ID: 1127668412

View in Genome Browser
Species Human (GRCh38)
Location 15:61171403-61171425
Sequence ACAGACCTACTGAACTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127668412_1127668419 27 Left 1127668412 15:61171403-61171425 CCCCCAGAGTTCAGTAGGTCTGT 0: 1
1: 1
2: 0
3: 22
4: 131
Right 1127668419 15:61171453-61171475 GATGCTGATTCTGCTAATCCAGG 0: 1
1: 1
2: 25
3: 221
4: 692
1127668412_1127668416 3 Left 1127668412 15:61171403-61171425 CCCCCAGAGTTCAGTAGGTCTGT 0: 1
1: 1
2: 0
3: 22
4: 131
Right 1127668416 15:61171429-61171451 TGCATTTCAAATAAGAACCCAGG 0: 1
1: 0
2: 14
3: 161
4: 1085

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127668412 Original CRISPR ACAGACCTACTGAACTCTGG GGG (reversed) Intronic
902534867 1:17113829-17113851 ACATACCTGCTGCACTTTGGAGG - Intronic
904378543 1:30096448-30096470 GCAGACCTCCTGAGCTGTGGAGG + Intergenic
909324252 1:74329823-74329845 ATAGACCTACAGAACTAGGGAGG - Intronic
910046734 1:82926586-82926608 ATTGACCTACAGAACTGTGGAGG + Intergenic
915519719 1:156435023-156435045 GCAGAGGTACTGAACTCTGGGGG + Intergenic
918326105 1:183412132-183412154 ACAGAGATACGGAGCTCTGGAGG + Intronic
918630540 1:186712282-186712304 ACAGACAAACTAAACTATGGTGG - Intergenic
922073369 1:222218062-222218084 GCTGACCTTCTGGACTCTGGTGG - Intergenic
923594658 1:235351649-235351671 ACAGACCAATTGCACTCTGCTGG + Intergenic
1063066855 10:2618878-2618900 ACTGAACTACTGAACTGTGATGG + Intergenic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064539733 10:16393243-16393265 ATAGAGCTGCTGGACTCTGGAGG + Intergenic
1065158279 10:22893505-22893527 ACACCCCTACTGATCTCTTGTGG + Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1067039241 10:42940200-42940222 CCAGACCCACTGAAGTCTGGAGG - Intergenic
1071753291 10:88505997-88506019 ACAGACCCCAGGAACTCTGGGGG + Intronic
1071976995 10:90965054-90965076 ACAGAGATAATGAACTATGGAGG - Intergenic
1074756003 10:116624581-116624603 GCAGACCTGCTGAAAACTGGAGG - Intronic
1076032297 10:127169969-127169991 ACAGAGCCCCTGAACTCAGGGGG + Intronic
1076467505 10:130694473-130694495 ACAGGCCTGCAGAACTATGGAGG + Intergenic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1079440060 11:20504339-20504361 ACAGACATACAGATCCCTGGGGG - Intronic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084684889 11:70687743-70687765 ACAGAGCTCCTGAGCTCTGGGGG + Intronic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1091333407 11:134748896-134748918 ACAAACCTTGTGATCTCTGGTGG + Intergenic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1093234246 12:16586542-16586564 TCAGGCCAACTGAATTCTGGAGG + Intronic
1095748950 12:45689962-45689984 ACAGCCCTACAGAAATCTGAGGG + Intergenic
1096153477 12:49329228-49329250 TCTTACCTGCTGAACTCTGGGGG - Exonic
1100024021 12:90105854-90105876 ACATACCCACGGACCTCTGGTGG - Intergenic
1104292911 12:127485584-127485606 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1108131589 13:47307266-47307288 ACAGACCTTCTGAGGTCTGAAGG - Intergenic
1108621832 13:52192476-52192498 ACATAGCTACTGTACTCGGGAGG + Intergenic
1127668412 15:61171403-61171425 ACAGACCTACTGAACTCTGGGGG - Intronic
1127997468 15:64161948-64161970 ACAGATCGGCTGAACTCTGCAGG + Intronic
1131537132 15:93246745-93246767 ACAGACCTCCTGCACTCTCCTGG - Intergenic
1133409800 16:5558717-5558739 ACAGACCCTCTGCACTCTGAGGG - Intergenic
1146230039 17:31099209-31099231 ACAGACATATTGCACTCTGATGG + Intronic
1154290783 18:13104346-13104368 ACACACCCACTGAATTCAGGTGG - Intronic
1155070638 18:22312970-22312992 ACAGACCAACAGCACTTTGGGGG - Intergenic
1156099383 18:33575620-33575642 ACATGCCAATTGAACTCTGGAGG + Intergenic
