ID: 1127652592

View in Genome Browser
Species Human (GRCh38)
Location 15:61023636-61023658
Sequence TAAGACAGCAAACCTGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 191}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127652592 Original CRISPR TAAGACAGCAAACCTGTTGC TGG Intronic
901198373 1:7453067-7453089 TGAGGCAGCAAAGCTGCTGCTGG + Intronic
901888927 1:12245086-12245108 TAAGATACCTAACCTCTTGCTGG + Intronic
902461629 1:16581807-16581829 CAGGACACCAAACCTGTTCCTGG - Intronic
902763561 1:18599884-18599906 TCACACAGCAAACCTGGTGGTGG + Intergenic
906621484 1:47284587-47284609 TAAGACAGTAAAGATGTTCCTGG + Intronic
906772466 1:48497176-48497198 TAATACAGCAAACATTTTTCAGG + Intergenic
907612941 1:55890726-55890748 TAACCCAGCAATCCTGTTACTGG - Intergenic
908300700 1:62758610-62758632 TAAGACATTAAAACAGTTGCGGG + Intergenic
908349820 1:63274336-63274358 TAAGGCAATAAACCTGTTGAAGG + Intergenic
911129499 1:94374464-94374486 TAAGACATTAAAACAGTTGCAGG - Intergenic
911751676 1:101503242-101503264 TAAGACATTAAAACAGTTGCAGG + Intergenic
912285996 1:108370098-108370120 TTAGAAAGCAGACCTGTTTCAGG - Intergenic
912548333 1:110466945-110466967 TAAGGCAGCAATCCTGAAGCAGG - Intergenic
913469820 1:119176653-119176675 TAAGACATTAAAACAGTTGCGGG + Intergenic
917280166 1:173372212-173372234 TAAGACATTAAAACAGTTGCAGG + Intergenic
921163195 1:212487395-212487417 TCAGACAGCAAACCTCTCACAGG + Intergenic
921687518 1:218106663-218106685 TAAGACATCAAAGTTGTTTCTGG + Intergenic
922330688 1:224572568-224572590 TACTACAGCAATCCTGTTGGAGG + Intronic
1065082707 10:22143146-22143168 TAAGACATTAAAACAGTTGCAGG + Intergenic
1068500603 10:57837027-57837049 TAAGACATTAAAACAGTTGCAGG + Intergenic
1069137047 10:64780464-64780486 TAAGACATTAAAACAGTTGCGGG - Intergenic
1069374086 10:67776331-67776353 TAAAACATCCAACCTGTTACCGG + Intergenic
1070352561 10:75607372-75607394 TAAGACAACAAATCTGCTGAGGG - Intronic
1073509032 10:104031468-104031490 GAAAACAGAAAACCTGATGCTGG - Exonic
1073755097 10:106572881-106572903 TAATACAGAAAATGTGTTGCTGG - Intergenic
1074969669 10:118525739-118525761 CATGACAGGAAACCTGATGCCGG - Intergenic
1075362598 10:121852384-121852406 TAAAAAAGCAAAACAGTTGCAGG - Intronic
1081421730 11:42879313-42879335 TAAGACATTAAAACAGTTGCGGG + Intergenic
1081941038 11:46942261-46942283 TAAGGCTGGAAACCTTTTGCGGG - Intronic
1086317689 11:85610838-85610860 TAAGACATTAAAACAGTTGCAGG + Intronic
1087075281 11:94122519-94122541 TAAGACATTAAAACAGTTGCGGG + Intergenic
1088492834 11:110403728-110403750 TAAGACATTAAAACAGTTGCGGG + Intergenic
1091573610 12:1712778-1712800 TAAGACATTAAAACAGTTGCGGG - Intronic
1092949012 12:13483171-13483193 TAAGACAAAACACTTGTTGCAGG + Intergenic
1093139923 12:15497664-15497686 TAAGGCAGCATGCCTGGTGCAGG + Intronic
1093271856 12:17072836-17072858 AAAAACAGCAAACCTGTTATGGG - Intergenic
1097580458 12:61449532-61449554 TAAGACAAAAAACTTGATGCTGG + Intergenic
