ID: 1127670228

View in Genome Browser
Species Human (GRCh38)
Location 15:61187941-61187963
Sequence GTGTGTTAGGGGAGGGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 402}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127670228_1127670238 7 Left 1127670228 15:61187941-61187963 CCCTCAACCCTCCCCTAACACAC 0: 1
1: 0
2: 3
3: 48
4: 402
Right 1127670238 15:61187971-61187993 CTCCCTGCCTCAGACCTGCCAGG 0: 1
1: 0
2: 7
3: 83
4: 536

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127670228 Original CRISPR GTGTGTTAGGGGAGGGTTGA GGG (reversed) Intronic
900110683 1:1004250-1004272 GTGTGTGAGGGGGGTGTTGAGGG - Intergenic
900304670 1:1999396-1999418 GTGTGTTAGCGGGGAGTCGATGG + Intronic
900612841 1:3551667-3551689 GGGTGTGTGGGGAGGGTTGGCGG - Intronic
900679708 1:3910080-3910102 GTCTGTGAGTGGAGTGTTGATGG + Intergenic
901642615 1:10700552-10700574 GTGTGTCAGGGGTGGGGTGGGGG + Intronic
902435428 1:16395393-16395415 GGGGGTTAGGGGAAGGTTGGGGG + Exonic
902682317 1:18052077-18052099 GTGTGTTAGGGGAAGGAGTAGGG - Intergenic
904838880 1:33357584-33357606 GTGTGTTGGGTTTGGGTTGATGG + Intronic
905419329 1:37828975-37828997 TTTTGTTAGAGGAGAGTTGAAGG - Intronic
905670503 1:39787898-39787920 GTGTGTTTGGGGCAGGGTGAAGG + Intronic
906057086 1:42925697-42925719 GTGTGTGTGGGGAGGGGTGCAGG + Exonic
906333920 1:44911848-44911870 GTGGGTTGGGGGAGGGGGGAGGG - Intronic
906882633 1:49608916-49608938 CTGTGGTGGGGGAGGGGTGATGG - Intronic
907053033 1:51342592-51342614 GTGTGGTGGGCGAGGGGTGAGGG + Intronic
907270485 1:53288164-53288186 GTGTGCTTGGGGAGGGTTTGTGG - Intronic
908440360 1:64147577-64147599 GTTTGTTAGAGGTGGGCTGAGGG - Intronic
908466943 1:64405553-64405575 ATGTGTGTGGGGAGGGTTGAAGG + Intergenic
908655964 1:66389206-66389228 GTGGTTTAAGGGAGGGTTGGGGG + Intergenic
908855067 1:68417581-68417603 GTGTGTTTGGGGAGGGTTAATGG + Intergenic
909115021 1:71522714-71522736 GTGTGTAAGGGGGGGGTAGAGGG - Intronic
909637278 1:77830591-77830613 GTGAGATAGGGCAGGGTTGCGGG - Intronic
910266914 1:85347615-85347637 GTGGGATGGGGGAGGGTGGAGGG + Intronic
910848910 1:91631939-91631961 GTGTGTTGGGTGAGGGTCGGGGG + Intergenic
912945521 1:114081041-114081063 GTGTGCTGGGAGAGGGTGGAGGG + Intergenic
913420334 1:118660046-118660068 ATATTTTAGGGCAGGGTTGATGG + Intergenic
913457658 1:119049861-119049883 GTGTTCTGGGGGAGGATTGATGG - Intronic
914834220 1:151194028-151194050 GGGTGTTAGGGGAGAGATGCTGG - Intronic
914959119 1:152190435-152190457 GTGTGTGTGGGTAGGGTTGGTGG + Intergenic
914983683 1:152438765-152438787 GTGTGTTTGGGGAGAGGTGGAGG + Intergenic
915733557 1:158070698-158070720 GTGTGTGTGGTGAGGGTTGTGGG + Intronic
915782446 1:158567643-158567665 GTGGGTTGGGGGAGGGGGGAGGG + Intergenic
915823925 1:159055981-159056003 GTACGTTAGGAGAGGGTTGTGGG + Intergenic
916801827 1:168223102-168223124 GTGTGTTAGGGGAAGGGAAAGGG + Intergenic
917316551 1:173731714-173731736 TTGTGTTGGGGGAGGGGGGAGGG + Intronic
917564489 1:176198424-176198446 CTGTGTTTGGTAAGGGTTGAAGG - Intronic
917635123 1:176928533-176928555 GAGTGTCAGGGGAGGCTTGGTGG + Intronic
918205046 1:182300708-182300730 GTGTGTTGGTGGAGGGTGGGTGG + Intergenic