1157072409 18:44423367-44423389 ACAGAGCTATGGAACTGTGGGGG + Intergenic
1157225104 18:45855567-45855589 ACTGACCTGCTGAGCTTTGGGGG + Exonic
1160901384 19:1430350-1430372 CTAGACTTACTGAACTGTGGCGG - Exonic
1163916790 19:20247099-20247121 ACAGGCCTGTTAAACTCTGGGGG + Intergenic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1164481054 19:28611268-28611290 AAAGGCCTATTGAACTCTGGGGG + Intergenic
1165165905 19:33856046-33856068 ACAGATATTCTGAGCTCTGGTGG + Intergenic
1166567374 19:43773514-43773536 CCAGACCTACTGAATCCTGGAGG - Intronic
1166753863 19:45178876-45178898 ACAGTCCGACTGGACTCTGCTGG - Intronic
925584391 2:5449060-5449082 ACAGATTCACTGAACACTGGTGG - Intergenic
926428283 2:12759759-12759781 AGACACCTACTGAATTTTGGAGG + Intergenic
930518552 2:52435521-52435543 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
931698380 2:64889215-64889237 AAAGTCCTGTTGAACTCTGGGGG - Intergenic
932275268 2:70446801-70446823 CCAGACCTACTATACTGTGGGGG - Intergenic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
932353441 2:71049745-71049767 AAGGGCCTACTGAACTCTGGGGG + Intergenic
938603327 2:132865666-132865688 TCTGTCCTACTGAACTATGGGGG + Intronic
938644731 2:133318992-133319014 CCAGGCCCACTGAACTCTGGGGG + Intronic
939739429 2:145887314-145887336 AGAGGCCAACTGGACTCTGGAGG - Intergenic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940990676 2:160092948-160092970 TCTGACCTACTGAACTTTTGGGG - Intergenic
943961899 2:194275048-194275070 ACAAGCCTAATGCACTCTGGTGG + Intergenic
945893707 2:215458521-215458543 ACATACCTGTTGTACTCTGGTGG + Intergenic
947325042 2:228964848-228964870 ACAGACATGCTGAAGTCTGCTGG + Intronic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1168987274 20:2060553-2060575 CCTGACCTACTGAATTTTGGTGG - Intergenic
1170759689 20:19238794-19238816 ACACACCTCCTGCCCTCTGGAGG + Intronic
1171018217 20:21561004-21561026 CCAGACCTACTGCACCCTGAGGG - Intergenic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1172503559 20:35444371-35444393 CGAGACATACTGAAGTCTGGAGG + Intronic
1173811286 20:45957432-45957454 ACAGATCTGCTGAAGTCTGGTGG - Intronic
1177321864 21:19532854-19532876 AAATACCTACAGAACTCTGAAGG - Intergenic
1182038925 22:27221006-27221028 ACAGACCAAGTGGGCTCTGGAGG - Intergenic
1183658466 22:39204653-39204675 ACAGACCTCCTGGCCTCCGGAGG - Intergenic
1184433245 22:44453991-44454013 ATAGACCAACTGTGCTCTGGTGG - Intergenic
1185079823 22:48703515-48703537 ACAGTCCCAGTGAGCTCTGGTGG + Intronic
949158118 3:851155-851177 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
949884564 3:8682968-8682990 AAAGGCCTATTTAACTCTGGGGG + Intronic
950199241 3:11031093-11031115 ACAGACCACATGGACTCTGGAGG - Intronic
951643432 3:24861659-24861681 AAAGACCTACAGAACTGTGGGGG - Intergenic
953189177 3:40667679-40667701 CCAGACCTACTGAACTCTGGGGG + Intergenic
954683681 3:52359302-52359324 CCAGACCTACTGGACCATGGAGG + Exonic
957022501 3:75140957-75140979 AAAGGCCTATTGAACTCTGGGGG + Intergenic
957044389 3:75362712-75362734 AAGGTCCTATTGAACTCTGGGGG - Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
960589341 3:119350482-119350504 CCAGACCTACGGCACTATGGGGG - Intronic
961272252 3:125698050-125698072 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961278032 3:125742910-125742932 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961876382 3:130026746-130026768 AAGGGCCTACTGAACTCTGGGGG - Intergenic
961892843 3:130144903-130144925 AAGGGCCTAATGAACTCTGGGGG - Intergenic
965945994 3:174241988-174242010 ACAGAGCTACTGTGCTCTGCTGG - Intronic
