ID: 1127658379

View in Genome Browser
Species Human (GRCh38)
Location 15:61076913-61076935
Sequence CTTTGAACAAGCAAGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 292}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127658379_1127658386 26 Left 1127658379 15:61076913-61076935 CCCTCTCCCTTGCTTGTTCAAAG 0: 1
1: 0
2: 0
3: 22
4: 292
Right 1127658386 15:61076962-61076984 TTCTTGAACTACACACAAGTGGG 0: 1
1: 0
2: 0
3: 12
4: 145
1127658379_1127658385 25 Left 1127658379 15:61076913-61076935 CCCTCTCCCTTGCTTGTTCAAAG 0: 1
1: 0
2: 0
3: 22
4: 292
Right 1127658385 15:61076961-61076983 CTTCTTGAACTACACACAAGTGG 0: 1
1: 0
2: 0
3: 8
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127658379 Original CRISPR CTTTGAACAAGCAAGGGAGA GGG (reversed) Intronic
901718187 1:11173586-11173608 CTTTGAACAATCAAGAGAGTAGG - Intronic
904698538 1:32344523-32344545 CTCTGAACAAGCAGAAGAGAAGG - Intergenic
905434234 1:37946137-37946159 CTCTGAACCATCAGGGGAGAAGG - Intronic
906755360 1:48308837-48308859 CTTAAAAGCAGCAAGGGAGAAGG - Intronic
907621154 1:55982320-55982342 CTTTAAAGCTGCAAGGGAGACGG - Intergenic
908079354 1:60559388-60559410 CTTTGAACCAGAAACAGAGATGG - Intergenic
908257670 1:62316260-62316282 CGGTGAACAGGCCAGGGAGAGGG + Intronic
910238191 1:85057696-85057718 CATTGAACAACTAAGGGTGAGGG - Intronic
911754793 1:101541039-101541061 CTTTGAATAAGCAATGGAGGAGG - Intergenic
911965080 1:104358220-104358242 ATTTGAACAAGCAAAGGAGCTGG - Intergenic
915507004 1:156364148-156364170 CTGTGTACAAGCTAGGAAGAGGG - Intronic
915592585 1:156879099-156879121 CTGTGAACAAGAAAAGGAGAGGG - Intronic
917231984 1:172847157-172847179 CTGTGAAGAAGGAAAGGAGAGGG + Intergenic
917266502 1:173226338-173226360 TTTTGAACAAGTAAGATAGAAGG - Intergenic
917648716 1:177054598-177054620 CTTTGAACAAACAGGGGCTATGG + Intronic
918691180 1:187481228-187481250 CTTTGAACAAGAAAGCAATATGG - Intergenic
920498715 1:206473060-206473082 CATTCCACAAGCAAGGGAGCGGG - Intronic
921704286 1:218303362-218303384 CTTGAAACAAGAAAAGGAGATGG - Intronic
1064644319 10:17445523-17445545 CTTTGGAAAAGAAAGGCAGACGG - Intronic
1066506384 10:36048939-36048961 CCTTGAACTAGGAGGGGAGAGGG + Intergenic
1068903617 10:62298259-62298281 TTTGGAACAACCCAGGGAGAAGG + Intergenic
1069257491 10:66352135-66352157 ATTTCAACAAGCAAGCAAGAAGG + Intronic
1073344852 10:102775361-102775383 CTTTGCACAAGCAAGGGCCCTGG - Intronic
1074610395 10:115016052-115016074 CTCTGAACTAGCAAAGCAGAAGG - Intergenic
1075146310 10:119885762-119885784 CTTTAAATCAGAAAGGGAGAAGG - Intronic
1077508565 11:2943441-2943463 ATTTGCACAAGCAGGGGAAAGGG - Intergenic
1077544179 11:3161954-3161976 CTGTGAGCAAGGAGGGGAGAGGG + Intronic
1077604477 11:3599278-3599300 CTTTGAACAACCAATGGTGTTGG + Intergenic
1079289678 11:19175921-19175943 CTTTCACCCAGCCAGGGAGAAGG + Exonic
1080282912 11:30579438-30579460 CCTTGAATAAACAAGAGAGATGG + Intronic
