGATGTGGGAAGG + Intergenic
1182203564 22:28599360-28599382 CATTTCTTTCAGATGGGGGAGGG - Intronic
1183268167 22:36843728-36843750 CATAAAATTCAGATGGGGGATGG - Intergenic
1184312078 22:43652315-43652337 CATCTTATGTAGATGGTGGCAGG - Intronic
951617155 3:24560175-24560197 CTCATTATGGAGGTGGGGGAGGG - Intergenic
951694797 3:25434868-25434890 CATCTGATGCAGATGGGGATGGG - Intronic
952185876 3:30968296-30968318 CATATTAGGAAGATGGGAGAGGG + Intergenic
953711386 3:45273893-45273915 CATGCACTGCAGATGGGGGATGG + Intergenic
956688777 3:71856928-71856950 CTGATTATGCAGATGATGGAAGG - Intergenic
956907039 3:73777231-73777253 CAGATTATGCAGAAGGTGGTTGG + Intergenic
959259754 3:104062098-104062120 TATATTATTCAGATGGTGGTGGG + Intergenic
959804269 3:110532167-110532189 TCCATTATGCAGATGGAGGAAGG - Intergenic
960085904 3:113591103-113591125 TATACTTTGCAGATGGAGGAAGG + Intronic
962904088 3:139786344-139786366 CATCTTTTGAAGATGGAGGAAGG + Intergenic
963091830 3:141489462-141489484 GATATTAAGCAGCTTGGGGAGGG + Intronic
965618104 3:170615088-170615110 AATAATATGCAGATGTGGCAAGG - Intronic
966711041 3:182973079-182973101 CCTCTTATCCACATGGGGGAGGG + Intronic
969317866 4:6392938-6392960 CATATAAGGCAGATGAGGGGTGG - Intronic
969980907 4:11153169-11153191 CATATGATGCAGCAGGGGGAAGG + Intergenic
972777155 4:42252006-42252028 CTTATTATACAGATGCAGGACGG + Intergenic
973824137 4:54688149-54688171 AATAGCATGCAGATGGGGGAGGG - Intronic
973839666 4:54848253-54848275 CATATTATCCAGGTGGAAGATGG - Intergenic
974555955 4:63447332-63447354 CATCTTATGTAGATGGTGGCAGG + Intergenic
975920553 4:79380817-79380839 AATATTATACATATGGGGGCAGG - Intergenic
979026416 4:115583261-115583283 CATATTCTGTCTATGGGGGATGG - Intergenic
979268344 4:118729878-118729900 CACATAATGCATATAGGGGATGG - Intronic
980302773 4:131015046-131015068 CAAAATATGCAAATGGTGGAGGG + Intergenic
986525339 5:8668067-8668089 CATATTCTGAGGATGGTGGAGGG - Intergenic
988653525 5:33181134-33181156 GATATTTTGGGGATGGGGGAAGG + Intergenic
989992193 5:50780418-50780440 CATCTTATACAGATGGGGTTTGG - Intronic
992986327 5:82234209-82234231 ACTTTTAGGCAGATGGGGGAGGG + Intronic
993614286 5:90091779-90091801 CATATGAAGAAGATGGGTGAAGG + Intergenic
994284469 5:97948436-97948458 TATGTTAATCAGATGGGGGAGGG - Intergenic
996058840 5:119010484-119010506 CATGTAATGCAGAAGGGGGGAGG - Intergenic
996184388 5:120458338-120458360 CTTATTTAGCAGACGGGGGAAGG - Intergenic
996708423 5:126520377-126520399 GCTTTTAGGCAGATGGGGGAGGG - Intergenic
997683332 5:135771424-135771446 CGTATTATTCAGAAGGGGCAGGG + Intergenic
997684841 5:135781305-135781327 CGTAATATGCAGAAGGGGTAGGG + Intergenic
997685554 5:135785698-135785720 CATAATATCCAGAGGGGAGAGGG + Intergenic
1001629071 5:173161102-173161124 AAAATAATCCAGATGGGGGATGG - Intronic
1006928493 6:37672944-37672966 TATATTATGGGGATGGGGGGTGG - Intronic
1008020483 6:46572058-46572080 CATATAATGCATGTGGGGGTAGG - Intronic
1010116559 6:72318484-72318506 AAGAATATGCAAATGGGGGAGGG - Intronic
1011043629 6:83058214-83058236 CATATTATGGTGATGGTGAAGGG - Intronic
1012202213 6:96420613-96420635 CATTTTATGCATGTGTGGGAAGG - Intergenic
1012334065 6:98031423-98031445 AATATTATGCTCATGGGAGATGG - Intergenic
1013805782 6:113994283-113994305 CAGATGATGCAGTTGGTGGATGG - Intronic
1014275572 6:119384547-119384569 TATTTTATGGAGATGGGGGAGGG + Intergenic
