ID: 1127668523

View in Genome Browser
Species Human (GRCh38)
Location 15:61172314-61172336
Sequence CCTTTCTTACGGTGGCACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 64}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127668516_1127668523 9 Left 1127668516 15:61172282-61172304 CCACCCATATAAATACCACGTAT 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1127668523 15:61172314-61172336 CCTTTCTTACGGTGGCACAAAGG 0: 1
1: 0
2: 0
3: 5
4: 64
1127668519_1127668523 -6 Left 1127668519 15:61172297-61172319 CCACGTATTTCATTATTCCTTTC 0: 1
1: 0
2: 1
3: 57
4: 371
Right 1127668523 15:61172314-61172336 CCTTTCTTACGGTGGCACAAAGG 0: 1
1: 0
2: 0
3: 5
4: 64
1127668518_1127668523 5 Left 1127668518 15:61172286-61172308 CCATATAAATACCACGTATTTCA 0: 1
1: 0
2: 2
3: 16
4: 172
Right 1127668523 15:61172314-61172336 CCTTTCTTACGGTGGCACAAAGG 0: 1
1: 0
2: 0
3: 5
4: 64
1127668517_1127668523 6 Left 1127668517 15:61172285-61172307 CCCATATAAATACCACGTATTTC 0: 1
1: 0
2: 1
3: 26
4: 344
Right 1127668523 15:61172314-61172336 CCTTTCTTACGGTGGCACAAAGG 0: 1
1: 0
2: 0
3: 5
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127668523 Original CRISPR CCTTTCTTACGGTGGCACAA AGG Intronic
902677950 1:18022001-18022023 TCTTATTTAGGGTGGCACAAGGG + Intergenic
910055450 1:83028343-83028365 TCTTTCCTACAGTGGCACCAGGG - Intergenic
917294402 1:173504008-173504030 CCCTTCTTAGGGTGCCCCAAGGG + Intronic
917906299 1:179589475-179589497 CCCTTGTTCTGGTGGCACAAGGG + Intergenic
918623456 1:186631847-186631869 CTTTTCTTACTGGGTCACAAAGG - Intergenic
923268301 1:232333267-232333289 CCTTGCTGAGAGTGGCACAAAGG + Intergenic
923641778 1:235769443-235769465 CCTTTGCTTCGGTGGCACTAAGG - Intronic
1069106688 10:64392305-64392327 TCCTTCATACGGTAGCACAATGG + Intergenic
1069879790 10:71584813-71584835 CCTGGCTTAGGGTAGCACAATGG + Intronic
1073345183 10:102777533-102777555 CCTTTCTTGTGGGGGCAGAAGGG - Intronic
1073871450 10:107869488-107869510 CCTTTATTTCTGTAGCACAATGG + Intergenic
1075301898 10:121332402-121332424 CTTGTCTTACTGTGACACAAGGG + Intergenic
1079033389 11:17002143-17002165 CCTTTCTGAGGGAGGCCCAAGGG + Intronic
1090982617 11:131736750-131736772 CTTCTCTTAGGGTGGCATAAGGG + Intronic
1098932855 12:76440364-76440386 TCTTTCTTACAGGTGCACAATGG + Intronic
1102713705 12:114951860-114951882 CCTTTATTAAGGAGGCCCAAGGG + Intergenic
1103070126 12:117934440-117934462 CTTTCCTTACGGTGGCAGAATGG - Intronic
1107771171 13:43788270-43788292 CCTTTGTTAAGGGTGCACAATGG - Intergenic
1110514700 13:76396291-76396313 CCTTTCTTACCCTAGAACAAGGG - Intergenic
1114339532 14:21728518-21728540 CCTTTTTTAAGGTGGCTCAGAGG + Intergenic
1117140767 14:52789346-52789368 CCTATCTTACTGTTGTACAAGGG + Intronic
1119425264 14:74531040-74531062 CCTTCCTTACAGTGTCCCAATGG - Intronic
1127668523 15:61172314-61172336 CCTTTCTTACGGTGGCACAAAGG + Intronic
1129035894 15:72648212-72648234 CCTGTCTGGAGGTGGCACAATGG - Intergenic
1129053422 15:72801464-72801486 CCATTCTCACGGTGGTACACAGG - Intergenic
1129213991 15:74089004-74089026 CCTGTCTGGAGGTGGCACAATGG + Intergenic
