ID: 1127653948

View in Genome Browser
Species Human (GRCh38)
Location 15:61037793-61037815
Sequence CTATAATAGAAGATGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 1, 2: 4, 3: 29, 4: 375}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127653946_1127653948 -10 Left 1127653946 15:61037780-61037802 CCTGAGATGAATGCTATAATAGA 0: 1
1: 0
2: 0
3: 7
4: 144
Right 1127653948 15:61037793-61037815 CTATAATAGAAGATGGAAGAAGG 0: 1
1: 1
2: 4
3: 29
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127653948 Original CRISPR CTATAATAGAAGATGGAAGA AGG Intronic
901407481 1:9059097-9059119 CCATCAGAGTAGATGGAAGAAGG - Intronic
901563305 1:10090511-10090533 CTGTAAAAGAGGAGGGAAGATGG + Intronic
902358089 1:15922444-15922466 CTATTCTAGAAGATGAAAGTAGG - Intronic
904096024 1:27978069-27978091 CTGTCTTTGAAGATGGAAGATGG + Intronic
906096600 1:43228402-43228424 CAATTAGAGAAGATGGAGGAGGG - Intronic
906197890 1:43940391-43940413 CTATACTTGGAGATGGAAGTAGG + Intergenic
906905481 1:49886118-49886140 CTATAATACAAAATAGAAAAAGG - Intronic
908072738 1:60481280-60481302 CTGTAACAGAAGATGAAACATGG - Intergenic
908769615 1:67584059-67584081 CAATCATTGAAGATGGAAGATGG + Intergenic
909856192 1:80535187-80535209 CTCTAAGAGAAGATCTAAGAAGG - Intergenic
911630395 1:100176898-100176920 TTTTAACAGAATATGGAAGAAGG + Intronic
912670021 1:111616887-111616909 CTATTAAAGGAGATAGAAGAAGG - Intronic
913084996 1:115428761-115428783 CTTTCATAGAAGCTGGAATATGG + Intergenic
915556447 1:156663488-156663510 CTAGAAGAGAAGGTTGAAGAAGG + Intergenic
916635425 1:166662749-166662771 ATGGAGTAGAAGATGGAAGAAGG - Intergenic
917127569 1:171701691-171701713 ATATTATATAAGATGGAGGAAGG - Exonic
917616768 1:176753888-176753910 CCATAAAATAAGAAGGAAGAAGG + Intronic
917732056 1:177884450-177884472 CTATAGAAGAAAATGGAAGATGG + Intergenic
917736830 1:177929112-177929134 GTATAATAAATGATGGAAAACGG - Intronic
918594098 1:186273059-186273081 CTATGATAGAAGATGGGGAATGG + Intergenic
920099486 1:203508112-203508134 CTATAACAGAAAAAGAAAGATGG + Intronic
921538312 1:216380176-216380198 ACATAAAAGAAGATGCAAGAGGG + Intronic
921568063 1:216744732-216744754 CTAGAAGAACAGATGGAAGATGG - Intronic
921789104 1:219269185-219269207 CTACAAGTGAAGATGGGAGAAGG + Intergenic
921879846 1:220243572-220243594 CTGAAAAAGTAGATGGAAGATGG - Intronic
921960670 1:221030492-221030514 CATTAATAGAATATGAAAGAGGG - Intergenic
922303190 1:224321382-224321404 GGATAAGAGAAGATGGCAGATGG + Intronic
922448535 1:225718044-225718066 CCATAACAGAAGATGGAAGAGGG + Intergenic
923308714 1:232712963-232712985 CTATCATAAAAGATGGAATTTGG + Intergenic
923445477 1:234066658-234066680 CTCAAATAGAAGTTGGACGAGGG + Intronic
1064095990 10:12424869-12424891 CTCTATTAGATGATGCAAGAGGG - Intronic
1065664878 10:28048072-28048094 CAATAATGGAGGATGGAAGAAGG - Intergenic
1065748371 10:28862610-28862632 CTATAATTGAAAATGGTAGCTGG + Intronic
1066020314 10:31292744-31292766 ATATAATTCAAGATGGAATAAGG + Intergenic
1066125493 10:32337779-32337801 AAATAATAGAAGATGAAAAAGGG - Intronic
1066560866 10:36668501-36668523 GAATAATAAAAGATGGAATAGGG + Intergenic
1068509296 10:57943987-57944009 CTATAATAGCGGATGGAAAATGG - Intergenic
1069329169 10:67270708-67270730 CTTTAATAGAAGTTGCAAAAGGG - Intronic
1069562572 10:69441226-69441248 CTATAAAAGAACATGGTGGAAGG - Intergenic
1069959457 10:72071067-72071089 GAATCATAGAAGATGAAAGATGG - Intronic
1070276435 10:75012136-75012158 CTATACTTGAAGACAGAAGAAGG + Intronic
1071890861 10:90005271-90005293 CTATAATGGAAGATGGTAAAGGG + Intergenic
1071900001 10:90109987-90110009 ATATAATAGAAAAGGGAAAAAGG + Intergenic
1072007144 10:91263011-91263033 CTATAAACAAAGATGGAAGGGGG + Intronic