1081033413 11:38113729-38113751 CTTTGAATCAGAGAGGGAGAAGG - Intergenic
1081129679 11:39363598-39363620 CTTTGTACAAGAAAAGGAGATGG + Intergenic
1081362847 11:42201483-42201505 TTTTGAAAAAGTAAAGGAGATGG - Intergenic
1081736537 11:45408431-45408453 CATTGAACAAGAACTGGAGAAGG + Intergenic
1083193258 11:61067881-61067903 CTTGGAACCAGCAAAGGAGTCGG + Intergenic
1083605604 11:63976759-63976781 CTTTGCACAAACAAGGGAGCTGG - Intronic
1084226934 11:67722093-67722115 CTTTGAACAACCAATGGTGTTGG + Intergenic
1084808263 11:71594762-71594784 CTTTGAACAACCAATGGTGTTGG - Intronic
1084812402 11:71621376-71621398 CTTTGAACAACCAATGGTGTTGG - Intergenic
1084845371 11:71894772-71894794 CTTTGAACAACCAATGGTGTTGG - Intronic
1085182330 11:74546414-74546436 CTTCAAACAAGCGAGGGAGGTGG - Intronic
1085714350 11:78858573-78858595 TTTTTAACAAGCAAGACAGAAGG - Intronic
1085772458 11:79337627-79337649 CTATGAAAAAGCAAAGGAAATGG + Intronic
1086217430 11:84400680-84400702 ATTTGAACAAGAAAGGGAAAGGG - Intronic
1086956265 11:92937245-92937267 CTTGGAGAAAGCAAGGGAGGAGG + Intergenic
1088874587 11:113923676-113923698 CTTTTAACAAGCAAGATGGAAGG + Intronic
1089340458 11:117753984-117754006 CTGAGGACAAGTAAGGGAGAAGG + Intronic
1090083875 11:123633843-123633865 CTTTGACCAAAGAAGGGAGTTGG + Intronic
1090855930 11:130609410-130609432 CCTTGGACAAGGAAGAGAGATGG - Intergenic
1091252278 11:134153924-134153946 CCATGAACAATCAAGGGCGAGGG - Intronic
1091863350 12:3806636-3806658 CTGTGAACTAGAAAGGGAGTGGG + Intronic
1092292525 12:7170656-7170678 CATTAAATAAGGAAGGGAGAAGG - Intergenic
1092537790 12:9404070-9404092 CTTAGAACAACCAACGCAGAGGG + Intergenic
1093339221 12:17950431-17950453 CTTGGTACAAGGAAGGAAGAAGG - Intergenic
1100193062 12:92213448-92213470 TTTGGAATAAACAAGGGAGATGG + Intergenic
1100562386 12:95760927-95760949 CTTTAAGGAAGAAAGGGAGATGG - Intronic
1100695135 12:97084499-97084521 CTCTGAACTGGAAAGGGAGAGGG + Intergenic
1101504992 12:105337856-105337878 CTTTGAACAAGGATGGGGTATGG + Intronic
1101588991 12:106109911-106109933 CTCTGAAAAAGAAAGGAAGAAGG - Intronic
1104019431 12:124981729-124981751 CTTAGAACAACCAAGCCAGAAGG - Intronic
1104820159 12:131672481-131672503 CTTTGAGCAGGGAAGGGACAAGG - Intergenic
1105807471 13:23963620-23963642 CTTTAAACAGGCATGGGAGCAGG - Intergenic
1107063851 13:36190924-36190946 TTTTGAACAAGAAAGGGACTTGG - Intronic
1108571162 13:51752770-51752792 CTCTAAATAAGCAATGGAGATGG + Intronic
1109227121 13:59710505-59710527 TGTTAAACAATCAAGGGAGAAGG + Intronic
1110500311 13:76219697-76219719 CTTTCAAAAAGCCAGTGAGATGG - Intergenic
1110749815 13:79099986-79100008 CTTTGAACAAGCCATAGAAAAGG + Intergenic
1116101287 14:40440456-40440478 CTTTGAAGAAGCAACTCAGATGG + Intergenic
1116377887 14:44227020-44227042 CTTTGAAAAACCAAGGCAGGAGG - Intergenic
1117039689 14:51758329-51758351 CTTTGAACAACCAATGGTGTTGG - Intergenic
