ID: 1127650171

View in Genome Browser
Species Human (GRCh38)
Location 15:60999294-60999316
Sequence CCCCATGTTCAAATGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127650171_1127650176 18 Left 1127650171 15:60999294-60999316 CCAGGCTCCATTTGAACATGGGG 0: 1
1: 0
2: 1
3: 11
4: 124
Right 1127650176 15:60999335-60999357 CAGGGAGCTCACTCCCACTAAGG 0: 1
1: 0
2: 2
3: 14
4: 155
1127650171_1127650174 -1 Left 1127650171 15:60999294-60999316 CCAGGCTCCATTTGAACATGGGG 0: 1
1: 0
2: 1
3: 11
4: 124
Right 1127650174 15:60999316-60999338 GTTCTCAAAAGAACAGTGACAGG 0: 1
1: 0
2: 2
3: 23
4: 217
1127650171_1127650175 0 Left 1127650171 15:60999294-60999316 CCAGGCTCCATTTGAACATGGGG 0: 1
1: 0
2: 1
3: 11
4: 124
Right 1127650175 15:60999317-60999339 TTCTCAAAAGAACAGTGACAGGG 0: 1
1: 1
2: 3
3: 46
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127650171 Original CRISPR CCCCATGTTCAAATGGAGCC TGG (reversed) Intronic
901685618 1:10941916-10941938 CCCCATGGTCATCTGGATCCGGG + Intergenic
903815944 1:26064545-26064567 CCTCATGGTAAAATGGAGACAGG + Intronic
912249627 1:107997389-107997411 GCCTAAGTTCACATGGAGCCAGG - Intergenic
919234800 1:194827260-194827282 CCCCATTTTCCAATGCATCCAGG + Intergenic
919769995 1:201151989-201152011 CCCCAAGTTCAAATCCAGCAAGG + Intronic
919977602 1:202623048-202623070 GCCAAGGATCAAATGGAGCCAGG - Intronic
920119285 1:203643643-203643665 CCCCCTGTTCCAAGAGAGCCTGG - Intronic
921457401 1:215388976-215388998 CCCAATGTTGAGAAGGAGCCTGG - Intergenic
924584943 1:245353951-245353973 CCCCAAGTTCAGATGTTGCCAGG + Intronic
1065232346 10:23611222-23611244 CCCCTTGTTGAGATGGAGTCTGG + Intergenic
1071521905 10:86336723-86336745 AGCCATGTTCCCATGGAGCCAGG - Intronic
1076029517 10:127145625-127145647 TCCCATCTTCAAAAGGAGACAGG - Intronic
1076874952 10:133211301-133211323 CCCCCTGCACACATGGAGCCTGG + Intronic
1077186560 11:1238107-1238129 GCCCAGGTTCAGATGGGGCCTGG + Intronic
1077529646 11:3089206-3089228 CCCCAGGGTGAAATGCAGCCAGG - Intronic
1078334948 11:10455873-10455895 CCCCTTGATAAAATGCAGCCAGG + Intronic
1081806198 11:45892157-45892179 CCCCATGTTCACCCAGAGCCAGG + Intronic
1094001412 12:25698771-25698793 CCTCAAGTTTAAATGGAGCCAGG - Intergenic
1094762033 12:33544991-33545013 CCCAGTGTTGAAGTGGAGCCTGG - Intergenic
1095975449 12:47938083-47938105 CCACCTGTAAAAATGGAGCCAGG + Intronic
1097694551 12:62763882-62763904 CCACATGTTCAAAAGCAACCAGG - Intronic
1098295662 12:69001556-69001578 CCCCAGATGCAAATGTAGCCTGG + Intergenic
1101042202 12:100767965-100767987 CCCCATGTTCCACTAGATCCAGG - Intronic
1101837271 12:108304296-108304318 ACCCAAGTTCATATGGATCCAGG + Intronic