1099376538 12:81900774-81900796 TAAGACATTAAAACTGTTGCAGG + Intergenic
1099610822 12:84866899-84866921 TAAAAAATCAAACCTTTTGCAGG - Intronic
1100436785 12:94578456-94578478 TGAGACAGCCAACCTGAAGCAGG - Exonic
1100529928 12:95453665-95453687 TAAGACATTAAAACTGTTGCAGG - Intergenic
1101779806 12:107825048-107825070 TAAGACATTAAAACTGTTGTGGG + Intergenic
1101950736 12:109172793-109172815 TAACCCAGCAATCCTGTTACTGG + Intronic
1102963979 12:117112225-117112247 CAAAACAACAAACCTGGTGCAGG - Intergenic
1104374285 12:128250305-128250327 TAAGTGAGTAAAGCTGTTGCAGG + Intergenic
1105762785 13:23529179-23529201 TAAGACATTAAAACAGTTGCGGG + Intergenic
1106004233 13:25753570-25753592 GAAAACAGCAAACATGGTGCTGG + Intronic
1106163003 13:27217058-27217080 TAAGACATTAAAACAGTTGCGGG + Intergenic
1108102152 13:46968008-46968030 TAGGACAGGAAACCTGCTGTGGG - Intergenic
1108599068 13:51974874-51974896 TTTGATGGCAAACCTGTTGCAGG + Exonic
1110403179 13:75117867-75117889 TGAGGCAGCAAACTTCTTGCTGG - Intergenic
1110906486 13:80896859-80896881 TAAGACATTAAAACAGTTGCGGG + Intergenic
1110936425 13:81295825-81295847 TAAGGCAGGAAACCTGTAGATGG - Intergenic
1110972506 13:81782713-81782735 TAAGACTGAAAACCTATTGTGGG - Intergenic
1111755705 13:92393026-92393048 TAACCCAGCAATCCTGTTACTGG + Intronic
1112519434 13:100082616-100082638 TAAGACATTAAAACAGTTGCGGG + Intergenic
1113036148 13:106052001-106052023 TAGGACAGAACATCTGTTGCTGG - Intergenic
1113551197 13:111194443-111194465 TAAGACATTAAAACAGTTGCAGG - Intronic
1114453275 14:22839856-22839878 TAAGAAAGCAAAGCTGGAGCAGG + Intronic
1116940924 14:50789864-50789886 CAAGACAGCATTCCTGTTTCTGG - Intronic
1123137924 14:106047157-106047179 TAATCCAGCAATCCTGCTGCTGG - Intergenic
1124898559 15:33800339-33800361 TAAGACATCTAACCTGGTCCTGG - Intronic
1125909946 15:43427506-43427528 TCAAACAGCAAACCTATGGCTGG + Intronic
1126071124 15:44865548-44865570 TAAGACATTAAAACAGTTGCGGG - Intergenic
1127652592 15:61023636-61023658 TAAGACAGCAAACCTGTTGCTGG + Intronic
1128392108 15:67189358-67189380 CAAGACAGCAACACTGTTCCTGG + Intronic
1128738875 15:70069895-70069917 GAAGCCAGCAGACGTGTTGCAGG - Intronic
1129480660 15:75823086-75823108 AAAGACAGCAAACTTGTATCAGG + Intergenic
1132506355 16:311328-311350 TCATAAAGAAAACCTGTTGCGGG - Intronic
1132786943 16:1662193-1662215 TAAGACACCAAAGATGTTCCAGG - Intronic
1133468863 16:6054435-6054457 AAAGACAGGAAACCTGACGCTGG - Intronic
1133936415 16:10272975-10272997 TAAGATAGTAAACGTGTTGTTGG + Intergenic
1134025520 16:10949996-10950018 GAAGACAGCAAAACTCTTGTTGG - Intronic
1135339368 16:21633114-21633136 TAAGACATTAAAACAGTTGCGGG - Intronic
1136164159 16:28441655-28441677 TAAGACAACAAAACATTTGCTGG - Intergenic
1136198806 16:28673328-28673350 TAAGACAACAAAACATTTGCTGG + Intergenic
1136215153 16:28787502-28787524 TAAGACAACAAAACATTTGCTGG + Intergenic
1136259877 16:29067349-29067371 TAAGACAACAAAACATTTGCTGG + Intergenic