1117681819 14:58211295-58211317 CTTGGAGCAAGCAAGACAGATGG - Exonic
1118010074 14:61601818-61601840 CATTTTACAAGCAAAGGAGAAGG - Intronic
1118681530 14:68246396-68246418 GTTTGTACAAACCAGGGAGATGG + Intronic
1118768599 14:68926898-68926920 CTATGAACAAGAAAGGGAACAGG + Intronic
1118800630 14:69186309-69186331 CTTAGTATAAGCAAGGAAGAAGG + Intergenic
1120133261 14:80832667-80832689 ATTTCACCAAGCAAAGGAGAAGG + Intronic
1122003334 14:98682595-98682617 CTTTGCACAAGCAATGCAGCTGG + Intergenic
1122003511 14:98683823-98683845 CTTTGCACAAGCAATGGAGCTGG + Intergenic
1122896482 14:104760080-104760102 CTTTGCTCTAGCAGGGGAGATGG + Intronic
1124023018 15:25941105-25941127 CTGTCTACAAGCCAGGGAGAAGG - Intergenic
1126110967 15:45174497-45174519 CCTTGCCCAAGCAGGGGAGAGGG + Intronic
1126478635 15:49093252-49093274 CTTTGAAAGACCAAGGCAGATGG - Intergenic
1127658379 15:61076913-61076935 CTTTGAACAAGCAAGGGAGAGGG - Intronic
1128487782 15:68112213-68112235 CCTTGAATAAGCAAGTGAGTAGG - Intronic
1128894234 15:71357870-71357892 CTTTGAATAAGTAAGGCAGTTGG - Intronic
1129979472 15:79854250-79854272 CTTAGAGAAAGCAAGAGAGATGG + Intronic
1130891128 15:88135041-88135063 CTTTCTACAAGCTTGGGAGATGG - Intronic
1136404496 16:30036215-30036237 CTTGGAAAAAGGAAGGGAGGGGG + Intronic
1137515285 16:49138150-49138172 CTGTCAGCAAGCAAGGGAGGAGG - Intergenic
1139323790 16:66135827-66135849 CTGTCTCCAAGCAAGGGAGAAGG + Intergenic
1141838477 16:86558929-86558951 ATTTGAACCAGCCAGGGAGCAGG - Intergenic
1146328506 17:31907441-31907463 CTTGGAACAAGGCAGGGGGATGG - Intergenic
1146621563 17:34402392-34402414 TTTTGAAAAACCAAGGGACAAGG + Intergenic
1146966309 17:37033964-37033986 GGTAGAGCAAGCAAGGGAGAAGG + Intronic
1148169568 17:45507857-45507879 GCTTGATGAAGCAAGGGAGAGGG + Intergenic
1148505718 17:48125657-48125679 ATTTTCACAAGCAAAGGAGAAGG + Intergenic
1148698221 17:49573778-49573800 CCTTGAACAAGGAAGGCATATGG - Intergenic
1148743407 17:49905666-49905688 CTTTGAGCAGACAAGGGAGGAGG + Intergenic
1148848604 17:50543240-50543262 CCTTGGCGAAGCAAGGGAGAGGG - Exonic
1149112929 17:53055827-53055849 CCTTGAAAAAGCAAGTGATATGG + Intergenic
1150524830 17:65911704-65911726 ATTTGAAGAAACAAGGGAAACGG - Intronic
1152345748 17:79750164-79750186 CTGATAACAAGCAAGGGAGGCGG + Intergenic
1153168001 18:2283898-2283920 CTTTGGGCGAGGAAGGGAGAAGG - Intergenic
1153893181 18:9536670-9536692 CTTTGACCAACCCAGTGAGAAGG - Exonic
1155493718 18:26423157-26423179 AAATGAAGAAGCAAGGGAGAGGG - Intergenic
1156631590 18:38975773-38975795 CTTAGAGCAAGCGAAGGAGAGGG + Intergenic
1156705435 18:39875808-39875830 CTTTGAGTAAGCACAGGAGAAGG - Intergenic
1158059676 18:53324455-53324477 CTCTGAAGAAGCATGGTAGAGGG + Intronic
1158156880 18:54435819-54435841 CTTTTCCCAAGCAAGAGAGAGGG + Intergenic
1159912920 18:74163505-74163527 GTTTCGACAAGCAAGGGAAAAGG + Intergenic
1161943784 19:7421915-7421937 CCTGGAAGAAGGAAGGGAGAAGG - Intronic