1072216263 10:93289840-93289862 TTATAATTGAAGATGGACAAAGG + Intergenic
1073831483 10:107388618-107388640 CTATAGGAGAAGTTGGAAAAGGG - Intergenic
1074802732 10:117017728-117017750 CAAAAATAAGAGATGGAAGAAGG + Intronic
1074808459 10:117078201-117078223 CTATAAGAGAAGGTGAAACATGG + Intronic
1075550988 10:123392079-123392101 CTATACTAGAAGATGGAAGAAGG - Intergenic
1076930077 10:133526461-133526483 CCTTCATAGAAGGTGGAAGAGGG + Intronic
1078299943 11:10118651-10118673 CTAAAATTGGAGATGGAAAATGG - Intronic
1080564227 11:33493306-33493328 CTATGGCAGAAGATGGAAGAAGG - Intergenic
1080981122 11:37407508-37407530 CTGTAATAGAAGATGAAACATGG + Intergenic
1082199189 11:49342684-49342706 CTATAACAAAAAATGAAAGAGGG - Intergenic
1082569636 11:54722350-54722372 CTAGTTTTGAAGATGGAAGAGGG + Intergenic
1082818151 11:57524285-57524307 CTAGAATAGAAGTTCCAAGAGGG + Intergenic
1082948371 11:58785271-58785293 CTGTAATAGAAGATGAAACATGG - Intergenic
1083502167 11:63119588-63119610 ATATAAAAGAAGATGAAATATGG + Intronic
1085999637 11:81966442-81966464 CTGAACTTGAAGATGGAAGAAGG + Intergenic
1086095638 11:83047586-83047608 CAATAATAGAAGATAGAGCAAGG + Intronic
1086656631 11:89365429-89365451 CTATAACAAAAAATGAAAGAGGG + Intronic
1086770031 11:90750602-90750624 CTATAAAAGAAAATAAAAGAGGG - Intergenic
1086941411 11:92801948-92801970 TTATAAAGAAAGATGGAAGATGG + Intronic
1087063170 11:94002638-94002660 CTTTAATGGTAGAAGGAAGAAGG + Intergenic
1087457950 11:98410965-98410987 CTAAGAGTGAAGATGGAAGAGGG - Intergenic
1088296617 11:108304289-108304311 ATATGATAGAAGAGGGAAAAAGG - Intronic
1091071721 11:132571059-132571081 CTAGAAGAGTAGGTGGAAGAAGG + Intronic
1091102984 11:132892964-132892986 GTATAATAGAAGTTGTGAGAAGG - Intronic
1092673363 12:10888088-10888110 CTGGCATTGAAGATGGAAGAAGG - Intronic
1092702414 12:11246944-11246966 CTGGCATTGAAGATGGAAGAGGG + Intergenic
1092711993 12:11348699-11348721 CTGGCATTGAAGATGGAAGAGGG + Intergenic
1093699466 12:22202524-22202546 CTATAATATTACATGGAAAAAGG + Intronic
1093793392 12:23282539-23282561 CTATAATAAAAGTTGAAAAAAGG - Intergenic
1096262929 12:50104196-50104218 CTATGATAGAAGATAGCAGCAGG - Intronic
1096520289 12:52181102-52181124 GTGTCATAGAAGATGCAAGAGGG - Intronic
1097227966 12:57490078-57490100 CTATAGCAGAAGATGGTTGAGGG + Intronic
1097331656 12:58338310-58338332 TTTTGATAGAAGAGGGAAGAAGG - Intergenic
1097338477 12:58410993-58411015 AAATAATAGAAAATGGAAAAAGG - Intergenic
1098118650 12:67209988-67210010 CAAAAGTAGAAGATGGAATAAGG + Intergenic
1098292931 12:68975817-68975839 GTATAATTGAAGAAGGAAGAAGG - Intergenic
1098754925 12:74349867-74349889 CTATAATAAAAGAAAAAAGAGGG + Intergenic
1099251887 12:80266356-80266378 CTATGATAGAAAATGAAAGCTGG - Intronic
1099658274 12:85522909-85522931 CTAGAATAGTACATGGAATATGG + Intergenic
1100081724 12:90860692-90860714 TTAAAATTGAAGATGGAAGAAGG - Intergenic
1100421151 12:94435177-94435199 CTATAACAGAAGCTCAAAGATGG + Intronic
1101640433 12:106582782-106582804 CTATAATAGAAGGGGGAAGTCGG + Intronic
1103708145 12:122890803-122890825 CTACAATACAAGAGGGAATAGGG - Intronic
1105053602 12:133078005-133078027 CCATTATACAAAATGGAAGAGGG - Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106757214 13:32834868-32834890 TTGTAATAGGAGATGGAACATGG + Intergenic
1107306533 13:39026388-39026410 CTGTAATATAAGAAAGAAGAGGG + Intronic
1107540419 13:41384304-41384326 CCAAAGTAGAAGATGGTAGAAGG - Intergenic
1108581200 13:51829854-51829876 AAAAAATAGCAGATGGAAGAAGG + Intergenic
1108935389 13:55875356-55875378 CTCAAACTGAAGATGGAAGATGG - Intergenic
1109221015 13:59641105-59641127 CTATAATACAAGGTAGAAGGTGG + Intergenic
1109283211 13:60380813-60380835 CTATAATCCAAGATGGCTGAGGG - Intergenic