1138494371 16:57398588-57398610 TAAGACATTAAAACAGTTGCAGG - Intergenic
1140793605 16:78414850-78414872 AAAGACAGCTAACCAGTTACCGG + Intronic
1144258337 17:13492046-13492068 AAACACAGCAAAAGTGTTGCTGG - Intergenic
1144585684 17:16486246-16486268 GAAGACAGCAAAGCAGTTTCTGG + Intronic
1144724246 17:17493751-17493773 TAGTACTGCAAACCTGTTGGTGG - Intergenic
1148344300 17:46893303-46893325 GAAGGCAGCCAACATGTTGCTGG - Intergenic
1148904175 17:50901035-50901057 TGAGGCAACAAACCTATTGCTGG - Intergenic
1150230377 17:63546388-63546410 TTAAACAGCAAGCCTGGTGCAGG + Exonic
1150997573 17:70336469-70336491 TAATACAGCCATTCTGTTGCAGG + Intergenic
1153046272 18:858003-858025 ATAGACAGAAAACCTGTTGTGGG - Intergenic
1153455280 18:5274258-5274280 TAATACAGCAATCCTACTGCTGG + Intergenic
1153463244 18:5360782-5360804 TAAGAAAGGAAAAGTGTTGCTGG + Intergenic
1156083988 18:33376965-33376987 CAACCCAGCAATCCTGTTGCTGG - Intronic
1159001187 18:62976823-62976845 TAAGACTGGAAACCTCTTGAAGG + Intronic
1159222691 18:65485601-65485623 TAATACATCAAACATGTTACAGG - Intergenic
1168465468 19:56597818-56597840 TAACCCAGCAACCCTGTTCCTGG - Intronic
1168543783 19:57233525-57233547 TAAGCCAGAGAACCTGCTGCTGG + Exonic
1202678065 1_KI270711v1_random:25554-25576 CAGGACACCAAACCTGTTCCTGG - Intergenic
925949598 2:8898370-8898392 TAAGACATTAAAACAGTTGCGGG - Intronic
926072089 2:9904605-9904627 CAAGCCAGCAAACCTATTACTGG - Intronic
927304910 2:21559896-21559918 TAAGCCAGGAAACCTCTTGAAGG + Intergenic
928851495 2:35753036-35753058 CAATTCAGCAATCCTGTTGCTGG - Intergenic
931782179 2:65588348-65588370 TAAGAGAATAAACCTGTGGCTGG - Intergenic
932478754 2:72025491-72025513 GAAGCCAGCAAACCTTTTCCTGG - Intergenic
932836802 2:75045747-75045769 CAAGACAGGAAACCTGTGGCAGG - Intergenic
932988629 2:76759496-76759518 TAAGCCAGCAAACCTGCCCCTGG + Intronic
934779071 2:96957619-96957641 TAGGACAGAAAACCTGCTGTCGG + Intronic
941159892 2:162024150-162024172 TATGCCAGCAAACCTCTTCCAGG + Intronic
941781221 2:169447709-169447731 TATGACAGCAAATGTGTAGCGGG + Intergenic
946708608 2:222484295-222484317 TAAGACTGCAATGCTGTTGGTGG + Intronic
1171196699 20:23205545-23205567 TTAAACAGCAAGCCTTTTGCAGG + Intergenic
1171309081 20:24131606-24131628 TAAGCCACCCAACCTGTTGGAGG - Intergenic
1173291326 20:41717572-41717594 TAGGACAGCAACCCTGCTGAAGG + Intergenic
1174062567 20:47843144-47843166 CATGCCAGCACACCTGTTGCTGG + Intergenic
1174073068 20:47912354-47912376 CATGCCAGCACACCTGTTGCCGG - Intergenic
1174150995 20:48486290-48486312 CATGCCAGCACACCTGTTGCTGG + Intergenic
1176413525 21:6461606-6461628 TGAGTCAGCACACCTGCTGCAGG - Intergenic
1177008419 21:15702376-15702398 TAAAACAGCAATCCTGGAGCGGG - Intergenic
1178260542 21:31096431-31096453 TAAGACAACAAAGCTGATGTAGG - Intergenic
1179689022 21:43069929-43069951 TGAGTCAGCACACCTGCTGCAGG - Intronic
1184922599 22:47616096-47616118 AAAGACAGGAAATCTGTGGCTGG + Intergenic