1162951697 19:14074974-14074996 CTCTTAACAGTCAAGGGAGAGGG - Exonic
1165400964 19:35599877-35599899 CTTTGAAAGATCAAGGCAGAAGG + Intergenic
1166251357 19:41573108-41573130 CTTTGCACAAGGAAGGGACCCGG - Intronic
1167734670 19:51286307-51286329 CTTTCAACTATGAAGGGAGAGGG - Intergenic
1168592866 19:57651624-57651646 CTGAGAGCAAGGAAGGGAGAAGG - Intergenic
1168600695 19:57716006-57716028 CCTTAAACAAGAAAGGAAGATGG - Intronic
925067367 2:938725-938747 TTTTTAACTAGAAAGGGAGAGGG - Intergenic
927431207 2:23027684-23027706 GTTTGAACAGGCAAGGGATGGGG - Intergenic
928321821 2:30289842-30289864 CCTTGAAGAGGCAAGGTAGAGGG + Intronic
928714124 2:34040726-34040748 ATTTAAACAACCAATGGAGAGGG - Intergenic
928945123 2:36765197-36765219 CTTTGTAAAAGGAAGGCAGAGGG + Intronic
929689488 2:44062552-44062574 CTTTGAAAAGCCAAGGCAGACGG + Intergenic
931571883 2:63677834-63677856 CTTGGAAAAAGCAATGGATAGGG + Intronic
931859918 2:66344327-66344349 GTTTGAACATGAAAGTGAGAAGG - Intergenic
931899208 2:66769371-66769393 AGGTGAACAAGGAAGGGAGAGGG - Intergenic
932248878 2:70222190-70222212 CCTTGAAAAGGCAAGAGAGATGG + Intronic
933239441 2:79903569-79903591 CCTTGAGGAAGCAAGGTAGATGG + Intronic
934852183 2:97708287-97708309 CTTTGATGAAGAAAGGGAAATGG - Intergenic
935150246 2:100427362-100427384 CTTTGATCAACCCAGTGAGAAGG - Intergenic
936720664 2:115248629-115248651 CATTGAATAAGGGAGGGAGATGG + Intronic
936850510 2:116892059-116892081 CTTTCAAAAAACAAGAGAGATGG + Intergenic
937484112 2:122295927-122295949 CTTTGAATAAGTAAGGCAGGTGG - Intergenic
937538139 2:122916294-122916316 CATAGAGCAAGCAAGGGAGCTGG + Intergenic
940480310 2:154220726-154220748 CTTATAACAATCAAGGGAGTAGG + Intronic
942194975 2:173508327-173508349 CTGTGGACAGGCAAGGGATATGG + Intergenic
943419965 2:187658021-187658043 CCTCCAACAAGCAAGAGAGAAGG - Intergenic
943688498 2:190844239-190844261 CTGTGAACAAACATGGGAGGGGG + Intergenic
943801926 2:192071049-192071071 CTTTGAATAAGTAAGGGAGGAGG + Intronic
945530011 2:210941343-210941365 CTTTGAGAAAGAAAGTGAGAAGG + Intergenic
946086563 2:217179351-217179373 CTTTGAAGATGGAAGGAAGATGG + Intergenic
947898180 2:233694754-233694776 CTGTGAAAAGGCAAGGGTGAGGG + Intronic
948178992 2:235965422-235965444 TTTTGAAGAAGCAATGGTGAAGG + Intronic
948244147 2:236464060-236464082 CTCTGAGCCAGCAAGGGAGAAGG + Intronic
1168992157 20:2103802-2103824 CTTGGAACCAGACAGGGAGAGGG - Intronic
1169067209 20:2700907-2700929 CTATGAACAAGAGACGGAGAAGG - Intronic
1169085222 20:2822023-2822045 CATTGATCAAGGAATGGAGAAGG + Intergenic
1170103579 20:12728877-12728899 CTCAGAGCAAGCAAGTGAGAGGG + Intergenic
1170715847 20:18830199-18830221 GTTGGAACAGACAAGGGAGAGGG - Intergenic
1172590616 20:36115213-36115235 CTTTGAGTAAGTAAGGGAGCTGG + Intronic
1174946486 20:54991906-54991928 ATATAAACAAACAAGGGAGAGGG - Intergenic
1178563110 21:33657646-33657668 CTTTGAACAAGGGAGGGATTAGG + Intronic