1110202056 13:72863229-72863251 CCATAAATTAAGATGGAAGAAGG + Intronic
1110895719 13:80750244-80750266 CTATGCTAGTAGATGAAAGATGG + Intergenic
1110988174 13:82001279-82001301 CTATAATAGAATGTGTAACAAGG + Intergenic
1111002147 13:82198330-82198352 TTGTAATAGAAGATGGAGGATGG + Intergenic
1111521797 13:89414116-89414138 CTAGAATAGATGATGGAATAAGG + Intergenic
1111860078 13:93692614-93692636 CTAAAATTTAAGATGGTAGAAGG - Intronic
1113044208 13:106137134-106137156 CTGTAACAGAAGATGAAACATGG - Intergenic
1114389072 14:22286407-22286429 CTAGTTTTGAAGATGGAAGAGGG - Intergenic
1114688671 14:24559618-24559640 GTTTTATAGAAGATGGAATAAGG - Intergenic
1115626076 14:35193146-35193168 CTCTAATAGAAGATGTATGGGGG + Intronic
1115962545 14:38851926-38851948 CTATAATAGAAAATGGTAAGAGG + Intergenic
1116214255 14:41990797-41990819 CTACCATAGAGGATGGAAGTAGG - Intergenic
1116281160 14:42910027-42910049 TTAAAATTGAAGATGAAAGAAGG - Intergenic
1116377846 14:44226633-44226655 ATATAATAGATGATGGGAGATGG + Intergenic
1116603239 14:46955308-46955330 CCATCATAGAAGATGAAAAATGG + Intronic
1117064367 14:51995351-51995373 CTAGACTTGAAGAAGGAAGAAGG - Intronic
1118092849 14:62501662-62501684 CTCTAAGAGAAAATGGAAAAGGG - Intergenic
1118760259 14:68876693-68876715 CTATAATGGGAGCAGGAAGAGGG - Intronic
1118776007 14:68974434-68974456 CTATAATAGAAGAATGATAAGGG + Intronic
1118821829 14:69350792-69350814 GAATGAGAGAAGATGGAAGAGGG + Intronic
1118960720 14:70528320-70528342 CTAAAAAAGAAGATAGTAGATGG - Intronic
1119201266 14:72754636-72754658 CTAAAATGGAAGACGGCAGATGG - Intronic
1119276215 14:73358683-73358705 CAATAATAGAAGTAAGAAGAAGG - Intronic
1120153603 14:81065409-81065431 ATATCTAAGAAGATGGAAGATGG + Intronic
1120230071 14:81832470-81832492 CTAGAATACAAGATTCAAGAGGG - Intergenic
1121518300 14:94568551-94568573 CAATGATAGAAAATGGAGGAGGG + Intronic
1124132984 15:27006499-27006521 CTAAAATAAAAGTTGGAAGAGGG - Intronic
1125264396 15:37862789-37862811 CCATAATGGAAGATGGAATCTGG - Intergenic
1125463534 15:39928644-39928666 CTTTAGTAAAAGATGGAATATGG + Intergenic
1127342447 15:58062126-58062148 CTAAAATAGAAGAGGCAAAAAGG - Intronic
1127653948 15:61037793-61037815 CTATAATAGAAGATGGAAGAAGG + Intronic
1128163780 15:65442799-65442821 CTATATTTGAGGCTGGAAGATGG + Exonic
1129096335 15:73212396-73212418 CTATAATATATGAAAGAAGAAGG - Intronic
1130790620 15:87152302-87152324 CAATAATAGAAGACGGAAATTGG + Intergenic
1131940387 15:97558417-97558439 CTAGATTTGAAGATGGAGGAAGG - Intergenic
1133668851 16:7997981-7998003 CTGTAGTGGAAAATGGAAGAGGG - Intergenic
1133929698 16:10222304-10222326 CTAGAATTGCAGATGGAAGAAGG + Intergenic
1134861660 16:17565648-17565670 CTATAATAGAAGTCCGAAAAGGG + Intergenic
1135267201 16:21037656-21037678 AAAGAATGGAAGATGGAAGAGGG + Intronic
1135753495 16:25076419-25076441 CTTTAATAGAAGATTGTAAAAGG + Intergenic
1135873658 16:26176757-26176779 CTATATTAGAAAATGGGAAAGGG - Intergenic
1135882815 16:26275695-26275717 CTCTAATAGAAGATGTACAAGGG + Intergenic
1136710360 16:32231993-32232015 CTATAGTAGATAATGGTAGAAGG - Intergenic
1136757552 16:32697418-32697440 CTATAGTAGATAATGGTAGAAGG + Intergenic
1136810554 16:33172957-33172979 CTATAGTAGATAATGGTAGAAGG - Intergenic
1136817030 16:33283037-33283059 CTATAGTAGATAATGGTAGAAGG - Intronic
1137279342 16:46962042-46962064 CTAAAGTAGAAAATAGAAGATGG - Intronic
1137294012 16:47072958-47072980 AAATAACATAAGATGGAAGAGGG + Intergenic
1137583286 16:49647610-49647632 CTAGTATTGAAGATGGAAGGAGG + Intronic
1139125654 16:64073200-64073222 CTATAGTGCAAGTTGGAAGATGG + Intergenic
1139385205 16:66563929-66563951 CTATGAAAGAACATGGAAGTAGG - Intronic
1140494142 16:75368394-75368416 CTATCATAGATGATGTAAAATGG + Intronic