918295147 1:183149558-183149580 GTGTGTGAGGAGAGGGGTGTGGG - Intergenic
918295196 1:183149805-183149827 GTGTGTGAGGAGAGGGGTGTGGG - Intergenic
918295233 1:183150002-183150024 GTGTGTGAGGAGAGGGGTGTGGG - Intergenic
918765162 1:188472587-188472609 ATGTGTAAGCAGAGGGTTGAAGG + Intergenic
918938224 1:190952902-190952924 GTTTGAGAGTGGAGGGTTGAAGG + Intergenic
919061240 1:192635549-192635571 GTGTGTGTGGGGAGGGGTGGGGG - Intergenic
919760968 1:201097776-201097798 GTGGGTGAGGGGAGGTTTTATGG + Intronic
919946191 1:202320506-202320528 GTGTGTTTGGGGCTGGGTGAGGG - Intergenic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
920505264 1:206511226-206511248 GTGTTTTGGGGTAGGGGTGATGG + Intronic
921233190 1:213095061-213095083 TTGTGTTAGGGAAGGGTTCAAGG - Intronic
921266276 1:213423392-213423414 GTTTCTTAGGGGCTGGTTGAAGG - Intergenic
922383298 1:225055677-225055699 GTGTGGTGGGGGAGGGGGGAGGG - Intronic
922850343 1:228727949-228727971 GTGTGTTTGGGGAGGGAAGTTGG + Intergenic
922934017 1:229410179-229410201 GGGTGTTGGGGGAGGGGTGCAGG - Intergenic
923041791 1:230324927-230324949 GTGTGTTAGGGGTGTGGGGAAGG + Intronic
923125249 1:231028826-231028848 GTGTGTTGCGGGAGGGGTGGAGG - Intronic
923379889 1:233406370-233406392 GTGGTTTTGGGGAGGGTTTAAGG + Intergenic
923471016 1:234291130-234291152 GTGTGTCAGGGAGGGGTTGGTGG - Intronic
924268612 1:242308934-242308956 GTGTGGGAGGGGAGGATGGAAGG + Intronic
1063528204 10:6804288-6804310 GTGGGGTAGGGGAGGGAGGAGGG - Intergenic
1066471700 10:35704131-35704153 GTGTGTTAGGGTTGTGTTGGAGG - Intergenic
1066633294 10:37477801-37477823 CTTTGTTTGGGGAGGGTAGACGG - Intergenic
1066716293 10:38289834-38289856 GTGTGGGAGGGGAGGATGGAAGG - Intergenic
1068836485 10:61560039-61560061 ATATGTTAGGGAAGGGCTGAAGG - Intergenic
1069224748 10:65929017-65929039 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1071145494 10:82565490-82565512 GTGTGTTTGGTGGGGATTGAAGG - Intronic
1071461379 10:85900068-85900090 GTGTCTTAAGGGATGTTTGAGGG - Intronic
1072731712 10:97850653-97850675 GTGTGTGAGGGGAGGGAAGGCGG + Intronic
1073104955 10:101027257-101027279 GTGAGGGAGGGGAGGGTGGAGGG - Intronic
1073345081 10:102776836-102776858 CTGTGTTGGGGGTGGGGTGAGGG + Intronic
1074627721 10:115211753-115211775 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1074960995 10:118445819-118445841 GGATGATAGGGGAGGGTGGATGG - Intergenic
1076884545 10:133255709-133255731 ATGTGACCGGGGAGGGTTGATGG - Intergenic
1078718923 11:13865712-13865734 GTGGGTTGGGGGAGGGGGGAGGG - Intergenic
1079769843 11:24445220-24445242 GTGTCTTAGGAGAGGCCTGATGG + Intergenic
1080007066 11:27420762-27420784 GTGTCTTGGGGGAAGGTGGAGGG + Intronic
1081000188 11:37659739-37659761 GTGGGGTGGGGGAGGGTGGAGGG + Intergenic
1083789916 11:64977812-64977834 CTGTGCTCAGGGAGGGTTGAAGG - Intergenic
1085214880 11:74820615-74820637 GTGTGTTTGGGGAGGGATTCAGG + Intronic
1085619956 11:78030605-78030627 GTGAGTGAGGGGAGGGCAGAAGG - Intronic
1086954545 11:92922381-92922403 GTGTGTCTGGGGAGGGAAGAGGG - Intergenic
1089272891 11:117314462-117314484 GTGTGTTTGGGGTGGGCGGAGGG - Intronic
1089318990 11:117612440-117612462 GTGTGTTAGGGGCGGGGGTAGGG - Intronic