1102917380 12:116764483-116764505 GCTCATGTGCAAATGGAGACTGG - Intronic
1104170868 12:126278977-126278999 CTCCATGTTCAAATGGTGACAGG + Intergenic
1104979840 12:132568925-132568947 CCCCATGGTCACATGGGGCAGGG + Intronic
1113456191 13:110450487-110450509 CCTAATGTTCAGATGAAGCCCGG + Intronic
1115548231 14:34482072-34482094 CCCGAAGTTCAAAAGCAGCCTGG + Intergenic
1119505159 14:75166356-75166378 CCCCATATGCATATAGAGCCTGG - Intronic
1120959687 14:90113481-90113503 CACCATCTTCAATTGGATCCTGG + Intronic
1121256726 14:92536169-92536191 CCCCCTCTTCAAGTGCAGCCTGG + Intronic
1121656868 14:95603513-95603535 CACCAATCTCAAATGGAGCCTGG - Intergenic
1121828228 14:97028039-97028061 CCCCATCTGAAAATGGAGGCAGG + Intergenic
1121922387 14:97894179-97894201 CCCCATGCTGAAATGCAGCCAGG - Intergenic
1124493251 15:30171417-30171439 GCCAAGGATCAAATGGAGCCAGG - Intergenic
1124750283 15:32366908-32366930 GCCAAGGATCAAATGGAGCCAGG + Intergenic
1127650171 15:60999294-60999316 CCCCATGTTCAAATGGAGCCTGG - Intronic
1128381411 15:67115844-67115866 CCCCTTGCTCAAATGGAATCAGG - Intronic
1129677260 15:77638440-77638462 GCCCAAGTTCCCATGGAGCCAGG - Intronic
1130372823 15:83300990-83301012 CTCCATGTTCAAATGAATCATGG - Intergenic
1134016855 16:10894794-10894816 ACCCATGTCCAAGTGGAACCAGG - Intronic
1135177793 16:20246327-20246349 CCACATGCTCAGATGGAGCCAGG - Intergenic
1138965182 16:62075647-62075669 CCCCATGTGAAAATGCAGCAAGG - Intergenic
1139092542 16:63666074-63666096 CCTCATGCTCAGATGGTGCCTGG + Intergenic
1139668990 16:68478993-68479015 GCCCCTTTTCAAATGGATCCAGG + Intergenic
1140555842 16:75920274-75920296 CCCCGTGGTCAAATGGATGCAGG - Intergenic
1145260315 17:21350877-21350899 CCCCATGTTCACAGGAATCCAGG + Intergenic
1145316302 17:21737063-21737085 CCCCATGTTCACAGGAATCCAGG - Intergenic
1145714730 17:27008984-27009006 CCCCATGTTCACAGGAATCCAGG - Intergenic
1146181545 17:30701449-30701471 CACCATGCTCAAAAGAAGCCAGG - Intergenic
1149104158 17:52942433-52942455 CCCCATGTTCAACTAGGGACTGG + Intergenic
1149553348 17:57555949-57555971 CCCCATGTCCCAATGATGCCTGG + Intronic
1150531330 17:65985520-65985542 CTCCATGAACAAATGGTGCCAGG + Intronic
1155110502 18:22709641-22709663 CCCCAGTGTCAAATGGAACCTGG - Intergenic
1160528066 18:79548767-79548789 CCCCAGGCTCACAGGGAGCCCGG + Intergenic
1163730537 19:18946869-18946891 CCCCATGAAGCAATGGAGCCAGG + Intergenic
1164823458 19:31267371-31267393 CTCCATGTTCAAATGGGCCATGG + Intergenic
1164857298 19:31534975-31534997 CCCCATGTCCACATGCGGCCTGG + Intergenic
1166396434 19:42444618-42444640 TCCCATGTACAAATGGAGCCTGG + Intergenic
1166412407 19:42564813-42564835 TCCCACGTACACATGGAGCCTGG + Intergenic