1141400298 16:83741557-83741579 ATATAGTAATAGATGGAAGATGG - Intronic
1141923154 16:87149783-87149805 CTGTAATACAAGATGGCAGTTGG - Intronic
1203059700 16_KI270728v1_random:957767-957789 CTATAGTAGATAATGGTAGAAGG + Intergenic
1143286153 17:5790715-5790737 CACTAATAGAAGATTGGAGAGGG + Intronic
1143396981 17:6607962-6607984 CTATAATTTAAGATAGAACACGG - Intronic
1143688487 17:8539207-8539229 CTATAACAGAATAAGTAAGATGG - Intronic
1145374168 17:22332293-22332315 CTATAAGAAAAGAAGTAAGATGG - Intergenic
1146564127 17:33897239-33897261 ATATCATTGAAGTTGGAAGAAGG - Intronic
1147031182 17:37638032-37638054 CTGTAACAGAAGATGAAACATGG + Intronic
1147745443 17:42691783-42691805 CTAGAAAAGCAGATGGAGGAAGG - Intronic
1148251769 17:46087591-46087613 CTATAACAGAAGTTGAGAGAAGG + Intronic
1148368354 17:47073314-47073336 CTATAACAGAAGTTGAGAGAAGG + Intergenic
1151022421 17:70632721-70632743 CAATAATAGAAAATGGGAGCAGG - Intergenic
1153542832 18:6174492-6174514 CAATAATAGGAGATTGGAGATGG + Intronic
1153723819 18:7935977-7935999 ATATAATAAAAGAAGAAAGAAGG - Intronic
1154346330 18:13546335-13546357 CAACAATAAAAGATTGAAGATGG + Intronic
1155162682 18:23208450-23208472 CTTTATTAAAAGCTGGAAGAAGG - Intronic
1155864713 18:30950898-30950920 CTGTCATTGAAGATGGAGGAAGG + Intergenic
1156093124 18:33495208-33495230 CTGTAATAAAAGAAGAAAGAGGG + Intergenic
1158060921 18:53340416-53340438 CTGCAAAAGAAGATGAAAGAAGG + Intronic
1158287105 18:55895898-55895920 TTGTAATATAGGATGGAAGAAGG + Intergenic
1158767188 18:60466419-60466441 AAATGATGGAAGATGGAAGATGG - Intergenic
1158767189 18:60466426-60466448 ATATAAAAAATGATGGAAGATGG - Intergenic
1159148039 18:64480541-64480563 TTATAACAGGAGATGGAATACGG - Intergenic
1159148393 18:64485008-64485030 CAATAGTAGAATTTGGAAGAAGG - Intergenic
1160251628 18:77208405-77208427 CTATAATATAATATGGGGGAGGG - Intergenic
1161990907 19:7683631-7683653 ATATAATAAATGAGGGAAGAAGG - Exonic
1164631764 19:29766507-29766529 CAAAAAAAGAAGAAGGAAGAAGG - Intergenic
1165341180 19:35213324-35213346 ATATCAAAGAAGAAGGAAGAGGG + Intergenic
1166582319 19:43913099-43913121 CTAGAATATAAGATCCAAGAGGG - Exonic
1168341455 19:55625580-55625602 CTATAAAAGAAGAAGAAAGGAGG - Intergenic
925882914 2:8368094-8368116 CTGAAAGAGAAGATGGATGAGGG - Intergenic
926452516 2:13023212-13023234 CTATAGTTGAGGATGGCAGAAGG + Intergenic
926558186 2:14385064-14385086 CTATACTAAAAGCAGGAAGAAGG + Intergenic
926993934 2:18713860-18713882 CTAAAATAGAAGATAAAAAATGG - Intergenic
926996303 2:18739697-18739719 CTATAATCTCACATGGAAGAAGG - Intergenic
927001828 2:18803560-18803582 CTGTAAAATAAGATAGAAGAAGG - Intergenic
928776572 2:34771709-34771731 TTTTAATAAAAGATGAAAGACGG - Intergenic
928888423 2:36176871-36176893 TTAAAATAGAACATGGAAAAAGG - Intergenic
928972328 2:37043223-37043245 CTGTAACAGGAGATGGAACATGG + Intronic
929304350 2:40343872-40343894 CTATTATAAAAAATGGAAAAGGG - Intronic
929446501 2:42005701-42005723 CTGGAAGAGATGATGGAAGAAGG + Intergenic
930659418 2:54039090-54039112 CTATAATAGAACAGGGAAGTGGG + Intronic
930966828 2:57338544-57338566 CTATAATAGAAAATTGAGGCTGG - Intergenic
931613536 2:64130556-64130578 CTTTAATAGAAGATAGCACAGGG - Intronic
931830113 2:66041881-66041903 CTAAACCAGAAGATGCAAGATGG - Intergenic
932019886 2:68073685-68073707 CAAGGATAGAAGATGGAAGGGGG - Intronic
932650403 2:73549713-73549735 ATATAAAAGAAGATGTAAAATGG - Intronic
933212817 2:79590994-79591016 TTATAAGAGAAGACAGAAGAAGG - Intronic
933643503 2:84789458-84789480 TTATAACAGGAGATGGAACATGG + Intronic
934144730 2:89080697-89080719 CTATAATAAAAGACTGAAAAAGG - Intergenic
934164767 2:89283960-89283982 CGATGACAGAAGAAGGAAGAAGG + Intergenic
934202507 2:89898564-89898586 CGATGACAGAAGAAGGAAGAAGG - Intergenic