950183990 3:10933949-10933971 TGAGACAGAAAAACTGCTGCAGG - Intronic
951020772 3:17778778-17778800 TAAGACATTAAAACAGTTGCAGG + Intronic
951842685 3:27051089-27051111 AGAGACAGAAAAGCTGTTGCAGG + Intergenic
953085050 3:39657126-39657148 TAAAACAGTAGACCTGTTCCTGG - Intergenic
955553665 3:60112169-60112191 TAATACAGCAAAGTTGGTGCTGG + Intronic
959090679 3:101899583-101899605 TAAGACAGGAAAAGGGTTGCTGG - Intergenic
959465421 3:106680491-106680513 TAACACACCACACCTGTTCCAGG - Intergenic
961137295 3:124523484-124523506 TATGAAAGCAAACCTGCTGGGGG + Intronic
963436651 3:145277143-145277165 TAAGACAGAAAACCTGGAACAGG + Intergenic
965063010 3:163805909-163805931 TAAGACATTAAAACAGTTGCAGG + Intergenic
965206435 3:165723706-165723728 TAATACAGCAAATCTGGTGAAGG + Intergenic
965309740 3:167114666-167114688 TCAGGCCGCAAACCTGTGGCCGG + Intergenic
965501347 3:169459742-169459764 TTACATAGCAAACCTGTTTCAGG + Intronic
967277339 3:187789447-187789469 TAAGAAAGCAACACAGTTGCTGG - Intergenic
969172950 4:5378719-5378741 TTAGTCAGCACACCTGCTGCTGG + Intronic
969830759 4:9794781-9794803 GAAGAAAGCAAACCTGGTGGTGG + Intronic
972041012 4:34599309-34599331 TAAGTCAGCAAACCTTTCTCAGG - Intergenic
974838580 4:67277963-67277985 TAAGACATTAAAACAGTTGCAGG - Intergenic
975113775 4:70656063-70656085 TAAGAGAGCATACCTCTTTCAGG + Exonic
975595540 4:76045843-76045865 TAAGACATTAAAACAGTTGCGGG - Intronic
977834660 4:101633941-101633963 TAAGACATTAAAACTGTTGTGGG - Intronic
978736968 4:112094534-112094556 TAAAACATCAACCTTGTTGCTGG - Intergenic
980229488 4:130030999-130031021 TAAGACAACAGACCTGATCCTGG - Intergenic
980810660 4:137875011-137875033 TAAGTCTAAAAACCTGTTGCTGG + Intergenic
981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG + Intronic
982363254 4:154546770-154546792 AAAGACAGTAAAACTGTTGCAGG - Intronic
982701398 4:158662324-158662346 TAAGACATTAAAACAGTTGCAGG + Intergenic
983834664 4:172372848-172372870 TAAGACATTAAAACAGTTGCAGG - Intronic
984917725 4:184738780-184738802 TAAGACATTAAAACAGTTGCAGG + Intergenic
985323604 4:188741866-188741888 TTAGACAGCAAATCTGATGCAGG - Intergenic
992455470 5:76911842-76911864 TAAGACATTAAAACAGTTGCGGG + Intronic
997431974 5:133847181-133847203 ACAGACATCAAACCTGTGGCAGG + Intergenic
997641427 5:135451244-135451266 TGGGACAGCGAGCCTGTTGCAGG + Intronic
998111729 5:139507667-139507689 TAAGACATTAAAACAGTTGCGGG + Intergenic
1004993104 6:21161079-21161101 GAAGACAACCACCCTGTTGCTGG + Intronic
1007030299 6:38620746-38620768 TAAGACATTAAAACAGTTGCGGG + Intronic
1009423866 6:63492673-63492695 AAAGACAGCAAAGCTTTTCCAGG + Intergenic
1009758912 6:67978456-67978478 CAACACAATAAACCTGTTGCTGG - Intergenic
1011374784 6:86677043-86677065 TAAGACATTAAAACAGTTGCGGG - Intergenic
1013907585 6:115236806-115236828 TAAGACATTAAAACAGTTGCAGG - Intergenic
1014375255 6:120664399-120664421 TGATCCAGCAAACCTGTTTCTGG - Intergenic
