ID: 1127659641

View in Genome Browser
Species Human (GRCh38)
Location 15:61088394-61088416
Sequence AAGCCACAGCTGCAAGAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 256}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127659639_1127659641 24 Left 1127659639 15:61088347-61088369 CCTCTAAGTGTGTGTGCATGTGT 0: 1
1: 1
2: 26
3: 262
4: 2145
Right 1127659641 15:61088394-61088416 AAGCCACAGCTGCAAGAAACGGG 0: 1
1: 0
2: 1
3: 29
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127659641 Original CRISPR AAGCCACAGCTGCAAGAAAC GGG Intronic
900176002 1:1291643-1291665 CTGCCACAGCTGCAAGGACCAGG - Exonic
900635363 1:3662197-3662219 ATGCCACAGCTGCAGGATCCTGG - Intronic
900860815 1:5228568-5228590 AAGCCAAACCTTCAAGAAAGGGG - Intergenic
901231525 1:7644228-7644250 AGGGCACAGCTGCAAGGACCAGG - Intronic
903324449 1:22562112-22562134 AAGACACAGAGGAAAGAAACGGG + Intergenic
904585393 1:31577054-31577076 AACTCACAGCTCCAGGAAACTGG + Intronic
904804366 1:33120382-33120404 CAGACACAGCTGGAAGGAACAGG - Exonic
905545917 1:38800818-38800840 AAGCCACAGCTGCAGAACCCAGG + Intergenic
906002768 1:42441351-42441373 GAGTCACAGCTGCAGGGAACTGG + Intronic
906479537 1:46191085-46191107 GAGCCACAGATGTCAGAAACAGG + Intronic
907281613 1:53350697-53350719 CAGCCTCAGCTGTAAGAAAGAGG + Intergenic
907585980 1:55618336-55618358 AAGCCAAAGGCGCAAGAACCAGG - Intergenic
908069729 1:60445314-60445336 AAGGCAGAACAGCAAGAAACAGG + Intergenic
909029661 1:70524301-70524323 AAGCCAGAACTGTAAGAAAGTGG - Intergenic
909185783 1:72483896-72483918 AATCCACATCTGCAAATAACTGG + Intergenic
910091463 1:83469476-83469498 TAGCTACAGCTGCATGAAAATGG + Intergenic
911508233 1:98780548-98780570 AACACACACCAGCAAGAAACTGG - Intergenic
914461862 1:147892187-147892209 AAGGCATAGAGGCAAGAAACAGG + Intergenic
915978365 1:160405328-160405350 AAGCCACATCACCAAGAGACAGG - Intronic
916651501 1:166838950-166838972 AAGCAACAGCTACAAAAATCAGG + Intergenic
917461657 1:175235342-175235364 AAGCCACAACTGCAGGAAAAGGG + Intergenic
917741354 1:177964577-177964599 ATTCCACAGCTGCAAGCACCAGG + Intronic
918218485 1:182414466-182414488 AAAACACAGATGGAAGAAACAGG - Intergenic
918447544 1:184630213-184630235 AAGCCTCTGCTGGAAGAAACAGG - Intergenic
918805135 1:189031051-189031073 AAACCCCAGTTGCAAGAAGCTGG + Intergenic
920080354 1:203368556-203368578 AAGAAACAGCTTCCAGAAACGGG + Intergenic
921326169 1:213987919-213987941 AAGACACAGCTGAAGGAAACAGG - Intronic
923685062 1:236147982-236148004 GAGCCACAGCTGGAAACAACAGG - Intronic
924432792 1:244010849-244010871 AAGCCAAAACTGAAAGAAAAAGG + Intergenic
1063202363 10:3795931-3795953 AAGCCAGAACTGCAAGAAGAAGG - Intergenic
1064540072 10:16396318-16396340 ATGTCACAGCTGGAAGAAAGCGG - Intergenic
1067451609 10:46385204-46385226 AAGCCAGAGCTGCTAGAGAAAGG + Intronic
1067585630 10:47474552-47474574 AAGCCAGAGCTGCTAGAGAAAGG - Intronic
1069248396 10:66237890-66237912 AAACCACAGATGCAAGAATTTGG - Intronic