934224525 2:90119854-90119876 CTATAATAAAAGACTGAAAAAGG + Intergenic
935286863 2:101572704-101572726 CTATAGCAGGAGATGGAACATGG + Intergenic
935883695 2:107592709-107592731 GTATAACAGAAGGTTGAAGACGG - Intergenic
936895154 2:117419309-117419331 ATATATTATCAGATGGAAGATGG - Intergenic
936997338 2:118429289-118429311 CTATAATAGAAGTATGAACAAGG + Intergenic
937679041 2:124624715-124624737 ATAGAATAGAAGCTGGTAGATGG + Intronic
938662665 2:133503703-133503725 GTATAATAGGAGCAGGAAGATGG - Intronic
939124727 2:138164610-138164632 CTTTAATTCAAGATGGAAAATGG + Intergenic
939304513 2:140393580-140393602 CTGAAATAGAAGATGGAAAATGG - Intronic
939589885 2:144051882-144051904 CTAAAGTGGAAGATGGAAGTAGG + Intronic
939729506 2:145764680-145764702 CTGTAAGAGAAGATGAAGGAGGG - Intergenic
940476883 2:154173877-154173899 CAATAATAGAAGCTGGAAGCTGG + Intronic
941144327 2:161824753-161824775 CTAAAATAAATGGTGGAAGAAGG + Intronic
942141462 2:172981318-172981340 CTATAGTAGTAGATGGATGAAGG + Intronic
943070604 2:183136535-183136557 CTATATCTGAAGATGGAAGATGG - Intronic
943210358 2:184956526-184956548 ATAAAATAGAAGCTGGAGGAAGG + Intergenic
943509467 2:188806057-188806079 CTATTATAGAAAAGGAAAGATGG + Intergenic
944429797 2:199620657-199620679 TTTCAAAAGAAGATGGAAGAAGG - Intergenic
946498276 2:220218456-220218478 CTTGAGTGGAAGATGGAAGAAGG - Intergenic
947484299 2:230533819-230533841 CTTTAATAGAAGATTGTAAAAGG + Intronic
1169555633 20:6746361-6746383 CTAAAATAAAAAATGGAAGGAGG - Intergenic
1170096567 20:12651820-12651842 TTTTTATAGAAGAAGGAAGAAGG + Intergenic
1170174720 20:13456052-13456074 CTATAACAGCAGATGAAACATGG + Intronic
1170184414 20:13572049-13572071 ATATGTTAGAAGGTGGAAGAAGG - Intronic
1170797154 20:19558047-19558069 CTGCAATAGAAGATGGGGGAGGG + Intronic
1171968297 20:31547102-31547124 CTATAAGAGAAGCTGGAAAATGG + Intronic
1173676540 20:44840657-44840679 ATATAATTGAAAATGGAAGAGGG - Intergenic
1173920461 20:46740916-46740938 CAAGAACAGAAGATGGAAAAAGG - Intergenic
1174231052 20:49045967-49045989 CTAAAATAGAAGCTCCAAGAGGG + Intergenic
1178160560 21:29908312-29908334 TCACAGTAGAAGATGGAAGATGG - Intronic
1178775479 21:35546085-35546107 CTATGATAGAAAGTGGATGAGGG - Intronic
1178789438 21:35686273-35686295 CTGTAACAGAAGATGAAACATGG + Intronic
1178819755 21:35964220-35964242 CTATCAAAGAAAAGGGAAGATGG + Intronic
1179215208 21:39361591-39361613 CAACAATAGAAGATGGATGTGGG + Intergenic
1179364591 21:40745121-40745143 CTTTAAAAAAAGATTGAAGAAGG + Intronic
1181860323 22:25813083-25813105 GGAGAATAGAAGAGGGAAGAGGG - Intronic
1182612181 22:31558060-31558082 CAATAATACAGGTTGGAAGAGGG - Intronic
1182877549 22:33705283-33705305 CTAAAAGAAAAGATGGAAGGGGG - Intronic
1185230835 22:49680506-49680528 CTAAAAAAGAAGAAGGAAGTTGG - Intergenic
949283236 3:2371054-2371076 CTATAATTTGAGATGGAAGTGGG + Intronic
950598566 3:14009277-14009299 CTGTAATAGGAGATGGAACACGG - Intronic
950712330 3:14821226-14821248 CTATAAAAGATGAGGGAGGAGGG - Exonic
951400869 3:22230287-22230309 CTATAAAAAAAGAAGGAAAATGG + Intronic
951569992 3:24051983-24052005 ACATAATAGAAGAAGGGAGATGG - Intergenic
951745877 3:25976832-25976854 CTAAAAGAGAAGATAGAACATGG - Intergenic
951870286 3:27354639-27354661 CTATAATACAAAATGGGAGATGG + Intronic
952618732 3:35309154-35309176 CTATAAAAGAGAATGGAATAAGG - Intergenic
953771761 3:45782909-45782931 CTGAAATAGAAGATGGAATGTGG - Intronic
955764106 3:62322358-62322380 AAATAAAAGAAGATGAAAGATGG - Intronic
957323049 3:78656980-78657002 ATTTAATAGAATATGGAATATGG - Intronic
957597511 3:82287321-82287343 CTATAGTTGAAGAAGAAAGAAGG + Intergenic
959948355 3:112150535-112150557 CTACAATTCAAGAAGGAAGATGG - Intronic