968616088 4:1578584-1578606 ACAGACCCACTAGACTCTGCAGG + Intergenic
969024340 4:4161595-4161617 AAAGGCCTATTGAACTCTTGGGG - Intergenic
969749920 4:9102238-9102260 AAGGGCCTACTGAACCCTGGGGG + Intergenic
969785645 4:9455099-9455121 AAGGACCTATTGAACTCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
972787046 4:42336194-42336216 ACTGACATATTGAACTCTTGTGG + Intergenic
979660190 4:123244250-123244272 ACAGCCCTGCTGCACTCTGGTGG + Intronic
983071668 4:163275179-163275201 ACAGACCTAGTGAAATCCAGGGG + Intergenic
988333123 5:29869044-29869066 ACAGACCATCTGAAAGCTGGAGG + Intergenic
1007922640 6:45624667-45624689 ACAGATTACCTGAACTCTGGAGG - Intronic
1011565351 6:88666944-88666966 AAAGGCCTATTGAACTCAGGGGG + Intronic
1012611689 6:101227133-101227155 AAAGGCCTGTTGAACTCTGGGGG - Intergenic
1013937294 6:115613082-115613104 ACAGACCTCCCTAACTCAGGAGG + Intergenic
1015923394 6:138287390-138287412 AGAGACATACTGACCCCTGGTGG + Intronic
1016100029 6:140087963-140087985 AAAGAACTACAGAACTATGGTGG + Intergenic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1024219085 7:47273790-47273812 ACAGACCTACTGTCCTCCAGTGG + Intergenic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1030468029 7:109927006-109927028 AAAGATCAGCTGAACTCTGGAGG - Intergenic
1032093195 7:128922298-128922320 ACAGTCCTACTGGACTGTGAGGG - Intergenic
1032170776 7:129582843-129582865 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
1032476952 7:132218043-132218065 ACCCACCGACTGGACTCTGGAGG - Intronic
1032564229 7:132924941-132924963 AAAGAACTGCTGAACACTGGGGG + Intronic
1035737699 8:1900796-1900818 ACTGACCTACGTAACTCTGCTGG - Intronic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1036906000 8:12708907-12708929 AAAGGCCTGCTGAACTCTGGGGG - Intergenic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1039278388 8:35956286-35956308 AAAGGCCTATTAAACTCTGGGGG + Intergenic
1039378080 8:37057573-37057595 ACAGACTTAGTGATATCTGGAGG - Intergenic
1041422494 8:57683716-57683738 AACGACCTACTTAAATCTGGAGG - Intergenic
1044460674 8:92440729-92440751 TCAGACTTAGTGAACTCTGGGGG + Intergenic
1045190685 8:99879912-99879934 ACAGACCTACAGAAACCTGTGGG + Intronic
1048067439 8:130984453-130984475 ACAAACTTACTGAGCTCTGCAGG - Intronic
1051062946 9:13066188-13066210 ACTGCCCTACTTAACTATGGAGG + Intergenic
1051551319 9:18332788-18332810 ACACTCTTACTGAACTCTGGCGG - Intergenic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1058870531 9:109198030-109198052 ACAGTCCTAATGATCTCTGGGGG - Intronic
1060619249 9:125048312-125048334 AGATACCTACTGTACTCTGGTGG + Intronic
1060890878 9:127187419-127187441 ACAGAGCTACTGCACGCTGGAGG - Intronic
1061571414 9:131479764-131479786 AGAGAGCTCCTGAACTCTTGCGG - Intronic
1061919262 9:133773232-133773254 ACAGACCTACTGAATACTGTAGG + Intronic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1186322580 X:8445668-8445690 ACACACTTACAGAACTCTGTGGG - Intergenic
1187267162 X:17745955-17745977 ACAGCCAAACTGAACACTGGGGG - Intronic
1187521556 X:20018994-20019016 ACAGAGCTGATGAACTTTGGAGG - Intronic
1187532176 X:20107011-20107033 ACAGAGCTGATGAACTTTGGAGG + Intronic
1191942159 X:66492192-66492214 ACACACCTACAGAACCCTGCAGG + Intergenic
1195437094 X:104857164-104857186 AAATACCTATTGGACTCTGGAGG + Intronic
1195964479 X:110417736-110417758 AAACACTTACTGAGCTCTGGAGG + Intronic
1197321871 X:125042643-125042665 TCCCACCTACTGCACTCTGGTGG - Intergenic
1197747254 X:129939959-129939981 ACAGACCTCCTTATCCCTGGGGG + Intergenic
1197792300 X:130268450-130268472 ACAGACCGACAGGACTCAGGAGG + Intronic
1201491804 Y:14549803-14549825 ACTGACATACTGGCCTCTGGGGG + Intronic