1069815840 10:71193807-71193829 AAGCCACAGAAGGAAGACACAGG + Intergenic
1070236129 10:74628362-74628384 AAGCCAAAGCTGCACTAAATAGG + Intronic
1074699674 10:116082228-116082250 AAGTCACAGCTCCAAGAGGCAGG + Intronic
1074758115 10:116642661-116642683 TAGGCACAGATTCAAGAAACGGG + Intronic
1075287377 10:121198788-121198810 AACCCACAGCTGCAAGGGCCTGG - Intergenic
1075905838 10:126081314-126081336 AAGCCAAAGTTGCAGGGAACCGG + Intronic
1076024416 10:127100377-127100399 AAGCCCCAGCTGCATGCCACAGG - Intronic
1076841929 10:133050062-133050084 GAGCCCCAGCTCCAGGAAACCGG + Intergenic
1078299964 11:10118970-10118992 AAGTCACATCTGCAGGAAAAAGG + Intronic
1079625312 11:22610087-22610109 AAGACACAGTTGCAATAATCTGG + Intergenic
1080218511 11:29873418-29873440 AAGCCACTGCTCAAAGAAATTGG - Intergenic
1080548422 11:33346033-33346055 AAGTAACTGCTGCAATAAACTGG + Intronic
1082169865 11:48990825-48990847 CACCAACAGATGCAAGAAACTGG - Intergenic
1082742140 11:56922779-56922801 ACACCCCAGCTGCAAGAAATGGG - Intergenic
1083705341 11:64510349-64510371 AACATACAGCTGCATGAAACAGG - Intergenic
1086471215 11:87113365-87113387 AAGCCAGAGCTGAAAGATTCAGG - Intronic
1086567131 11:88240085-88240107 AACACACAGCTGCAAGGAACAGG - Intergenic
1087202486 11:95359895-95359917 AATACACGACTGCAAGAAACAGG - Intergenic
1088094877 11:106087023-106087045 AACACACAGAGGCAAGAAACAGG - Intronic
1088125243 11:106416388-106416410 AAGCAACACATGCAAGAAACTGG - Intergenic
1088998900 11:115032255-115032277 AATCCTCATCTGCAAGACACTGG - Intergenic
1089031475 11:115334034-115334056 GAGATGCAGCTGCAAGAAACAGG - Intronic
1089703275 11:120258712-120258734 AGGCCACTGCTGCAAGGAACGGG - Intronic
1091562146 12:1622994-1623016 AAGGCACAGCGGGGAGAAACAGG + Intronic
1091883089 12:3995433-3995455 AGGCGAGAGCTGGAAGAAACAGG + Intergenic
1092780136 12:11978625-11978647 AAGCCAGAGCTGCAAGACTCCGG - Intergenic
1094120410 12:26968015-26968037 CAGTCACAGCTGCATGAATCCGG - Intergenic
1097934323 12:65228138-65228160 GACCCACAGCTACAAGAAAATGG - Intronic
1098444154 12:70549021-70549043 AAGCCACATCTGCAAAATAGAGG - Intronic
1098509563 12:71295740-71295762 AAGCCACAGCATCTAGAAAATGG + Intronic
1100648991 12:96564006-96564028 CAGCCACAGCTGGAAGATAGTGG + Intronic
1103146370 12:118598472-118598494 CAGACACAGCTCCAAGAGACAGG - Intergenic
1104052605 12:125206195-125206217 AAGCCACAGCACCAGGAAAGGGG - Intronic
1104181315 12:126384241-126384263 AGGCCACACCTGCAAGGAACTGG + Intergenic
1105422422 13:20264812-20264834 GAGCCACAGCCCCAAGACACAGG + Intergenic
1107378566 13:39831378-39831400 AGGCCACAGCTCTAAGAAAATGG - Intergenic
1108506065 13:51113509-51113531 CAGCCTCAGCTATAAGAAACGGG + Intergenic
1110682880 13:78337157-78337179 AAGACACTGCTGAAAGAAAATGG - Intergenic
1113031139 13:105994803-105994825 AATCCACAGCTCCAGGAACCAGG + Intergenic
1113137986 13:107114976-107114998 AAGCCACAGTTGCAAGATTTAGG - Intergenic
1114394078 14:22341003-22341025 AAGCAACAGCTGCCAGAAATTGG - Intergenic
1114681185 14:24484677-24484699 AATCCACAGCTCCAGTAAACTGG - Intergenic