960026562 3:113017757-113017779 GTATAAGAGAAGTTGGAAAATGG + Intronic
960919297 3:122730318-122730340 CTGTAATAGAAGAAGCCAGAAGG - Exonic
960926170 3:122796572-122796594 CTATAACATAAGATGGAAGAAGG + Intronic
961414149 3:126745195-126745217 TTATTAAAGAAGAGGGAAGAGGG + Intronic
962144745 3:132829164-132829186 AGAAAATATAAGATGGAAGAGGG - Intergenic
962564654 3:136645367-136645389 CTAGAATAGAGCATGGAGGAAGG - Intronic
962694966 3:137939049-137939071 CTAGAATAGAAAGTGGAGGAGGG - Intergenic
963713741 3:148779131-148779153 GAATAACAGAAGTTGGAAGATGG + Intergenic
964194672 3:154048728-154048750 TAATAATAGATGAAGGAAGAAGG + Intergenic
965045937 3:163576650-163576672 TTATAATAGAAAATGAAGGAAGG - Intergenic
965157614 3:165084685-165084707 CTAGAATAAAATATGGAAGTAGG - Intergenic
965692588 3:171373300-171373322 GTATGATAGAAGATGGTGGAGGG - Intronic
966104821 3:176323228-176323250 GTAGAATAGCAGATGGAACACGG + Intergenic
966369650 3:179235547-179235569 TTATAAAAGAGAATGGAAGACGG - Exonic
966435402 3:179878174-179878196 CCATGATAGAAGATGGAAGAGGG - Intronic
966721965 3:183072382-183072404 CTCTAATTGCAGATGGAGGAGGG + Exonic
969389892 4:6884726-6884748 CTGTAACAGGAGATGGAACATGG - Intergenic
970467889 4:16345969-16345991 CTGTCTTTGAAGATGGAAGAAGG - Intergenic
972020948 4:34313454-34313476 CTTTCATAGTAAATGGAAGATGG - Intergenic
972043237 4:34630682-34630704 CTGTATTTGAAGTTGGAAGAAGG - Intergenic
972305026 4:37822703-37822725 ATAGAATAGTAGATTGAAGAAGG - Intergenic
974642175 4:64645414-64645436 AAATAATAGAAGGTAGAAGATGG - Intergenic
974694768 4:65352015-65352037 CTGTAACAGCAGATGGGAGACGG + Intronic
976009907 4:80474585-80474607 ATATGATAGAATGTGGAAGATGG + Intronic
976777509 4:88722223-88722245 CCTTAATAGATGATGGTAGATGG - Intergenic
977104197 4:92859522-92859544 CTATAAGATAACAAGGAAGAAGG - Intronic
977383149 4:96303178-96303200 CTATCATAGAAGGTGGAATATGG + Intergenic
977590506 4:98821055-98821077 CCAAAGGAGAAGATGGAAGATGG + Intergenic
977886968 4:102263027-102263049 GAGTAATAGAAAATGGAAGATGG - Exonic
978613176 4:110566777-110566799 ATAGAACAGAAGATGGAGGAAGG - Intergenic
978747979 4:112215964-112215986 ATAGAATATAAGATGGAAGCTGG - Intergenic
979202425 4:117994222-117994244 CTAGTTTTGAAGATGGAAGAGGG - Intergenic
980218788 4:129886756-129886778 CTATAATAGAAGATGAAACATGG + Intergenic
980373279 4:131907885-131907907 CTATCTTTGAAGATAGAAGAAGG - Intergenic
980522375 4:133950602-133950624 CTCAAACTGAAGATGGAAGATGG - Intergenic
982634556 4:157877302-157877324 CAATAATAGGAAATGGAAAAAGG - Intergenic
982654183 4:158125821-158125843 GTATAAGAGAAGATGGACCAAGG - Exonic
982761471 4:159289457-159289479 CTATAATTGCTGATGGAAGGGGG + Intronic
986350796 5:6877947-6877969 CTACAGAAGAAGAAGGAAGAGGG - Intergenic
986373521 5:7106170-7106192 AGATAATAAAAGATGAAAGATGG + Intergenic
986410072 5:7469012-7469034 CTATAATAAAATAAAGAAGAAGG - Intronic
986537978 5:8812593-8812615 CTAAAATAGAAGTTGGATAAAGG + Intergenic
988072081 5:26304946-26304968 GTATAAAATAAGATTGAAGATGG - Intergenic
988177043 5:27742332-27742354 CTTTAATTCAAGAAGGAAGATGG + Intergenic
988828367 5:34963428-34963450 TTATAACAAAAGATGGAACATGG - Intergenic
990096582 5:52121828-52121850 CTATAATAAAAAATGTAAGCCGG + Intergenic
990334262 5:54756720-54756742 CTATATTAAAAGCTAGAAGAAGG + Intergenic
990677720 5:58206720-58206742 CTACAGTGGAAGATGGCAGATGG + Intergenic
991009767 5:61870735-61870757 CTATGATAGCAGATGGAGGCAGG - Intergenic
991579020 5:68134961-68134983 CCAAAATAGAATATGGAATAAGG + Intergenic
993425845 5:87763254-87763276 CTAAAATATAAGATGCATGAGGG + Intergenic
993492792 5:88572231-88572253 CCATAATGGAGGAAGGAAGATGG - Intergenic
996826932 5:127693782-127693804 CTATCATAGATCATGAAAGAGGG - Intergenic
