ID: 1127668268

View in Genome Browser
Species Human (GRCh38)
Location 15:61170116-61170138
Sequence AGTCATAAGACTTCCTGTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 106}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127668267_1127668268 -2 Left 1127668267 15:61170095-61170117 CCTCATTTGTCAAGTGGGTTGAG 0: 1
1: 0
2: 1
3: 19
4: 248
Right 1127668268 15:61170116-61170138 AGTCATAAGACTTCCTGTATTGG 0: 1
1: 0
2: 0
3: 9
4: 106
1127668262_1127668268 7 Left 1127668262 15:61170086-61170108 CCCCAGTTTCCTCATTTGTCAAG 0: 3
1: 58
2: 775
3: 3910
4: 11083
Right 1127668268 15:61170116-61170138 AGTCATAAGACTTCCTGTATTGG 0: 1
1: 0
2: 0
3: 9
4: 106
1127668261_1127668268 17 Left 1127668261 15:61170076-61170098 CCTTGCTGATCCCCAGTTTCCTC 0: 1
1: 0
2: 40
3: 272
4: 1808
Right 1127668268 15:61170116-61170138 AGTCATAAGACTTCCTGTATTGG 0: 1
1: 0
2: 0
3: 9
4: 106
1127668263_1127668268 6 Left 1127668263 15:61170087-61170109 CCCAGTTTCCTCATTTGTCAAGT 0: 1
1: 3
2: 47
3: 305
4: 1491
Right 1127668268 15:61170116-61170138 AGTCATAAGACTTCCTGTATTGG 0: 1
1: 0
2: 0
3: 9
4: 106
1127668264_1127668268 5 Left 1127668264 15:61170088-61170110 CCAGTTTCCTCATTTGTCAAGTG 0: 1
1: 5
2: 92
3: 555
4: 1830
Right 1127668268 15:61170116-61170138 AGTCATAAGACTTCCTGTATTGG 0: 1
1: 0
2: 0
3: 9
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127668268 Original CRISPR AGTCATAAGACTTCCTGTAT TGG Intronic
907113346 1:51947516-51947538 GGTTAGAGGACTTCCTGTATTGG - Intronic
907537709 1:55180088-55180110 AGGCATAATGCTTCATGTATCGG + Intronic
908978924 1:69930431-69930453 TGTCTGAAGAATTCCTGTATAGG + Intronic
917238756 1:172923246-172923268 AGTCATAGGACTCATTGTATGGG - Intergenic
917416356 1:174814480-174814502 AGACATAAGTCATCCAGTATTGG + Intronic
920932283 1:210400320-210400342 AGTGATAAGAGTTTCTTTATTGG + Intronic
922923252 1:229326771-229326793 AGTCTTCTGGCTTCCTGTATCGG + Exonic
923505474 1:234601746-234601768 TGAGATAAGACATCCTGTATAGG - Intergenic
1064834657 10:19512595-19512617 AGACAGAAGCTTTCCTGTATAGG - Intronic
1070197557 10:74173054-74173076 AGTTTTAAGACTACCTGTTTTGG + Intronic
1079818005 11:25087032-25087054 ACTCAGAAGACTTCCTGACTTGG + Intergenic
1084920258 11:72464032-72464054 AGTCATAAGACTCCCTGTGATGG + Intergenic
1085187174 11:74585467-74585489 AGTAATAATACTTACTTTATTGG + Intronic
1087122429 11:94588909-94588931 GGACAGAAGTCTTCCTGTATAGG + Intronic
1088160094 11:106858631-106858653 AGTCATAATACTTCTGGTCTTGG - Intronic
1088285710 11:108185225-108185247 ATTCCTAGGACTTCCGGTATGGG - Exonic
1088538260 11:110885221-110885243 AGCCATCAGTCTTCCTGTGTCGG - Intergenic
1092025586 12:5236917-5236939 ATTCATAAGACTTTCTACATAGG - Intergenic
1093509346 12:19907688-19907710 AGTAATAGGTCTTACTGTATAGG + Intergenic
1097048728 12:56207451-56207473 ACACATAAGACATCCTGTAGTGG + Intronic
1098711334 12:73766564-73766586 AGTCAGAAGAATTTCTATATAGG - Intergenic
1104205551 12:126635027-126635049 TTTCATGAGAATTCCTGTATTGG - Intergenic
1104800120 12:131548888-131548910 GGTCATCAGACTTACTGTCTCGG - Intergenic
1106560573 13:30841914-30841936 ATTCATAATCCTTCCTGTGTAGG - Intergenic
1108894925 13:55314085-55314107 AGGCATAAGAAGTCTTGTATAGG - Intergenic