1117472396 14:56059197-56059219 GAGCTCCAGCTGCAAGAAGCTGG + Intergenic
1117622687 14:57603664-57603686 GAGCCACAGCTGTAACAATCTGG - Intronic
1117746689 14:58876793-58876815 CTCCCATAGCTGCAAGAAACTGG - Intergenic
1120556495 14:85934339-85934361 AAGTCACAGCTGCAAGCTAAGGG + Intergenic
1121737245 14:96227011-96227033 AAGCCACTCCAGCAAGAGACAGG + Intronic
1122045338 14:99018929-99018951 AAGACACAGTGGTAAGAAACAGG - Intergenic
1125000821 15:34768441-34768463 GAGCCAGAACTTCAAGAAACAGG - Intergenic
1125545082 15:40497546-40497568 AGGCCACAGCAGTAAGAAAAGGG - Intergenic
1125644320 15:41259072-41259094 AAACCACACCTGAAACAAACAGG - Intronic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1126675150 15:51154508-51154530 GAACTACAACTGCAAGAAACAGG + Intergenic
1127659641 15:61088394-61088416 AAGCCACAGCTGCAAGAAACGGG + Intronic
1127659750 15:61089364-61089386 AAGCTACATCTGTGAGAAACAGG - Intronic
1127932906 15:63609216-63609238 CAGCCTCAGCTGGAAGAAGCAGG + Exonic
1128445501 15:67756071-67756093 AAGCCACAGCTCTAGGAAAAGGG - Intronic
1131640497 15:94287676-94287698 AAGCTACAGCTTCGACAAACAGG + Intronic
1131673279 15:94645134-94645156 AAGCAACAGCCACCAGAAACTGG + Intergenic
1134359729 16:13520070-13520092 GAGCCATATCTGCAAGAACCAGG + Intergenic
1135393439 16:22112827-22112849 AAGCCAGAGCTGCCAGAAGTGGG - Intronic
1135746249 16:25019091-25019113 AAAACCCAGCTGCATGAAACAGG + Intergenic
1136061765 16:27731405-27731427 TTGCCACATATGCAAGAAACAGG - Intronic
1137633465 16:49965168-49965190 AGGACACAGCTGGAAGAAAAGGG - Intergenic
1137669346 16:50270451-50270473 ATTTCACAGGTGCAAGAAACAGG - Intronic
1137764152 16:50964673-50964695 GAGCCACAGCTTCCAGGAACAGG - Intergenic
1138103341 16:54272255-54272277 AAGCCACAGCCCCAGGAAATGGG - Intergenic
1138153060 16:54677209-54677231 AAGACATAGCTCCAGGAAACAGG + Intergenic
1139202074 16:64988084-64988106 AAGGCAACACTGCAAGAAACAGG - Intronic
1140100854 16:71915300-71915322 AAGGCACAGCTGAAAGAATTTGG - Intronic
1140953928 16:79845107-79845129 GAGCTGCAGCTGCAAGAAAGAGG - Intergenic
1141940527 16:87273147-87273169 AAGCCACAGAGGCAGGAAGCAGG - Intronic
1143308913 17:5972144-5972166 AGGCCAGAGCTGGAAGAGACAGG - Intronic
1143551710 17:7634414-7634436 CAGCCACAGAGGCAGGAAACTGG - Intergenic
1143579904 17:7819337-7819359 AAGCCACCGCAGCAATAAGCTGG + Exonic
1145001979 17:19311976-19311998 AAGCCACACTGGCCAGAAACAGG - Intronic
1146267037 17:31459680-31459702 ATGACAGTGCTGCAAGAAACAGG - Intronic
1147608127 17:41785753-41785775 CAGCCACAGCTACTGGAAACTGG + Intronic
1148813883 17:50312926-50312948 ATGCCACAGCTGCAGGAGTCAGG + Intergenic
1150606098 17:66692308-66692330 AAAACACAACTGCAAGAGACTGG + Intronic
1151325999 17:73380084-73380106 GGGACGCAGCTGCAAGAAACGGG + Intronic
1153798268 18:8645220-8645242 ATGCCACAGCTGAATTAAACTGG + Intergenic
1155957228 18:31964137-31964159 AAGCCACTGCTGCAAGGAGGTGG - Intergenic
1159612824 18:70545784-70545806 AAGCCACATCTCCAAGAAAAGGG - Intergenic