1181129995 22:20725596-20725618 CTATCAATAAGCCAGGGAGATGG + Intronic
1182178184 22:28315189-28315211 CTCTCAACAAGCCAGGGAGGAGG + Intronic
1184224596 22:43122034-43122056 CTTTCAGCATTCAAGGGAGATGG - Intronic
949754818 3:7396981-7397003 CCTTGAACATTCAAGGAAGATGG + Intronic
951261639 3:20516867-20516889 CTTGGATCAAGCAAAGGAGAGGG - Intergenic
952738939 3:36716951-36716973 CTTTAAATAAGGTAGGGAGAGGG - Intronic
955130159 3:56157992-56158014 CTGAGCACCAGCAAGGGAGAGGG + Intronic
955345048 3:58154717-58154739 GTTTGAACAAGGATGGAAGAGGG + Intronic
955615704 3:60804405-60804427 CTTTGTACAAGCAAGGGCTCTGG + Intronic
955921010 3:63955348-63955370 CTTTGAATCAGCAGTGGAGATGG + Intronic
956058908 3:65330106-65330128 CTTTGAACCACTGAGGGAGAAGG + Intergenic
957075328 3:75598285-75598307 CTTTGAACAACCAATGGTGTTGG + Intergenic
957249467 3:77754704-77754726 TTTTGAAAAAGAAAGGGAGGAGG + Intergenic
958979881 3:100708854-100708876 ATTTGAACAGGTAAGGGAGAAGG + Intergenic
959679582 3:109078767-109078789 CTTTGGCCAAGAAAGAGAGATGG + Intronic
960222090 3:115125097-115125119 CTTTGGAAAACCAAGGCAGAAGG + Intronic
960795900 3:121487357-121487379 CTTTTCACAAGCCAGTGAGATGG + Exonic
960950052 3:122993369-122993391 CTTTGAGGAAACACGGGAGAGGG - Intronic
961275862 3:125725849-125725871 CTTTGAACAACCAACGGTGTTGG - Intergenic
961576517 3:127841234-127841256 CTTGGAAGGAGCATGGGAGAGGG + Intergenic
961719634 3:128884433-128884455 ATTTGAACAGGGGAGGGAGATGG + Intronic
961850827 3:129816574-129816596 CTTGGGAAAGGCAAGGGAGAGGG + Intronic
961875618 3:130021190-130021212 CTTTGAACAACCAATGGTGTTGG + Intergenic
963914440 3:150845031-150845053 CTGTGAACAACCAAATGAGAAGG + Intergenic
965171321 3:165268285-165268307 CTTTGTAAGAGAAAGGGAGAGGG - Intergenic
966538025 3:181055722-181055744 ATTTTAAAAATCAAGGGAGATGG - Intergenic
967887100 3:194340949-194340971 CTTTTCACATGCAAGGGACAGGG - Exonic
968392464 4:204773-204795 CTTTTAACAAGCAGAGGTGAAGG - Intergenic
968987975 4:3888937-3888959 CTTTGAACAACCAATGGTGTTGG + Intergenic
969018971 4:4126240-4126262 CTTTGAACAACCAATGGTGTTGG + Intergenic
969023609 4:4156114-4156136 CTTTGAACAACCAATGGTGTTGG + Intergenic
969400954 4:6955165-6955187 CTTTGAAAATGCAAGGGAAAAGG - Intronic
969786372 4:9460587-9460609 CTTTGAACAACCAATGGTGTTGG - Intergenic
970506115 4:16732194-16732216 CTTTGAAAAGGCAAGGCTGAGGG - Intronic
972563457 4:40248833-40248855 CTTTGAACAAGGGAGTGACAGGG + Intergenic
972727464 4:41757808-41757830 TTATGAATAAGCAAGGGAGTTGG - Intergenic
972901073 4:43684058-43684080 ATTTGAAGGAGCGAGGGAGAAGG + Intergenic
973832476 4:54775468-54775490 CTATGAAAAAGCAAGGGCTATGG + Intergenic
973886134 4:55324066-55324088 CTTGAAAGAAGCAAGGGAGGAGG + Intergenic
975741531 4:77433894-77433916 CTTTTAACAAGCAAGTGGGATGG - Intergenic
976128598 4:81859535-81859557 CTTGGTACCAGAAAGGGAGATGG - Intronic