1112065162 13:95785000-95785022 AGTCAGCAGACTTCCTATACTGG + Intronic
1112122319 13:96426597-96426619 AGTCAAATGACTTACTGTCTCGG - Intronic
1117884872 14:60349889-60349911 AGTTTTACCACTTCCTGTATAGG - Intergenic
1118659189 14:67989013-67989035 AGTCCTAATACTTATTGTATAGG - Intronic
1202928428 14_KI270725v1_random:15657-15679 AGTGATAAGGCTTCATGTAAAGG + Intergenic
1125869050 15:43081121-43081143 AGTTATAAGACTTCCTGGCCAGG + Intronic
1125953152 15:43771023-43771045 ACTCAGAAGTCTTCCTGTTTGGG + Intronic
1127668268 15:61170116-61170138 AGTCATAAGACTTCCTGTATTGG + Intronic
1129054541 15:72809578-72809600 AGTCATAAGACATGCTGGCTGGG - Intergenic
1130222186 15:82028951-82028973 AGTGACAAGTCTGCCTGTATTGG + Intergenic
1133440780 16:5819299-5819321 AGGCATAAGCCTTCATGAATGGG - Intergenic
1138848702 16:60599611-60599633 AATCATAAGCCTTCCTTTATCGG - Intergenic
1142834532 17:2575236-2575258 AGTTATACAACTGCCTGTATTGG - Intergenic
1144428323 17:15166681-15166703 AATATTAAGTCTTCCTGTATAGG + Intergenic
1146232893 17:31130002-31130024 AGTCATCAGAGTTCTTGTGTTGG + Intronic
1150447692 17:65240180-65240202 AGCCATAACAGTTCCTGAATAGG - Intergenic
1153061235 18:997227-997249 AGTCAAAAGACTTCCTGGGCCGG + Intergenic
1153726107 18:7957017-7957039 AGTGTTAAGAATTCCTGTTTTGG + Intronic
1161020030 19:2005113-2005135 AGTCAAAAGAATTCCTGGCTGGG - Intronic
1163468490 19:17483563-17483585 TTTCATGAGACTTCCTGCATGGG - Intronic
926873240 2:17446247-17446269 AGTTATCAGACATCCTATATAGG + Intergenic
927132701 2:20073872-20073894 AGAAATAAGTTTTCCTGTATTGG + Intergenic
927991726 2:27452864-27452886 AATAATAAGACATACTGTATTGG - Intronic
928831772 2:35494430-35494452 AGTAGTAAGATTTGCTGTATGGG - Intergenic
940366844 2:152857867-152857889 AGTCATAAGTATTCATGTATGGG - Intergenic
942445562 2:176075174-176075196 AGTTATAAGTCTTCCTTTAGCGG + Intergenic
946857821 2:223970540-223970562 AGACATAATCTTTCCTGTATCGG - Intergenic
1172887094 20:38238799-38238821 AGTGATAAGACCTTCTGTATTGG + Intronic
1174012906 20:47465041-47465063 AGTCCTATGACTTCCTGGGTTGG + Intergenic
1174029473 20:47610646-47610668 ACTCACAAGACTTCCTGAATAGG - Intronic
1175019855 20:55834169-55834191 AATCATAAGATCTCCTGTGTAGG + Intergenic
1176590456 21:8644300-8644322 AGTGATAAGGCTTCATGTAAAGG + Intergenic
1180273284 22:10621333-10621355 AGTGATAAGGCTTCATGTAAAGG + Intergenic
1184631839 22:45787530-45787552 ACTCAGTAGACTTACTGTATGGG + Intronic
949136823 3:577375-577397 AGTGATAAGGCTTCGTGTAAAGG - Intergenic
949272073 3:2229442-2229464 AGTCATGAGGCTTCTTGAATAGG + Intronic
950348181 3:12319021-12319043 AGTCATAAGACTTGGTGGCTGGG + Intronic
953674304 3:44988443-44988465 AGTCAGCAAACTTCCTGTAAAGG + Intronic
954114188 3:48455791-48455813 AGTCACAAGACTTCCAGGCTGGG - Intronic
954926181 3:54237041-54237063 AGTCATTAGACTTCCCTTAATGG - Intronic
955674130 3:61432609-61432631 ACTGATAATACATCCTGTATTGG - Intergenic
955690420 3:61585381-61585403 AGTCATAAGACTGCGTGTTGAGG - Intronic
967604555 3:191430188-191430210 TGTGATAAGACATCCAGTATGGG + Intergenic
970561324 4:17284719-17284741 GGTCACAGGACTTCCTGAATGGG - Intergenic
971658742 4:29384739-29384761 AGTCATAAAATTTCCTGTCAGGG - Intergenic
971693608 4:29869342-29869364 AGTCATCAGCCTTCCTGGAGGGG - Intergenic