1160278372 18:77461557-77461579 AAGTCTCAGCTTCAAGAAACAGG - Intergenic
1160281415 18:77494222-77494244 AAACCACAGAGGCAAGAAATTGG + Intergenic
1160427955 18:78791186-78791208 AAACCACAGCTGCAAGGACTTGG - Intergenic
1165793934 19:38507601-38507623 AAGCCAAAGCTGATAGAGACGGG + Intronic
1166253055 19:41584698-41584720 AAGCCACAGCTGCCTGGAGCAGG + Intronic
1166788728 19:45385152-45385174 AGGCTACAGCTGCCAGAAAGGGG - Intronic
1167496824 19:49824334-49824356 AAGCCCCAGCTGGAAGCAAATGG - Intronic
1167761829 19:51454595-51454617 AAGCCAGAGCTGGAAGGACCTGG - Intronic
926593813 2:14768075-14768097 AAGCCACAGGTGCTAGGATCTGG - Intergenic
926747095 2:16167839-16167861 AAGCCACAGCACCACGAAGCTGG + Intergenic
927571963 2:24167729-24167751 AAATCACAGTGGCAAGAAACAGG - Intronic
927865418 2:26584657-26584679 AAGCCACAGCTGTCAGATAAAGG + Intronic
931302711 2:60996616-60996638 AAGCAACAGCAGCATGAAGCAGG + Intronic
932966836 2:76485780-76485802 AATCCACACCTGCCAAAAACAGG - Intergenic
933249379 2:80011886-80011908 ATGGCACACCTGCAAAAAACAGG - Intronic
933367029 2:81365931-81365953 AAGACACATATGTAAGAAACAGG - Intergenic
934307668 2:91840362-91840384 AAGCCGCAGCAGCAAAAATCCGG - Intergenic
935409850 2:102750398-102750420 AAGCAACATCGGCAAAAAACAGG - Intronic
938038005 2:128052736-128052758 AAGCCACATCTGTAGGAAAAGGG - Intergenic
939894926 2:147779933-147779955 GAGAGACAGCTGCAAGAGACAGG - Intergenic
941740282 2:169028500-169028522 AAGGCCCAGATGCAAGAGACAGG + Intronic
943203028 2:184854311-184854333 ATTTCACAGCTGCAAGAAGCTGG - Intronic
943427545 2:187754440-187754462 AAACCACTGATGCAAGAAATTGG - Intergenic
945582356 2:211611174-211611196 GAGCCACAGCTGCAAGCTAAGGG + Intronic
945631167 2:212278526-212278548 AGGCCACACCAGCAAGAAAATGG + Intronic
946007812 2:216540577-216540599 AAGGCACAGAAGCATGAAACAGG - Intronic
946905010 2:224407345-224407367 GAGCCACAGCAGCATGAAAAAGG - Intergenic
947848873 2:233268033-233268055 AAACCACAGCTGCCTGAAGCAGG - Intronic
948846976 2:240687847-240687869 AAGCCCCAGCTGGCAGAAAGGGG - Intergenic
1169238897 20:3957641-3957663 GAGCCACAGATGGAAGAAAAAGG - Intronic
1170678933 20:18507933-18507955 CACCCACAGCTGCAACAAGCAGG - Exonic
1173416995 20:42865742-42865764 AAGCAACAGCTCCAACAAAGAGG + Intronic
1174270604 20:49365597-49365619 AGGCCACAGCTGCAGGAGAGTGG + Exonic
1174485131 20:50856191-50856213 AATCCACAGCTGCAGGCAGCAGG - Intronic
1174979355 20:55375719-55375741 AAGCCAAAACTGCAAGATCCTGG + Intergenic
1174998374 20:55598600-55598622 AAGGCAAAGCTGCCAGAAATTGG + Intergenic
1175692493 20:61075634-61075656 CAGCCACAGCTGGAAGGAAGTGG + Intergenic
1176055781 20:63147824-63147846 AATGCACAGGTGTAAGAAACAGG - Intergenic
1179777759 21:43677927-43677949 AATCCACAGCTGCAAAAACATGG - Intronic
1180040335 21:45275488-45275510 AATCCACAGCTGCAAAAACATGG + Intronic
1181058781 22:20272213-20272235 AAGCCACAGCAGCAGCAAAGGGG + Intronic
1183720266 22:39558118-39558140 AAGCCAACGCGCCAAGAAACTGG - Intergenic