978403954 4:108360536-108360558 CTCTGAACAAGGAAGGGAAGAGG - Intergenic
980085460 4:128386038-128386060 CTGGTAACAAGCAATGGAGATGG + Intergenic
980410326 4:132409746-132409768 CTAGGAACAAGGAAGAGAGAAGG - Intergenic
980566742 4:134552277-134552299 CCTTGAATGAGAAAGGGAGAGGG + Intergenic
980832789 4:138152053-138152075 CTTTGTAAAAGGAAGGTAGAAGG + Intergenic
981056309 4:140365671-140365693 CATTGAACAAGCTGAGGAGAAGG - Intronic
982106846 4:152018659-152018681 CTTTCAGCAGGGAAGGGAGAAGG - Intergenic
982375954 4:154690822-154690844 CTTTTAAGAAGCAGGGGACATGG - Intronic
982483543 4:155939927-155939949 CCTTAAAAAAGCAAGGGGGATGG - Intronic
983123807 4:163923541-163923563 CTTAGGATAAGCAAGGAAGAAGG + Intronic
984403261 4:179294557-179294579 CTTTAAACAAATAAGGCAGATGG + Intergenic
985863061 5:2489442-2489464 CTATGAACAATCAGGGGACATGG + Intergenic
986504371 5:8433415-8433437 CATAGAACAAGCAAGGGAGGAGG + Intergenic
987347891 5:16994832-16994854 GTTTGAGCAGGAAAGGGAGAGGG + Intergenic
988357765 5:30199863-30199885 CTTTAAATCAGAAAGGGAGAAGG - Intergenic
988569199 5:32347432-32347454 CTTAGAAGAAACAAGAGAGATGG + Intergenic
988958151 5:36340280-36340302 CTTTAAACAAGAAAGGAAAAAGG - Intergenic
990058624 5:51618492-51618514 CTTTGATCAAGCCAGGCGGAAGG - Intergenic
990920442 5:60959925-60959947 ATTTGTATAAGTAAGGGAGAAGG - Intronic
992982887 5:82195013-82195035 CTGTGAATAAGCAAGGAAGATGG - Intronic
995542173 5:113196191-113196213 GTTGGCACAAGCAAGGGAGATGG - Intronic
995702485 5:114951914-114951936 CTAGGAACAAGAAAGAGAGATGG + Intergenic
996340400 5:122431941-122431963 TTTTAAAAAAGAAAGGGAGATGG - Intronic
996421092 5:123263618-123263640 TTTTGAATAAGCCAGGGAAAGGG - Intergenic
996921266 5:128770136-128770158 CTTTGCCCAGGAAAGGGAGAGGG + Intronic
997595581 5:135105115-135105137 CTTGGAACAGGAAAGGGACAAGG + Intronic
999774399 5:154800438-154800460 CTCAGAAGAAGGAAGGGAGAGGG + Intronic
999774987 5:154804913-154804935 CTTTGAACAACGAAGGGCGTGGG + Intronic
999811643 5:155132914-155132936 TTTTGAACAATCAAGGAAGCTGG - Intergenic
999825466 5:155269472-155269494 TTTGGAACAACCAAGGCAGAAGG - Intergenic
999948123 5:156619342-156619364 CATTTAACAAGGGAGGGAGATGG + Intronic
1001118890 5:168962589-168962611 CTTTGGCCAACCAGGGGAGATGG - Intronic
1001491768 5:172161025-172161047 CTTTGAGCTGGCCAGGGAGAGGG - Intronic
1001546644 5:172574529-172574551 AAGTGAACAAGCAAGGGAAAGGG - Intergenic
1003412859 6:5880854-5880876 CTTTCTTCTAGCAAGGGAGAGGG + Intergenic
1003940126 6:11016167-11016189 ATTTTAAAAAGGAAGGGAGAAGG - Intronic
1004006757 6:11643934-11643956 CTCTGAACAAGTAATGAAGATGG - Intergenic
1004131845 6:12928234-12928256 CTTCAAACAACCATGGGAGAAGG + Intronic
1004746460 6:18513744-18513766 ATTAAAACAATCAAGGGAGAAGG - Intergenic
1006694879 6:35922456-35922478 CTCTGAACAAGTAATTGAGAAGG + Intergenic
1008021000 6:46577012-46577034 CTTAGAGCCAGCAATGGAGAAGG + Intronic