1015859642 6:137661966-137661988 CATGTTGTGAAGATGGGGAAAGG + Intergenic
1016759822 6:147724696-147724718 CTCATGATGGAGATGGGGGAAGG + Intronic
1018116544 6:160591381-160591403 CATATTTGGCAGAAGGTGGAAGG - Intronic
1018219726 6:161565987-161566009 CTGATGATGCAGAAGGGGGAAGG - Intronic
1019302928 7:317993-318015 CATCTGGTGCAGATCGGGGAAGG - Intergenic
1020749289 7:12120168-12120190 CATAGTGAACAGATGGGGGATGG + Intergenic
1022530102 7:31061624-31061646 CATATTATGCAGAGATGGGGAGG - Intronic
1022853065 7:34285245-34285267 CATAGTAAGAAGATTGGGGATGG + Intergenic
1023062353 7:36340700-36340722 ATTATAATGCAGATGGGGGGAGG - Intronic
1023228692 7:38000659-38000681 CAATCTATGCTGATGGGGGATGG + Intronic
1024565042 7:50673804-50673826 GAGATGATGCAGATGGGGGCCGG - Intronic
1024589628 7:50870161-50870183 CTAATTTTGCAGATGGGAGAAGG + Intergenic
1024894498 7:54242193-54242215 CATCTTATGCGGATGGCGGCAGG - Intergenic
1028721143 7:94033167-94033189 AATATCCTGCAGATGGGGGATGG - Intergenic
1028743558 7:94303165-94303187 CTTATTTTGGAGGTGGGGGATGG - Intergenic
1030628633 7:111871113-111871135 TATATTACATAGATGGGGGAAGG + Intronic
1031085635 7:117299163-117299185 CATAATATAAAGATGGGGGTGGG - Intronic
1031311432 7:120202756-120202778 CCTATTATAAAGATGTGGGATGG - Intergenic
1032619293 7:133511528-133511550 ACTTTTAGGCAGATGGGGGAGGG + Intronic
1036449068 8:8849461-8849483 CACATTATGCACATGTGGGGTGG - Intronic
1037225469 8:16584278-16584300 CATACTATTAAGATGGGGGAAGG + Intergenic
1038092284 8:24267909-24267931 CATATTTAGCAGATGTGAGAAGG - Intergenic
1038931423 8:32197796-32197818 CAAAATATGCAGAAGAGGGAGGG - Intronic
1039019344 8:33187849-33187871 GCTTTTAGGCAGATGGGGGAGGG - Intergenic
1039295217 8:36143842-36143864 AATGTTATTGAGATGGGGGAAGG + Intergenic
1040989628 8:53335917-53335939 CAGAGTAGGCAGATGGGGGGTGG - Intergenic
1042067390 8:64893217-64893239 TAGAGTATGCATATGGGGGAGGG - Intergenic
1042189821 8:66174668-66174690 AATATTATGCAGATGATGAAAGG + Exonic
1043399797 8:79872775-79872797 CATAGAATTCAGTTGGGGGATGG - Intergenic
1043961311 8:86421901-86421923 AAAATTTTGCAGATGGGGAAGGG + Intronic
1045177127 8:99737459-99737481 AATATTATGCTTGTGGGGGAAGG - Intronic
1045459088 8:102411763-102411785 CAGACAATGCGGATGGGGGATGG - Intronic
1047266247 8:123312162-123312184 GATTTTATGCAGAAGGGAGAAGG - Intergenic
1052667196 9:31510217-31510239 AATATTATTGAGATGGGGGAAGG - Intergenic
1053418920 9:37964567-37964589 CTCATTATGCAGATGGGAAATGG + Intronic
1054146196 9:61562792-61562814 CATCTTCTGCAGATAAGGGAGGG + Intergenic
1055312508 9:74997598-74997620 AAAATTTTGCAGATGGGGAATGG - Intronic
1058341556 9:103903855-103903877 CAAATGATGTAGATGGAGGATGG - Intergenic
1059457585 9:114409352-114409374 CATATAATGCAATCGGGGGAGGG + Intronic
1185701002 X:2230142-2230164 CATACTATGCATGTGTGGGAGGG + Intronic
1190013300 X:46804168-46804190 AGTATTATGCAGCTGGGGGAGGG - Intergenic
1191979410 X:66909471-66909493 CATATGATGCAGAGTGGGGAGGG + Intergenic
1193047054 X:77064616-77064638 CAGATTGAGTAGATGGGGGAGGG - Intergenic
1193218933 X:78899356-78899378 CATATTATGTAGATGGTGACAGG + Intergenic
1198055180 X:132987142-132987164 CACATTTTACAGATGGGGAAAGG - Intergenic
1200327286 X:155254612-155254634 AATATTCTCCAGATGGTGGAGGG + Intergenic
1200909569 Y:8517775-8517797 TGTATTATCCAGATGGGGAATGG - Intergenic
1202585553 Y:26421879-26421901 CATATTTTGCAGTCAGGGGAAGG + Intergenic