ID: 1127649089

View in Genome Browser
Species Human (GRCh38)
Location 15:60988780-60988802
Sequence GACCTAGATTTATCTACTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 57}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127649089 Original CRISPR GACCTAGATTTATCTACTCC AGG Intronic
900438464 1:2642215-2642237 GACCTGGATTTACCTCCTCATGG + Intronic
902180969 1:14688078-14688100 GCCCTAGACGTCTCTACTCCTGG + Intronic
911222076 1:95259021-95259043 GAGGAAGATTTATCTAGTCCAGG - Intergenic
912325407 1:108754427-108754449 AGCCTTGATTTTTCTACTCCTGG + Intronic
913555021 1:119957231-119957253 GACCTTGATGTATATACTCATGG - Intronic
915277133 1:154796944-154796966 GACTTAAATGTATCTAATCCCGG + Intronic
917756755 1:178109101-178109123 GACATAGCTTTATTTACTCCAGG + Intronic
918899785 1:190399841-190399863 CATCTAAATTTAGCTACTCCTGG + Intronic
919204466 1:194403827-194403849 GACATAGATTCATATACTCCAGG + Intergenic
919360264 1:196583999-196584021 GACCAAGATTGCTCTACTTCTGG - Intronic
1065997983 10:31077561-31077583 AACCTAGAATTATCTATCCCTGG - Intergenic
1066554163 10:36592956-36592978 GACCTAGCCTTAACTATTCCAGG - Intergenic
1069384961 10:67875832-67875854 GATCTAGGTTTATATACTGCTGG + Intergenic
1069624100 10:69856790-69856812 GACCTAGAGATATCTTCTCAAGG - Intronic
1075742738 10:124705756-124705778 GACCTAGGTCTATCTGCTCAAGG + Intronic
1085049493 11:73372895-73372917 CCCCTAGATTTCTCTTCTCCAGG + Intergenic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1088990468 11:114949209-114949231 GATCTTGATTTATTTACTCTAGG + Intergenic
1097288469 12:57895340-57895362 AACCTATATTTTTCTTCTCCAGG + Intergenic
1107948743 13:45443456-45443478 GCCATAGATTTAGCTACTGCTGG - Intergenic
1109990904 13:70056182-70056204 GACACAAGTTTATCTACTCCTGG - Intronic
1116501673 14:45631716-45631738 TACCTGGTTTTATCTACTCTGGG + Intergenic
1126396981 15:48228806-48228828 TACCTAGACTTTCCTACTCCTGG + Intronic
1127085434 15:55420156-55420178 GATTTAGCTTTATCTTCTCCAGG - Intronic
1127298131 15:57627767-57627789 GACCAGGATTTTTCTAATCCTGG - Intronic
1127649089 15:60988780-60988802 GACCTAGATTTATCTACTCCAGG + Intronic
1134775557 16:16850214-16850236 TACCGAGGTTTATCTCCTCCAGG - Intergenic
1138307043 16:55987918-55987940 GAAATAGATTAATCTACTCATGG + Intergenic
1140261113 16:73380854-73380876 GACCCAGAGTTATATATTCCTGG + Intergenic
1144130488 17:12242114-12242136 CACCCAGATTTCTTTACTCCTGG + Intergenic
1148088019 17:45006428-45006450 GATTTGGATTTATCTGCTCCTGG - Intergenic
1155413127 18:25567806-25567828 TACCTAGAGTGATCTAGTCCAGG - Intergenic
1155587104 18:27379115-27379137 GAAATGGATTTATTTACTCCAGG + Intergenic
1155872532 18:31045175-31045197 GACTTAGATTAATATACTCATGG - Intergenic
1159779650 18:72646137-72646159 TACCTTGATTTATCTGCTCGAGG - Intergenic
937134628 2:119542222-119542244 GACCTTGATTAATCTAGGCCAGG - Intergenic
941850683 2:170177127-170177149 TACCTAGATTTATCTGCTCCAGG + Intergenic
942926721 2:181441892-181441914 GACCTTGCTTTATCTACTGCAGG + Intergenic
946395025 2:219439331-219439353 GACCAAAATTTATGTCCTCCAGG + Intronic
1175320852 20:58087217-58087239 GACCAAGATCTACCTCCTCCAGG + Intergenic
1178489196 21:33037303-33037325 GACGTAGATTTTTAAACTCCTGG - Intergenic
949742176 3:7248966-7248988 GATCTATATTTATTTTCTCCTGG - Intronic
956894485 3:73645817-73645839 GACATAGAATTATCTCCTCATGG + Intergenic
964767751 3:160195175-160195197 CACCCAGATTTTTCTGCTCCAGG + Intergenic
977220231 4:94329484-94329506 TAGCTAGTTTTATCTCCTCCAGG - Intronic
979295392 4:119027024-119027046 GACTTAGATTTTTCAGCTCCCGG - Exonic
983099966 4:163613133-163613155 GATCTTTATTTATCTACTTCTGG - Intronic
1000115145 5:158147011-158147033 TACCTACATTCATCTACACCGGG + Intergenic
1008269839 6:49478316-49478338 GAAATAGATTTATTTACTGCAGG - Intronic
1019566568 7:1683846-1683868 GACATTAATTTACCTACTCCAGG + Intergenic
1022433151 7:30347800-30347822 AATCTAGATTTATATTCTCCAGG + Intronic
1028193970 7:87883586-87883608 TACCTACATTTATTTATTCCAGG - Intronic
1042061955 8:64828269-64828291 GAACAAGATTTATATATTCCAGG + Intergenic
1042468397 8:69155043-69155065 AATTTAGATTGATCTACTCCAGG - Intergenic
1046021785 8:108674064-108674086 TACCTAGTTTTGTCAACTCCAGG - Intronic
1052446154 9:28564348-28564370 TATTTAGAATTATCTACTCCCGG - Intronic
1192999513 X:76549552-76549574 GAACTGGATTTATCTACTTTTGG + Intergenic
1194567765 X:95514559-95514581 GACCAAGATTTATCTACTTCTGG + Intergenic
1199499593 X:148495302-148495324 GCCCTAGATTTATAATCTCCAGG + Intergenic
1200175600 X:154113742-154113764 GACCTAGAATTCTGTACTCCCGG - Intergenic
1202172119 Y:22060838-22060860 CACCTAGAATTATCTAGCCCTGG + Intergenic
1202219243 Y:22525533-22525555 CACCTAGAATTATCTAGCCCTGG - Intergenic
1202323938 Y:23670532-23670554 CACCTAGAATTATCTAGCCCTGG + Intergenic
1202546833 Y:25999522-25999544 CACCTAGAATTATCTAGCCCTGG - Intergenic