1129400021 15:75276359-75276381 CCTGTCTGGAGGTGGCACAATGG - Intronic
1129472872 15:75764930-75764952 CCTGTCTGGAGGTGGCACAATGG + Intergenic
1129731126 15:77933349-77933371 CCTGTCTGGAGGTGGCACAATGG + Intergenic
1138411504 16:56844061-56844083 CCTTGCCTCCGGTGTCACAAGGG + Intronic
1140227111 16:73087400-73087422 CTTGTCTTACAGAGGCACAAGGG + Intergenic
1140476214 16:75240362-75240384 CCTTCATTACGGTGGCACGGCGG - Intronic
1141383520 16:83597860-83597882 AAATTCTTACGGTAGCACAAGGG - Intronic
1148844600 17:50521961-50521983 CTTTTCTTACAGAGGCACATTGG + Exonic
1157474988 18:48018024-48018046 ACTTTCTCAGGGTTGCACAAAGG + Intergenic
931252602 2:60546751-60546773 CCTTTCATTCTTTGGCACAATGG - Intronic
935068219 2:99670312-99670334 TCTTTATTACAGTGGCACATGGG + Intronic
935160317 2:100524048-100524070 CCCTGCTCAGGGTGGCACAAGGG + Intergenic
942255247 2:174090654-174090676 CCCTTCTTACGGTCACAAAATGG - Intronic
943836524 2:192521129-192521151 CCTTTCTTACTCTAGAACAAGGG + Intergenic
945979388 2:216296833-216296855 CCTTTCTGAGGGTGGCGTAATGG + Intronic
1169580065 20:7011652-7011674 CCATTCTTACTGTAGCACAAAGG - Intergenic
1170739346 20:19041247-19041269 ACTTTCTGATGGTGGAACAAAGG + Intergenic
1175192399 20:57220102-57220124 CCTTTCTTGGGGTGGCAAAATGG + Intronic
1184839087 22:47042140-47042162 CCTTTCATACTGTGTCACAGTGG + Intronic
949472988 3:4416030-4416052 ATTTTCTTACAGTAGCACAAAGG + Intronic
950577652 3:13842387-13842409 TCTTCCTTGCAGTGGCACAACGG - Intronic
955521414 3:59779012-59779034 CCTTTCTAACAGTGGAATAAGGG - Intronic
959653818 3:108778523-108778545 CCTCTCTGAGGGTGGCACAATGG + Intergenic
973532523 4:51847108-51847130 CCTTTCGTAGGGTGGAAGAAGGG + Intronic
975985608 4:80199062-80199084 CCTTTATTAAGGTGTCATAAAGG - Intronic
981243462 4:142506670-142506692 CCTTTCTTACTGTGGGTCAGGGG + Intronic
982757100 4:159234153-159234175 CATTTCTGACAGTGGCACCAAGG + Intronic
982990058 4:162262802-162262824 CCATTCTTAGGGTGAAACAATGG + Intergenic
987652528 5:20761492-20761514 ACTTTTTTACACTGGCACAAAGG + Intergenic
988461684 5:31444457-31444479 GCTTTCTTACCGTGGCAGAAGGG - Intronic
988743032 5:34099990-34100012 ACTTTGTTACACTGGCACAAAGG - Intronic
990872257 5:60444828-60444850 ACTTTCTTCCTGTGGCACAGAGG + Intronic
993539106 5:89126014-89126036 CCTTTCTGAGGGTGGCTCTAAGG + Intergenic
1004484685 6:16055112-16055134 GCTTTCTTGCTGTGGAACAATGG - Intergenic
1004942522 6:20575067-20575089 CCTTTCTTTTGCTGGGACAAAGG + Intronic
1009963038 6:70547171-70547193 GCTGTCCTACTGTGGCACAAAGG + Intronic
1010486934 6:76425971-76425993 CCTTTCTCAGAGTGGCAAAATGG + Intergenic
1021554641 7:21906719-21906741 GGTTTCTTATGGTGGCAAAATGG - Intronic
1032518796 7:132526893-132526915 CCTGCCCCACGGTGGCACAATGG + Intronic
1038570408 8:28657387-28657409 CCTTTCTTACTCTGGCACCTTGG + Intronic
1045030534 8:98130987-98131009 CCTATCTTTCAGTGGCAGAATGG + Intronic
1057922522 9:99108958-99108980 AATTTCTTAGGGTGGCACAGGGG + Intronic
1058362469 9:104165237-104165259 CCTATCTTAGGGTGGCAAGAAGG + Intergenic
1196365845 X:114922759-114922781 ACTTTCTTATGGTAGCAAAATGG + Intergenic