997602108 5:135147661-135147683 CTATAATTGAAGATGAAATTTGG + Intronic
999097523 5:148993404-148993426 ATAAAATAGAAGATGGAAAAAGG + Intronic
1000904221 5:166944068-166944090 CCCTAATAGAAGATTAAAGATGG + Intergenic
1001281894 5:170392007-170392029 CAATAGTAGAATATGGTAGAAGG + Intronic
1003044248 6:2718354-2718376 TTAGAATAGAAGAAGGGAGAAGG - Intronic
1003092294 6:3114449-3114471 CTAGAATAGAAGACTGAAGCTGG + Exonic
1003618624 6:7677701-7677723 AAATAGGAGAAGATGGAAGATGG - Intergenic
1003804585 6:9712900-9712922 CTTTAAAAAAAAATGGAAGAAGG + Intronic
1005253120 6:23970734-23970756 TTATAACAGAAGATGAAATATGG + Intergenic
1006529845 6:34642495-34642517 CTATAACAGGAGATGAAACACGG + Intronic
1007393629 6:41564786-41564808 TTAAAATGGAAGATGGAAGGTGG + Intronic
1008772876 6:55000924-55000946 CTATACTAGAAGGTGGAATTTGG - Intergenic
1008966923 6:57322233-57322255 CTAGAATAGAATGGGGAAGAGGG + Intronic
1011954863 6:93014906-93014928 CTTTAATTCAAGATGGAAAATGG + Intergenic
1014322145 6:119943131-119943153 CTTTAATTCAAGAAGGAAGATGG - Intergenic
1015078120 6:129188116-129188138 CTATAATGCAAGGTGGAATATGG - Intronic
1015796238 6:137014707-137014729 CAATAATATAAGGTGGAAAAGGG - Intronic
1015841210 6:137479177-137479199 CTATACTAGAACCTGGATGAAGG + Intergenic
1015900501 6:138060595-138060617 TTCTAATAGAAGATGAAATATGG + Intergenic
1016540833 6:145161954-145161976 CTATAAAAGAAACTGGATGAAGG + Intergenic
1017692788 6:156983751-156983773 CTACAATGGAAGAGGGATGATGG + Intronic
1018492825 6:164313225-164313247 CTATAATAAAAGATGGACAGAGG + Intergenic
1019131211 6:169877433-169877455 CTAAAAAGGAAGACGGAAGAAGG - Intergenic
1020378027 7:7509832-7509854 GTATAACTGAACATGGAAGATGG - Intronic
1020572045 7:9875852-9875874 CTAACTTTGAAGATGGAAGAAGG - Intergenic
1021239885 7:18187372-18187394 CTAGAAAAGAAGATAGAATAGGG - Intronic
1021322980 7:19234371-19234393 GTACAGTAGAAGGTGGAAGAAGG + Intergenic
1022314962 7:29237175-29237197 TTATAATGGAAAATGGAAAAGGG - Intronic
1023282743 7:38588263-38588285 CTATTAATTAAGATGGAAGATGG + Intronic
1024493853 7:50019497-50019519 CTATAATATAATCTTGAAGAGGG + Intronic
1027376049 7:77550978-77551000 CTGTAATAGGAGATGAAACATGG - Intronic
1027553425 7:79631506-79631528 ATATAAAATAAGATGGAAGTGGG - Intergenic
1027843006 7:83338116-83338138 CTACAATAGAAGATGAAATTTGG + Intergenic
1028127878 7:87135278-87135300 GAATGATAGAAGATGGAAAAAGG - Intergenic
1028417104 7:90592853-90592875 ATAGTATATAAGATGGAAGAGGG + Intronic
1029058066 7:97767461-97767483 CAATAACAGCAGAAGGAAGATGG - Intergenic
1030000296 7:105052340-105052362 CTATTTTAGATAATGGAAGAGGG - Intronic
1030506045 7:110423946-110423968 GTACAATAGAATATGGATGAAGG - Intergenic
1032310684 7:130783947-130783969 CTGAAATAGAAGATAGAAGATGG - Intergenic
1032567799 7:132965874-132965896 TTGTCATAAAAGATGGAAGAAGG + Intronic
1032810847 7:135415263-135415285 CTATAAAAGAAGAAGAAATAAGG + Intronic
1033485614 7:141786207-141786229 GTAGAATAGGGGATGGAAGATGG + Intronic
1033816141 7:145075865-145075887 ATATAAGAGGAGAAGGAAGATGG - Intergenic
1034476109 7:151283277-151283299 CCATATTAACAGATGGAAGAAGG + Intergenic
1038102724 8:24396925-24396947 CTATAATGGAAAATGGAGTAAGG - Intronic
1038161937 8:25047875-25047897 ATTTAATGGAAGATAGAAGATGG - Intergenic
1038612287 8:29068263-29068285 CAAGAAAAGAAGATAGAAGACGG + Exonic
1039402806 8:37285606-37285628 CTGTAACAGAAGATGAAACATGG + Intergenic
1040641521 8:49339975-49339997 ATAAAATAGAACATTGAAGAAGG + Intergenic
1042097912 8:65238730-65238752 CAATAATTGAAGAAGGAATAAGG + Intergenic
1043570624 8:81598901-81598923 TCAAAATAGAAGGTGGAAGAGGG + Intergenic
1043693216 8:83183755-83183777 CTACAAGAGAAAATGTAAGATGG - Intergenic