927133415 2:20079821-20079843 CCTCATGTCCCCATGGAGCCAGG - Intergenic
927215765 2:20667162-20667184 CACTATGTTCAAAAGGCGCCGGG + Exonic
931516068 2:63051377-63051399 CCCCCTCCTCAAATGGATCCCGG + Intronic
931832172 2:66064375-66064397 CCCCAGCCTCAAATGCAGCCTGG - Intergenic
932129989 2:69178611-69178633 CCCCGTGTGCAAGTGGAACCTGG + Intronic
933217009 2:79642668-79642690 CACCATGTCCAAATGGAGGTGGG - Intronic
938936542 2:136132436-136132458 CCCAATGTACAAATGAAACCAGG + Intergenic
948051394 2:234982064-234982086 CCGGATATTCAAATGGACCCGGG - Intronic
948931694 2:241136320-241136342 CCCCATGTTTAGATGGATCTGGG + Intronic
948991569 2:241558525-241558547 CCCAATTTTCAAATGGACCCCGG + Intergenic
1170769522 20:19319851-19319873 CCCCATGGTCAAATGGGCACAGG - Intronic
1172204167 20:33150576-33150598 GACCATGTTGAAATGGATCCTGG + Intergenic
1175473875 20:59254950-59254972 GCTCATCTTCAAATGGTGCCAGG + Exonic
1175989133 20:62778854-62778876 CCCCATCTGTAAATGGAGACAGG - Intergenic
1176708658 21:10132644-10132666 CCTGATGTACATATGGAGCCTGG - Intergenic
1185153633 22:49180321-49180343 CCACATGTGCAGAGGGAGCCTGG - Intergenic
1185357262 22:50381209-50381231 CCCCATGCTGAGGTGGAGCCTGG - Intronic
950095379 3:10326409-10326431 CTCCATGTTCATTCGGAGCCAGG - Exonic
950288618 3:11765193-11765215 ACCCATGATCAAGTGGACCCAGG + Intergenic
951940999 3:28078965-28078987 CACCATGTTCAAGAGGAGCAAGG - Intergenic
952304651 3:32135240-32135262 TCCCTGGTTCATATGGAGCCTGG - Intronic
953064388 3:39455985-39456007 CCACGTGGTCAAATGAAGCCTGG + Intergenic
953448945 3:42990538-42990560 CTCAATGCTCAAATGGAGGCCGG - Intronic
957909841 3:86606976-86606998 CCCAATGTTCAGGTGGGGCCTGG - Intergenic
959338644 3:105099109-105099131 CCCCATCTCCAAATACAGCCAGG - Intergenic
961269682 3:125679861-125679883 CCTGATGTTCACCTGGAGCCTGG - Intergenic
962754155 3:138455538-138455560 CCCCAGGTTCCAAGGAAGCCTGG + Intronic
963545991 3:146658891-146658913 CTCCATGATCAAATGGAGGTGGG - Intergenic
964321037 3:155497527-155497549 CCCCAGGTCCTAAGGGAGCCAGG + Intronic
967545257 3:190718248-190718270 CCCAATATTCAAATTGAGCCAGG - Intergenic
970270906 4:14346336-14346358 GCCCATGTGCAAAGGGAGTCAGG - Intergenic
972395849 4:38659230-38659252 CACCATGTTGAAATGGATTCAGG - Intergenic
975086610 4:70348975-70348997 CCCCATGCTAAAATGCAGCCAGG + Intergenic
977100989 4:92814821-92814843 CACCATGTTCTATAGGAGCCAGG + Intronic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
978535810 4:109761258-109761280 CCAGATGTTCAAATGAAGCAAGG + Intronic
982770210 4:159390286-159390308 CCCCCTGCTCCAATGGCGCCTGG + Intergenic
983661078 4:170131372-170131394 CCCCATTTTGAATTGGGGCCCGG + Intergenic