1008365255 6:50671573-50671595 ATTTTAAAAAGCAAGGCAGATGG + Intergenic
1010666094 6:78631075-78631097 CTTGGTACAAGTAAGGCAGAGGG + Intergenic
1012692829 6:102336399-102336421 CTTTGAAGATGGAAGGAAGAGGG - Intergenic
1013774455 6:113664145-113664167 CTGGGAAGCAGCAAGGGAGAAGG - Intergenic
1013861968 6:114646672-114646694 CTTTAAAGAAGAAAGAGAGAGGG - Intergenic
1014020533 6:116583218-116583240 CTTTGGACAGCCAAGGTAGAAGG - Intronic
1014983716 6:127977055-127977077 CTGTGAAGAAACAAGGTAGATGG + Intronic
1016714838 6:147212941-147212963 CATTTAACAACCAAGGAAGAAGG - Intronic
1021351566 7:19600578-19600600 CTTTAAACCAACAAAGGAGAAGG - Intergenic
1021457504 7:20845556-20845578 CTTTGAAGAAGAAAGGGAGCAGG - Intergenic
1021491202 7:21221278-21221300 CTTCGAGGAAGCAAGGAAGAAGG - Intergenic
1022958624 7:35403863-35403885 CTCTCAACAGGCAAGTGAGACGG - Intergenic
1023258459 7:38335316-38335338 CTTCCAACTTGCAAGGGAGAAGG - Intergenic
1024702606 7:51920802-51920824 CTTTGAAGACCCCAGGGAGATGG - Intergenic
1026432057 7:70357337-70357359 CTTTCAACAAATAAGGGAGGTGG - Intronic
1028242512 7:88438395-88438417 ATTTGAAGAAGCAAGGGGGCCGG - Intergenic
1028333310 7:89622931-89622953 CTCTGAACAAGCTGGGGATAGGG - Intergenic
1028378939 7:90176685-90176707 GTATCAACAAGCACGGGAGAGGG - Intronic
1028874206 7:95802242-95802264 CTTTGAGAAAGCAAAGGGGATGG - Intronic
1029077427 7:97946617-97946639 CTTTGAACAACCAATGGTGTTGG + Intergenic
1029533487 7:101141274-101141296 CTTAGAACAGGCAAGGGACAGGG - Intergenic
1029893657 7:103958632-103958654 ATTTGAACAAGGGAAGGAGAGGG + Intronic
1030787467 7:113680064-113680086 CTTTGAACAAGGCAGGGATTAGG + Intergenic
1032253959 7:130282410-130282432 ATCTGAACAAGCACAGGAGAGGG - Intronic
1032267904 7:130381388-130381410 CTTTGAGACAGCAAGGCAGAGGG - Intronic
1032487427 7:132298297-132298319 CTGTCAACAGCCAAGGGAGAGGG + Intronic
1032681421 7:134188316-134188338 GCTTGAACTATCAAGGGAGATGG + Intronic
1032860063 7:135868242-135868264 CTCTAAAAAAGGAAGGGAGAGGG + Intergenic
1034027757 7:147725602-147725624 ATTTGAACAAGGGAGGAAGAAGG + Intronic
1034590738 7:152136987-152137009 GTTTTAAAATGCAAGGGAGATGG - Intronic
1036756089 8:11471948-11471970 CCTTGAACAAAGAAGGGAGGTGG - Intronic
1036832588 8:12033251-12033273 CTTTGAACAACCAATGGTGTTGG + Intergenic
1037087878 8:14875463-14875485 CTTTGGATAAGGAAGGGACAAGG + Intronic
1037530315 8:19766455-19766477 GTTTGAACTAACCAGGGAGAAGG - Intergenic
1038256836 8:25957996-25958018 CCTTGCACAGCCAAGGGAGAGGG + Intronic
1042875102 8:73434467-73434489 ACCTGAACAAGGAAGGGAGAGGG + Intronic
1044136374 8:88591324-88591346 GTTTGAACAAGAAAGAGAGAGGG + Intergenic
1044757601 8:95481195-95481217 CTCTAAAAAAGCAAGGGAGGAGG + Intergenic
1044993186 8:97814586-97814608 CTTAGAGCAAGCAAGAGAGTGGG + Intronic
1045705916 8:104922148-104922170 CTCTAAACAAACAAGGAAGAAGG + Intronic
1047080177 8:121451727-121451749 CCTTGAACATTCAAGGAAGAAGG - Intergenic