1183945064 22:41320792-41320814 AAGGCTCAGCAGCAAGAAAAGGG - Intronic
949525049 3:4895119-4895141 ATCCCACAGCTGCAAGGAACTGG + Intergenic
951445946 3:22780999-22781021 AAGCCAGAGAGGCCAGAAACTGG + Intergenic
953168555 3:40486943-40486965 AAGTCACAGCTACATGATACAGG + Exonic
956003541 3:64754241-64754263 ATCCCACAGCTGCAAGGAACCGG - Intergenic
956323947 3:68029878-68029900 AAGCCTCAGCTGTCAGAAATTGG + Intronic
956760749 3:72441980-72442002 AAGCTACAACTGCAAAAAACTGG + Intronic
959109500 3:102105201-102105223 AAGCGACAGCTCACAGAAACTGG - Intronic
959463638 3:106657746-106657768 AAGCCACAGAAGAATGAAACTGG + Intergenic
960351659 3:116601142-116601164 ATGACACAGCTGCAACACACAGG + Intronic
960949287 3:122988651-122988673 AAGTCACAGCTGGAAGCAGCAGG - Intronic
961500212 3:127327013-127327035 AAGTCAGATCTGAAAGAAACTGG + Intergenic
961792888 3:129389286-129389308 AAAACACATCTGCCAGAAACAGG - Intergenic
961798921 3:129429683-129429705 CAACCTCACCTGCAAGAAACAGG + Intergenic
961806808 3:129495478-129495500 AAAACACATCTGCCAGAAACAGG - Exonic
962047684 3:131777876-131777898 AACCAACAGCTGCAATAAAGGGG - Intronic
962583617 3:136819525-136819547 ACGCGACAGCGGAAAGAAACGGG - Exonic
963837861 3:150075072-150075094 AATTTACAGCTGGAAGAAACAGG - Intergenic
963899881 3:150724145-150724167 CAGCCACACCTGCACAAAACTGG - Intergenic
965871889 3:173274853-173274875 AGGCCACAGCGGCAAGACAAAGG + Intergenic
966839963 3:184080476-184080498 AAGCCATGTCTGCAAGGAACAGG + Intergenic
967936639 3:194733306-194733328 GAGCCACCGCTGAAAGAGACGGG + Intergenic
968912817 4:3484595-3484617 AAGCCCCAGCTGCGAGTCACGGG - Intronic
968950935 4:3691055-3691077 AAGCCCTACCTGCAGGAAACTGG - Intergenic
969539888 4:7781584-7781606 AAGCCTCTGCTGCAGGAAGCAGG + Exonic
970793475 4:19887625-19887647 AGGCCACAGCAGCCAGAAAAAGG + Intergenic
972382740 4:38534618-38534640 AAGCCACAGCCACGAGAAAAAGG - Intergenic
973334608 4:48943253-48943275 AGGCTACAGCTGCAAGGAACTGG + Intergenic
974425187 4:61733442-61733464 AATCCACAGCTGCAATGTACTGG - Exonic
974550086 4:63361116-63361138 CAGCCACAACAGAAAGAAACAGG - Intergenic
977591862 4:98835964-98835986 AAGCCAGAGATGCAAGTAAATGG - Intergenic
978249919 4:106618228-106618250 AAGCCACTGCTGCACTAACCTGG - Intergenic
978465205 4:109001353-109001375 AAACCACAGTTAAAAGAAACAGG + Intronic
978585569 4:110272615-110272637 CAGCCACAGGTGTAAGCAACCGG - Intergenic
979597705 4:122553049-122553071 AAGCCACATATGCTAGATACTGG - Intergenic
981120172 4:141040583-141040605 AAGGCACTTCTGCAAGAAAAAGG + Intronic
981824921 4:148929035-148929057 AAGCCACATCTGTAGGAAAAGGG + Intergenic
982763688 4:159319012-159319034 AAGCCACGGATGGGAGAAACAGG - Intronic
984316671 4:178138891-178138913 AAGGCACAGCTGCATGTAAAAGG - Intergenic
985227726 4:187780762-187780784 AAACCACAGATGCAAGTATCAGG + Intergenic
986009453 5:3699055-3699077 AAGCCATAGCTGTATGAAGCAGG + Intergenic
987212382 5:15695887-15695909 AAGCAACTGCAGCTAGAAACAGG - Intronic
987472482 5:18350484-18350506 AGGCCACAGCTCCAAGACACAGG - Intergenic