984706745 4:182852769-182852791 CCCCATCTGGAAATGGAGCAGGG - Intergenic
985658736 5:1145127-1145149 CCCCTTCTTCAAAGGGAACCTGG + Intergenic
985751588 5:1681750-1681772 CCCCAGGTCAAAATGCAGCCTGG + Intergenic
987292130 5:16519331-16519353 CCCCAGGTTTAAATGGGGGCAGG + Intronic
991340160 5:65600201-65600223 CCCAATGTTGAAATGGGGCCTGG - Intronic
994389058 5:99167933-99167955 CCCTATGTTTAAATGAAGCCAGG + Intergenic
996125794 5:119724397-119724419 CCTCAAGTTCATATGGAGCTGGG + Intergenic
998923078 5:147092314-147092336 CCCCATATGCAAATGGAGAAAGG + Intergenic
1003550496 6:7098464-7098486 GCCCAGGTCCAAATGGAGCCAGG - Intergenic
1005719408 6:28586657-28586679 CCCCTTGTTCTTCTGGAGCCTGG + Exonic
1018914503 6:168124958-168124980 TCCGATGTTCAAATGGCCCCGGG + Intergenic
1021649530 7:22820164-22820186 TCCCATGTTGAAATAGAGACAGG - Intronic
1022098520 7:27155694-27155716 CCCCATCTTGAAATGGACCCTGG + Intronic
1026349632 7:69504360-69504382 GCCCATTTTCAAATGGAGTTTGG - Intergenic
1027122805 7:75534041-75534063 GACCAGGGTCAAATGGAGCCAGG + Exonic
1034950716 7:155295643-155295665 CCCCATGAAGAAATGCAGCCTGG - Intergenic
1039251394 8:35668808-35668830 CTTCTTGTTGAAATGGAGCCTGG + Intronic
1040611745 8:48991342-48991364 CACCATTTTAGAATGGAGCCAGG + Intergenic
1044729435 8:95218341-95218363 CCACATGTGAAAAGGGAGCCAGG - Intergenic
1045809210 8:106201742-106201764 CATCATTTTCAAATGGAGGCAGG + Intergenic
1051395964 9:16621037-16621059 ACCCAAGATCAAATTGAGCCTGG + Intronic
1053645629 9:40118140-40118162 CCTGATGTACACATGGAGCCTGG - Intergenic
1053760080 9:41345369-41345391 CCTGATGTACACATGGAGCCTGG + Intergenic
1054326644 9:63716041-63716063 CCTGATGTACACATGGAGCCTGG - Intergenic
1054538944 9:66257832-66257854 CCTGATGTACACATGGAGCCTGG + Intergenic
1055090782 9:72364088-72364110 CCCCATGTTCCAATGGATTTTGG + Intronic
1055318614 9:75059315-75059337 CCCCATTTATAAATGGTGCCAGG + Intergenic
1058694364 9:107546991-107547013 CCAGATGCTCAAATGGTGCCTGG - Intergenic
1060153981 9:121306158-121306180 CCCATTGTTCAAATGGAATCTGG + Intronic
1060886705 9:127159655-127159677 CCCCATCTTCTCAGGGAGCCTGG + Intronic
1062497682 9:136839340-136839362 CCCCCTGCTGAGATGGAGCCGGG + Exonic
1202793419 9_KI270719v1_random:101613-101635 CCTGATGTACATATGGAGCCTGG - Intergenic
1187133469 X:16525261-16525283 CCCCATGTTTAAAGGGAGGAAGG - Intergenic
1190947589 X:55110910-55110932 CCCCATCTTGAATTGGAGCTGGG + Intronic
1193276786 X:79598240-79598262 CTCCACCTACAAATGGAGCCTGG - Intergenic
1194501013 X:94680819-94680841 CCCCATGTGGAGGTGGAGCCTGG + Intergenic
1198202642 X:134437210-134437232 CCCCATATCCAGATGGAGTCAGG + Intergenic
1200234100 X:154459952-154459974 CCCCATGCTGGAAAGGAGCCAGG - Intronic