1089581875 11:119486532-119486554 GTGTGTTAGGGGAGGGGGGTAGG + Intergenic
1090515839 11:127425649-127425671 CTGTTTCAGTGGAGGGTTGAGGG + Intergenic
1090773085 11:129938984-129939006 GAGGGTTAGGGCAGGGGTGAGGG - Intronic
1090963067 11:131574101-131574123 TGGTGTCTGGGGAGGGTTGATGG + Intronic
1091087161 11:132732634-132732656 GTGTGTAAGGGGAGGCTTCAGGG + Intronic
1091144539 11:133266225-133266247 GTGTGCTAGGGTGGGGTTGAAGG - Intronic
1091208855 11:133839530-133839552 GTGGGGTAGGGGAGGGGGGAGGG + Intergenic
1092267813 12:6996372-6996394 GTGTGATGGGGGAGGGTTACAGG - Intronic
1093643435 12:21554669-21554691 GTGTGTTAGGGAAAGGTGCAAGG + Intronic
1094096030 12:26705791-26705813 GTGAGGAAGGGAAGGGTTGAAGG - Intronic
1095476473 12:42590929-42590951 GTGTGTGGGGGGAGTGTGGAGGG + Intergenic
1095500289 12:42830166-42830188 GTGTGTCAGGGGTGGGTGGGTGG + Intergenic
1095770608 12:45952201-45952223 GTGGCTGAGGGGAGGGGTGAAGG - Intronic
1096370302 12:51063843-51063865 GTGCGGAAGGGGAGGCTTGAGGG + Exonic
1096418013 12:51430483-51430505 ATGTGTGAGGAGAGGGTGGAGGG - Intronic
1096705722 12:53420773-53420795 GGGTGTGAGGGGAGATTTGAAGG - Intergenic
1096844980 12:54401491-54401513 GTGGTTTAGAGGAGGGTGGAAGG + Intronic
1096914305 12:55015025-55015047 GTGTATAAGGGGAGAGTTGGTGG + Intergenic
1097921025 12:65073871-65073893 GTGTGTGTGGGGTGGGGTGAGGG + Intronic
1098115591 12:67173099-67173121 GTGTGTTAGTGGGGGGATGAAGG - Intergenic
1099105261 12:78488192-78488214 GTGTGTTAGGGGACAGGTAAAGG + Intergenic
1099144212 12:79018343-79018365 GTGGGGTAGGGGAGGGGGGAGGG + Intronic
1099608874 12:84839575-84839597 GTGGGGTAGGGGAAGGGTGAGGG + Intergenic
1100693174 12:97061521-97061543 GTGGGTTCGGGGCGGGTAGAGGG + Intergenic
1101778431 12:107814860-107814882 GGGGGTTAGGGGATGGGTGAGGG - Intergenic
1101838256 12:108310193-108310215 GTGTGTTAGGGGAGGGGAGAAGG + Intronic
1102867922 12:116388948-116388970 GTGTGTGGCGGGAGGGTGGAGGG - Intergenic
1103946838 12:124531758-124531780 GTGTGTAGGGGGAGGTTTTAGGG - Intronic
1104182891 12:126399476-126399498 GTGTGGTGGGTGAGGGATGAGGG - Intergenic
1104610730 12:130225655-130225677 GTGTGCTGGGGGAGGGGTGGGGG - Intergenic
1104779818 12:131412928-131412950 GTGTGTTGGGGGCAGGATGAGGG + Intergenic
1104815023 12:131640569-131640591 CTGTGCTGGGGAAGGGTTGAGGG + Intergenic
1107905567 13:45058040-45058062 GTGTGATGGGGCAGGGGTGAGGG - Intergenic
1108779778 13:53815432-53815454 GTGTGTTAGCGGAGTACTGAAGG - Intergenic
1109169262 13:59075653-59075675 GTGTGCTAGGGCAGTGTGGAAGG - Intergenic
1110333566 13:74300481-74300503 GTGTGGTAGGGGTGGGTGGATGG + Intergenic
1110435931 13:75478428-75478450 GTATGTTAGGGGATGTTTGCAGG + Intronic
1111507438 13:89212037-89212059 GTGTGTTGGGGGAGAGGTGGTGG - Intergenic
1113781503 13:112980132-112980154 GTGTGTTTTGGGTGGGATGAGGG + Intronic
1115755901 14:36525557-36525579 GGGTGTGAGGGAAGGGTGGAGGG + Intergenic
1116538548 14:46066539-46066561 GTGGGTTGGGGGAGGGGGGAGGG + Intergenic
1118106448 14:62665638-62665660 GTGTGTTGCGGGAGGGCTGGGGG - Intergenic
1118755876 14:68843491-68843513 GTGTGTTTGGGGAGGGAGTAGGG - Intergenic