972314042 4:37908747-37908769 AGAAATAAGACTTCCTTTTTGGG - Intronic
974576749 4:63734938-63734960 AGTAATAAGCTTTCCTTTATTGG - Intergenic
974756766 4:66219336-66219358 AGTCAAAACACTTTTTGTATAGG - Intergenic
975256452 4:72241691-72241713 AGTCATGAGACTCACTGTATAGG - Intergenic
975347586 4:73310925-73310947 AGTCTTAAAACTTCCTGTCATGG - Intergenic
976301055 4:83515974-83515996 AGTCATAATCCTGCCTGGATTGG + Intronic
976442637 4:85093192-85093214 GGTCATAAGCCTTCATGAATAGG - Intergenic
982272692 4:153607583-153607605 AGTCATAAGATTGCCTTTAAAGG + Intronic
987641640 5:20619602-20619624 AGTCATGAGACTTGGAGTATCGG - Intergenic
997724188 5:136106488-136106510 TGTCATAAGACTTGCTGAAGAGG - Intergenic
997760072 5:136437590-136437612 TGTAATATGGCTTCCTGTATTGG - Intergenic
1001175850 5:169468228-169468250 ATTCATATGACTCCCTGTTTTGG + Intergenic
1004945927 6:20612907-20612929 AGTCTTATTACTTACTGTATGGG - Intronic
1007838071 6:44692029-44692051 AGTCACAAGACATTCTGTTTGGG - Intergenic
1011905840 6:92366342-92366364 GGTCATAAGACTTCATGTTGAGG - Intergenic
1012937050 6:105379323-105379345 AGTCAGCAAACTTCCTGTAAAGG - Intronic
1013024624 6:106258735-106258757 AGTCATAAGTTATCCTGAATTGG - Intronic
1014476469 6:121878663-121878685 AGTAATAAGATTTCCTGAAAAGG + Intergenic
1019058337 6:169238625-169238647 AATTATAAGACTAACTGTATAGG + Intronic
1022178533 7:27895704-27895726 AGTTACAAGACTTCCTCTCTTGG + Intronic
1024227599 7:47338145-47338167 AGTAAAAAGAGTTCCTGTACAGG + Intronic
1024848744 7:53683630-53683652 AATCATATGACATCCTGTAAAGG + Intergenic
1025984645 7:66438477-66438499 ATTCATGAGACTCCCTGTAAAGG - Intergenic
1026030071 7:66784468-66784490 ATTAATAAGACTGCCTGTAAAGG + Intronic
1027207849 7:76117066-76117088 ATTCATAAGACTGCCTGTAAAGG - Intergenic
1031116709 7:117676787-117676809 AGTTATCTGACTCCCTGTATGGG - Intronic
1036964311 8:13278852-13278874 AGTCATCAGAGATCATGTATAGG + Intronic
1039790252 8:40870112-40870134 ACTCATCAGATTTCCTTTATAGG - Intronic
1051152066 9:14092532-14092554 AGTCATCTGACTTCCTGTGTAGG - Intronic
1057319379 9:93998286-93998308 AGTCATAAGACTTAGTGTACAGG - Intergenic
1058285020 9:103167053-103167075 AGTAATAAGACATCCTCTAAAGG - Intergenic
1059492003 9:114675807-114675829 AGCCATAAGAGATGCTGTATAGG + Intergenic
1060437943 9:123611442-123611464 AGTCTTAAGACTTCCTGCCAGGG - Intronic
1203620463 Un_KI270749v1:122965-122987 AGTGATAAGGCTTCATGTAAAGG + Intergenic
1187404227 X:18988084-18988106 AGTCAGCAGACTTCCTTTGTGGG + Intergenic
1187418795 X:19116569-19116591 ACTTATAAGACTGCATGTATTGG + Intronic
1187625733 X:21111342-21111364 AGTGATCAGAGTTCCTGTGTTGG + Intergenic
1190284846 X:48955189-48955211 GGACATAAGACTTCCTGCCTCGG - Intronic
1190816004 X:53930078-53930100 CGTGATAAGAATTCCTATATGGG + Intergenic
1198653307 X:138887510-138887532 AGTCAAAAGACTTCAAGTTTTGG + Intronic
1202079809 Y:21072591-21072613 AGAGTCAAGACTTCCTGTATTGG - Intergenic
1202169402 Y:22025168-22025190 GGTCATAATACTTCATGAATTGG + Intergenic
1202221963 Y:22561197-22561219 GGTCATAATACTTCATGAATTGG - Intergenic
1202321155 Y:23634470-23634492 GGTCATAATACTTCATGAATTGG + Intergenic
1202549612 Y:26035586-26035608 GGTCATAATACTTCATGAATTGG - Intergenic