1015673419 6:135718062-135718084 TAGGACTGCAAAGCTCTTGCTGG + Intergenic
1017014307 6:150087878-150087900 AAAGACAGCAAATCAGTTGCAGG - Intergenic
1017312249 6:152987502-152987524 TTAGACAGCAAATCGGATGCAGG + Exonic
1019048490 6:169166027-169166049 GAAAACAGCACACCTGCTGCCGG - Intergenic
1019056145 6:169224921-169224943 TGAGGCAGCACACCTGTTGAAGG + Intronic
1029380437 7:100210951-100210973 AAAGAGAGCACACCTGTCGCAGG + Intronic
1030835875 7:114284684-114284706 CAACACAGCAATCCTGTTACTGG + Intronic
1031732042 7:125312188-125312210 TAAGACATTAAAACAGTTGCGGG + Intergenic
1031940425 7:127782995-127783017 TAATTCAGCAAACATGCTGCAGG + Intronic
1033242629 7:139692941-139692963 CAAGTCACCAAACCTGTTGGAGG - Intronic
1033758974 7:144420577-144420599 TAAGACATTAAAACAGTTGCGGG - Intergenic
1033978440 7:147131884-147131906 GAAGACAGCAAAGCTACTGCTGG - Intronic
1034025788 7:147702403-147702425 TATGACAACAAACCTATTTCTGG + Intronic
1036145244 8:6248927-6248949 TAAAACAGGAAACCTCTTGCTGG + Intergenic
1038537919 8:28367842-28367864 TAAGAAAGAATACCTGCTGCTGG + Intronic
1040971210 8:53139234-53139256 TAAGACATTAAAACTGTTGCAGG - Intergenic
1042311364 8:67382013-67382035 TGAGACAGAAAAAATGTTGCTGG + Intergenic
1042919864 8:73910344-73910366 TAAGACATTAAAACAGTTGCGGG + Intergenic
1044005185 8:86930172-86930194 TAAGACATTAAAACAGTTGCGGG - Intronic
1047014655 8:120710745-120710767 CCAGACACCAAACCTATTGCTGG + Intronic
1047082890 8:121483261-121483283 TAATTCAGCAATCCTTTTGCTGG + Intergenic
1049979884 9:894174-894196 TCAGACAGGAAACCAGTGGCAGG + Exonic
1051011711 9:12423715-12423737 TGAGTCATCAAACCTGTGGCAGG - Intergenic
1051872030 9:21749170-21749192 ATAGCCATCAAACCTGTTGCAGG + Intergenic
1052586628 9:30437626-30437648 TAACACAGCAATCCTATTACTGG + Intergenic
1055930370 9:81553977-81553999 TAAGACAGGATCCCTGCTGCTGG + Intergenic
1059858793 9:118433800-118433822 CAAGACAGCAAAACTTTTGAAGG + Intergenic
1061345199 9:130018413-130018435 TAAGACAGAAACCCTGTGACAGG + Intronic
1188136764 X:26501811-26501833 TAAGACATTAAAACAGTTGCAGG + Intergenic
1190512994 X:51193069-51193091 TGATACAGGAAACATGTTGCTGG + Intergenic
1194623221 X:96198263-96198285 TAAGAAAGCAAAACACTTGCTGG + Intergenic
1195429229 X:104769600-104769622 TAAGACAAATAGCCTGTTGCAGG - Intronic
1196127105 X:112112450-112112472 TAAGACATTAAAACAGTTGCGGG - Intergenic
1196260177 X:113569751-113569773 TGACACAGCAATCCTATTGCTGG - Intergenic
1196481679 X:116157444-116157466 TAAGACAGCAAACCTGAGGCAGG - Intergenic
1197385804 X:125799617-125799639 TTGGAAAGCAAACCTTTTGCTGG - Intergenic
1198437267 X:136629530-136629552 TAAGACAGCAGACTTGTGGGAGG - Intergenic
1199832145 X:151557874-151557896 TAAGACATTAAAACAGTTGCAGG - Intergenic
1201555990 Y:15265052-15265074 TAAGACATTAAAACAGTTGCGGG + Intergenic
1201631484 Y:16075600-16075622 TAAGACATTAAAACAGTTGCAGG + Intergenic
1201907999 Y:19104863-19104885 TAAGACATTAAACCAGTTGTGGG - Intergenic