1048664869 8:136649724-136649746 CTGTGCTCAACCAAGGGAGATGG + Intergenic
1048695594 8:137024490-137024512 CTTTGAGAAAGCAAAGGATAGGG - Intergenic
1050734609 9:8748666-8748688 TTTTGAACAGCCAAGGCAGACGG + Intronic
1051352485 9:16211459-16211481 CTTTGAACATGCAGGTGAAATGG - Intronic
1052535623 9:29742930-29742952 CACTGGACAGGCAAGGGAGAAGG - Intergenic
1053576979 9:39363637-39363659 ATTTGAACATACAAGGGAGCTGG + Intergenic
1053841486 9:42191562-42191584 ATTTGAACATACAAGGGAGCTGG + Intergenic
1054098549 9:60922327-60922349 ATTTGAACATACAAGGGAGCTGG + Intergenic
1054119949 9:61197956-61197978 ATTTGAACATACAAGGGAGCTGG + Intergenic
1054587807 9:66984606-66984628 ATTTGAACATACAAGGGAGCTGG - Intergenic
1054983346 9:71232821-71232843 GTGTGAACCAGTAAGGGAGAAGG - Intronic
1055193629 9:73559436-73559458 CTCTGAATAAGCTAGGAAGAAGG - Intergenic
1055803472 9:80066972-80066994 CTTTGAACATGCAATGAATATGG - Intergenic
1056103614 9:83325014-83325036 TTTTAAAAAAGCAAGGCAGATGG + Intronic
1057038665 9:91831877-91831899 CTTTTTACAGGGAAGGGAGATGG - Intronic
1058956005 9:109949329-109949351 GCTTGAAAAAGCAAGAGAGATGG + Intronic
1060103159 9:120857456-120857478 CTTTGAGAGAGCATGGGAGAAGG - Exonic
1060899388 9:127244325-127244347 CATTGATCAGGCAAGAGAGAGGG + Intronic
1062330296 9:136039451-136039473 CTTCGAAAAAACAAAGGAGAAGG + Intronic
1203654684 Un_KI270752v1:11783-11805 CTCAGAACAAGGAAGGGTGAAGG - Intergenic
1185569604 X:1123495-1123517 CTATAAACAAGCAAGTGAGGAGG + Intergenic
1186397124 X:9221094-9221116 CTTTGGTCAAACAATGGAGAAGG + Intergenic
1187302329 X:18062806-18062828 CTTTGAAGGATAAAGGGAGATGG - Intergenic
1187460580 X:19483383-19483405 CTTTTACCCAGAAAGGGAGATGG - Intronic
1188824205 X:34810171-34810193 CTATGAAAAATCAAGGAAGAAGG - Intergenic
1189197662 X:39165780-39165802 TTTTGAAAAAGCAAGGAAGAAGG - Intergenic
1191192393 X:57680374-57680396 TCTTGAAGAAGCAAGGTAGATGG - Intergenic
1195981753 X:110585993-110586015 CTTTGAAGAATCAAAGAAGATGG - Intergenic
1196164857 X:112527538-112527560 CTTAGAAGAAATAAGGGAGAAGG + Intergenic
1196434786 X:115665023-115665045 CTTTGAGGAAGCCAGGAAGAAGG + Intergenic
1196802474 X:119556189-119556211 CTTTGGCCAAGCAAAAGAGATGG - Intronic
1196944603 X:120811499-120811521 CTTTAAACAAGCCATTGAGAAGG - Intergenic
1197559827 X:128005801-128005823 CTTTGAACATTCAATGGAGAAGG - Intergenic
1198095133 X:133372490-133372512 CTTTCAACTATCAAGGCAGATGG - Intronic
1198971429 X:142285269-142285291 CTATCAACAAGCCAGGAAGAGGG - Intergenic
1199281436 X:146004576-146004598 CAGTGAACATGCAAAGGAGAAGG + Intergenic
1199294367 X:146140605-146140627 GGTTGAACAAGCAAAGGAAAAGG - Intergenic
1200152559 X:153958400-153958422 CCTTTAACAGGCAAGGGAGGAGG + Intronic
1200753747 Y:6970610-6970632 TTTTTAAGAAGCAAGGGACATGG + Intronic
1201704529 Y:16921616-16921638 CTTTGAACATGAATGGGGGATGG - Intergenic