988902407 5:35747141-35747163 AAGCCACCACTACAAGAAAAAGG + Intronic
989948364 5:50267100-50267122 AAGACACAGCCTCAAGATACAGG + Intergenic
992021613 5:72630349-72630371 AAGCCACTGCATCAAGAAACAGG - Intergenic
992480812 5:77150925-77150947 AACACACAGCAGCAAGACACAGG - Intergenic
993792853 5:92228634-92228656 AAGCCATAGCTGCATGAAGCTGG - Intergenic
994568297 5:101482480-101482502 AAGCCACATCTACAGGAAAAGGG - Intergenic
995076426 5:107990180-107990202 ATGCCCCAGCTGAAAGAAAAAGG - Intronic
996341285 5:122441591-122441613 AATGCAGAGCTGCATGAAACTGG + Intronic
997099300 5:130950761-130950783 TAACCAAAGCAGCAAGAAACTGG - Intergenic
997395110 5:133553431-133553453 AAGCTACAGTAGCAAGACACAGG + Intronic
999049977 5:148512136-148512158 AAGATACAGCTGCAAGAATTGGG - Intronic
1001244117 5:170092965-170092987 AAGCAAGAGCTCCAAGAAAGGGG + Intergenic
1002841995 6:914145-914167 GAGCCAGAGGTGCAAGCAACAGG + Intergenic
1003270895 6:4606957-4606979 AAGCCCTCGCTGCCAGAAACAGG + Intergenic
1004807035 6:19213933-19213955 AAGCCACTGCAGCCATAAACTGG - Intergenic
1007777923 6:44234153-44234175 AAGCCACGGCTGGAGGACACAGG - Intergenic
1007827163 6:44609149-44609171 AAGGCACAGCAGCAAGAGAGAGG + Intergenic
1007933562 6:45713792-45713814 TAGACAAAGGTGCAAGAAACAGG - Intergenic
1007990457 6:46249792-46249814 AAGGTACAGCTGTCAGAAACAGG + Intronic
1008444151 6:51569098-51569120 AAGCCACAGATGCAAGTAGCAGG + Intergenic
1011444564 6:87423637-87423659 ATGCAACAGCAACAAGAAACAGG - Intronic
1014149151 6:118033722-118033744 CAGCCACAGCAGCAAGAAGAGGG + Intronic
1015175403 6:130301791-130301813 AAGCCACACCTACAACCAACTGG + Intronic
1015699433 6:136019464-136019486 AAGCCACAGATACACAAAACAGG + Intronic
1015997632 6:139010787-139010809 AAGCCACTGCAGCCAGCAACTGG + Intergenic
1016534600 6:145096456-145096478 AAGCAACAGACACAAGAAACAGG - Intergenic
1017215342 6:151900656-151900678 AAGCCACATCTCTAAGAAAAGGG - Intronic
1019120206 6:169796437-169796459 ACTCCACAGCTGTAAGAAAATGG - Intergenic
1019433139 7:1008603-1008625 CAGCCTCAGCTCCGAGAAACAGG + Intronic
1020506451 7:8995018-8995040 AAGCCAGAGCTGTAAGTAACTGG - Intergenic
1022346239 7:29517176-29517198 TAGCCACAGCTCCAAAAGACAGG - Intergenic
1023418290 7:39951346-39951368 CAGCCACAGCGGCGAGGAACGGG + Exonic
1023719262 7:43076446-43076468 AAGTCACAGCTGCAAGCTAAGGG + Intergenic
1024637089 7:51300049-51300071 AAGGCACAGCGGCAATAGACTGG - Intronic
1026538377 7:71259315-71259337 AAGGCACACGTGCATGAAACAGG - Intronic
1029183170 7:98719496-98719518 AATCCACACCTTCAAGAATCAGG - Intergenic
1029549825 7:101231869-101231891 AAGTCCCGGCTGCAGGAAACTGG - Intergenic
1030041241 7:105452356-105452378 AAGCAGCAGCTGCAAAAAGCAGG - Intronic
1030440205 7:109579801-109579823 AATTGACAGCTCCAAGAAACTGG - Intergenic
1031634645 7:124086950-124086972 AAGTCCCAGCTGCTAGAAATTGG + Intergenic
1033380870 7:140817277-140817299 AAAACACTGATGCAAGAAACTGG + Intronic
1034753982 7:153597136-153597158 AAGGGAAGGCTGCAAGAAACAGG - Intergenic