1045332313 8:101166032-101166054 CTATAGAAAAAGAAGGAAGAGGG + Intergenic
1045891306 8:107161040-107161062 CAATGAAAAAAGATGGAAGAAGG - Intergenic
1046226627 8:111289144-111289166 CTAAAATAGAACATGCAAGAGGG + Intergenic
1046305850 8:112366039-112366061 CTATAACAGGAGATGAAACATGG + Intronic
1046465457 8:114596390-114596412 CAATAATAGTAAATGTAAGAAGG - Intergenic
1046622345 8:116541659-116541681 TTATAAGAGAAGAAAGAAGAGGG - Intergenic
1048048171 8:130792687-130792709 CAATAAAAGAAAATGGATGAGGG - Intronic
1049341431 8:142114646-142114668 CTTTGAGAGAAGAAGGAAGAAGG + Intergenic
1050028149 9:1356971-1356993 CTATTATAGAAGGTGGCAGCAGG - Intergenic
1050409559 9:5348758-5348780 TAAAAATGGAAGATGGAAGATGG - Intergenic
1050745407 9:8870415-8870437 CTAGAATTGAAGATGCAAGGGGG + Intronic
1051046764 9:12884962-12884984 CTATAATGGAAGACAGCAGAGGG - Intergenic
1051283884 9:15474404-15474426 ATAAATTAGAAGATAGAAGATGG + Intronic
1051571638 9:18565112-18565134 CTATAATAGAGCAAGGAAGGTGG + Intronic
1052031342 9:23632486-23632508 CAATAAAAGAATAGGGAAGAGGG - Intergenic
1052074261 9:24121204-24121226 CTACCACAGAAGATGGAAAAAGG + Intergenic
1052107247 9:24533948-24533970 CATTAATCTAAGATGGAAGAAGG + Intergenic
1053638273 9:40038058-40038080 CTATCTTTGAAGATAGAAGAAGG - Intergenic
1053767809 9:41427165-41427187 CTATCTTTGAAGATAGAAGAAGG + Intergenic
1054319067 9:63634658-63634680 CTATCTTTGAAGATAGAAGAAGG - Intergenic
1054546477 9:66338666-66338688 CTATCTTTGAAGATAGAAGAAGG + Intergenic
1054746826 9:68862491-68862513 CTATAAGAAAAGCTGGAAGTGGG + Intronic
1055090584 9:72361986-72362008 CAAAATTAGAAGATGGGAGAAGG + Intronic
1055483187 9:76730599-76730621 CTGAAATAAAAGATGAAAGAGGG + Intronic
1055882070 9:81013696-81013718 GTAGAATAGCAGATGGAACACGG - Intergenic
1056329669 9:85511067-85511089 CTAGGATGCAAGATGGAAGAGGG - Intergenic
1058587261 9:106522893-106522915 CTATTCTAAAAGATGGAGGAGGG + Intergenic
1059372279 9:113851802-113851824 CTTTAACAGAAGATTCAAGATGG - Intergenic
1059855704 9:118395059-118395081 CTGAAATAGAAAATGCAAGAGGG - Intergenic
1060340574 9:122772191-122772213 CTATCATAAAAGAAGGAAGGAGG + Intergenic
1061513912 9:131077378-131077400 CTATTATAGAAGCTGGAGGCTGG + Intronic
1202786144 9_KI270719v1_random:21617-21639 CTATCTTTGAAGATAGAAGAAGG - Intergenic
1186707705 X:12159571-12159593 CTATAAAAGAATATAGAACATGG - Intronic
1186851091 X:13580869-13580891 GAATGATATAAGATGGAAGATGG - Intronic
1187964176 X:24594448-24594470 TTAAAATAGAAAATGGAAAATGG - Intronic
1189011528 X:37049953-37049975 CTAAAATAATAGATGGAACAAGG + Intergenic
1189074022 X:37897182-37897204 CTATAAAAGATGAGGGCAGAGGG + Intronic
1190034996 X:47014053-47014075 TTATAATAGGAGATGAAACATGG - Intronic
1192308755 X:69991281-69991303 CTTAAATAGAAGATGTAAGTAGG - Intronic
1192746427 X:73943388-73943410 AAATAAAAGAAGAGGGAAGATGG + Intergenic
1194071927 X:89335675-89335697 CTCTAACAAAAAATGGAAGAGGG + Intergenic
1195742036 X:108074631-108074653 CTATAATAGAAGTCTGAACAGGG + Intronic
1196818292 X:119682743-119682765 CTATCACAGAGGTTGGAAGAGGG - Intronic
1197683557 X:129413358-129413380 CTAGACAACAAGATGGAAGAAGG + Intergenic
1198333100 X:135640422-135640444 CCTGAAGAGAAGATGGAAGATGG - Intergenic
1198333347 X:135642711-135642733 CATTAAGAGAAGATGGAAAATGG - Intergenic
1198614601 X:138442567-138442589 CTGTAAGAGATGCTGGAAGAGGG - Intergenic
1198934639 X:141893966-141893988 CTAAAATACTAAATGGAAGAGGG + Intronic
1199604237 X:149563825-149563847 CTATAATAGCAGGTGGAGGGGGG + Intergenic
1200726169 Y:6671404-6671426 CTCTAACAAAAAATGGAAGAGGG + Intergenic
1201554750 Y:15256289-15256311 CATTAATAGAAGATCAAAGAAGG + Intergenic
1201724492 Y:17137864-17137886 GTAGAATAGCAGATGGAACATGG + Intergenic