1036582675 8:10090021-10090043 AAACCACAGCAGCATGAAAGGGG + Intronic
1042401955 8:68360070-68360092 AAGCCACAGCTGAAACAAAGAGG - Intronic
1043100726 8:76041645-76041667 AATCAACAGCTGCAAGTTACTGG + Intergenic
1044559821 8:93601951-93601973 AGGCCACAGCTTCAAGACACAGG + Intergenic
1044925820 8:97208051-97208073 AAGCCACAGATGAAATAAACAGG + Intergenic
1046676241 8:117111766-117111788 AAGCCACAGCTGAGAGATAGTGG + Intronic
1047499806 8:125431965-125431987 GAGACACAGCTCCTAGAAACAGG + Intronic
1047963151 8:130025505-130025527 ATGGCAAAGTTGCAAGAAACAGG - Intergenic
1048142455 8:131807697-131807719 AAGCCACAGCTGCAAGAGTGAGG + Intergenic
1048566942 8:135610762-135610784 AAGTCACAGAGGCATGAAACAGG + Intronic
1048716970 8:137281768-137281790 AGGCCACAGCTGCCAGACAAAGG + Intergenic
1051696237 9:19770977-19770999 GATCCACATTTGCAAGAAACTGG + Intronic
1051696479 9:19773393-19773415 GGGCCACAGCTGGAATAAACTGG + Intronic
1052929788 9:34047020-34047042 AAACCAGAGCAGCAGGAAACAGG + Intronic
1053202686 9:36163493-36163515 CAGCCACAGCTGCCAGGAACAGG - Exonic
1054731108 9:68704028-68704050 CAGCCACATCTGCAAGAAGCAGG + Intergenic
1056063762 9:82911764-82911786 AAGCCACAGGTGTCAAAAACTGG + Intergenic
1058770750 9:108228777-108228799 AAGCCACATCTACAGGAAAATGG + Intergenic
1060060595 9:120455942-120455964 AACCCACAGCTGCAAGAAAAGGG + Intronic
1061662895 9:132141997-132142019 ATGCCACAGGGGCAAGAAACAGG - Intergenic
1061704714 9:132444139-132444161 AAGCCACCTCTGTAGGAAACGGG - Intronic
1061944735 9:133902288-133902310 AAGCCTCTGCTGCAGGACACAGG + Intronic
1062398483 9:136362262-136362284 AGGCCAGAGCTGCAAGCACCAGG + Intronic
1062463132 9:136670155-136670177 CATCCACATCTGCAGGAAACGGG - Exonic
1062705145 9:137934751-137934773 AAGCCACAGCTCTAGGAAAATGG + Intronic
1185554169 X:1007399-1007421 CAGCCACATCTTAAAGAAACAGG + Intergenic
1186451752 X:9679835-9679857 AGGCCACAGTTGCCAGAACCAGG - Intronic
1189557295 X:42158410-42158432 AAAACACGGCTGAAAGAAACCGG - Intergenic
1189579274 X:42388665-42388687 AAAGCACAGGTGAAAGAAACAGG - Intergenic
1192026736 X:67460921-67460943 AAGCCACTGCTCAAAGAAATAGG + Intergenic
1192291756 X:69804511-69804533 AAGACAAAGCTAAAAGAAACAGG + Intronic
1193228903 X:79019816-79019838 AGGACACAACTGGAAGAAACTGG + Intergenic
1195387321 X:104325388-104325410 AAGTCTCAGCTGCAAGGAAAAGG - Intergenic
1195774134 X:108384394-108384416 TAGGCACAGATTCAAGAAACAGG + Intronic
1197588990 X:128384680-128384702 AAGCCACATCTGTAGGAAAAGGG + Intergenic
1200361127 X:155607884-155607906 AAGACACTGCTGAAAGAAATCGG + Intronic
1201629380 Y:16052807-16052829 CAGCCATAGCTACAAGAAACAGG + Intergenic
1201753806 Y:17465334-17465356 AAGCCACAGATGCAGGCAGCTGG - Intergenic
1201847746 Y:18440651-18440673 AAGCCACAGATGCAGGCAGCTGG + Intergenic
1202068615 Y:20967455-20967477 ATGCCACAGCTGCAACTAAGTGG + Intergenic
1202335756 Y:23809273-23809295 AAGCCACAGATGCAGGCAGCTGG - Intergenic
1202535011 Y:25860794-25860816 AAGCCACAGATGCAGGCAGCTGG + Intergenic