1119903933 14:78284700-78284722 GTGTGTTTGGGGAGGTTCTACGG - Intronic
1121774808 14:96583662-96583684 GTGTGTTGGGGGAGGGCGGGTGG + Intergenic
1122001830 14:98664803-98664825 GTGTGTCAGAGGAGGGTTCTCGG - Intergenic
1122265963 14:100546985-100547007 GTGTGTTGGGGGCGGTTTAAAGG + Intronic
1124039515 15:26087682-26087704 GTGTGTTAGGAGAAGCTTCAAGG - Intergenic
1124229794 15:27934445-27934467 CTGTGTTAGAGGAGCGGTGAAGG - Intronic
1124569435 15:30848765-30848787 GTGGGGTGGGGGAGGGGTGAGGG - Intergenic
1127304144 15:57685506-57685528 GTGTGTCGGGGGAGGGTGGGGGG + Intronic
1127670228 15:61187941-61187963 GTGTGTTAGGGGAGGGTTGAGGG - Intronic
1127693323 15:61419134-61419156 GTGGGTTAGGGAAGGGGTCAGGG + Intergenic
1128283434 15:66416343-66416365 GTGTGTTTGGGGGGGATTGTAGG - Intronic
1129912871 15:79242589-79242611 AGGAGTGAGGGGAGGGTTGACGG + Intergenic
1129926310 15:79367464-79367486 GTGTTTTAGGGGAGAGTTTAAGG - Intronic
1130928522 15:88403354-88403376 GTGTGTTGGGGGCGGGGTGGGGG - Intergenic
1133302063 16:4788342-4788364 GTGTGATGGGGGAGGGGAGAGGG + Exonic
1137275896 16:46933236-46933258 GTGAGTTCAGGGTGGGTTGAGGG + Intergenic
1137621356 16:49878516-49878538 GTGGGTTGGGGGAGGGGGGAGGG - Intergenic
1137732414 16:50698390-50698412 GTGTGTGTGGGAAGTGTTGATGG + Intronic
1140068310 16:71627760-71627782 GTGAGCTAGGGGAGGGTGGGGGG + Intronic
1142614112 17:1125138-1125160 CTGGGTTTGGGGAGGGGTGACGG - Intronic
1142870189 17:2814843-2814865 GTGTTGGGGGGGAGGGTTGACGG + Intronic
1144447828 17:15347429-15347451 GAGTGGAAGGGGAGGGCTGATGG + Intergenic
1144447851 17:15347514-15347536 GAGTGGAAGGGGAGGGCTGATGG + Intergenic
1144447863 17:15347557-15347579 GAGTGGAAGGGGAGGGCTGATGG + Intergenic
1144720250 17:17464130-17464152 GTGTGTTAGGGGAGAGGTATTGG + Intergenic
1144830359 17:18127573-18127595 GTGGGTTAGGGGTGGGGTGGGGG + Intronic
1146184720 17:30717366-30717388 CTGTGTGTGGGGAGGGTTGCTGG - Intergenic
1146540352 17:33688089-33688111 GTGTGTTGGGGGTGGCCTGAGGG + Intronic
1146688329 17:34856616-34856638 GGGGGTTAGGGGAGGGTAGAGGG + Intergenic
1147210592 17:38870548-38870570 GTGTGTTGGGGGAAGGTTAGGGG + Intronic
1147266959 17:39240189-39240211 GTGAGTTTGGGCAGGGGTGAGGG + Intergenic
1147387251 17:40089815-40089837 GTGTGTAGGGGGTGAGTTGAGGG - Intronic
1151518147 17:74610388-74610410 GTGGGTTAGCAGAGTGTTGAGGG - Exonic
1151944929 17:77314563-77314585 GTGTGTTAGGTGAGGGGACATGG + Intronic
1152262228 17:79273414-79273436 GTGTTTTAGGGTGGGGTGGATGG + Intronic
1152279191 17:79375432-79375454 GTGTATTTGGGGAGTGTTGAGGG + Intronic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1152591736 17:81216893-81216915 GGATGTCAGGGGAGGGATGAAGG + Intronic
1155075578 18:22351195-22351217 GTGTGTTGGGGGAAGGGAGATGG + Intergenic
1156505038 18:37585108-37585130 GTGTGTGAGGGCAGGGTGGGAGG + Intergenic
1156897737 18:42265808-42265830 GTGTGGTGGGGGAGGGGGGAGGG - Intergenic
1158608913 18:58920786-58920808 GTGTGTTTGGGGAGGGGAGGGGG + Intronic
1158911947 18:62073199-62073221 GTGTGTAAGGGGGGGATGGAGGG + Intronic
1159128049 18:64247736-64247758 GTGTGGTAAGGGAAGGTAGATGG - Intergenic
1160473328 18:79159583-79159605 GGGGTTGAGGGGAGGGTTGATGG - Intronic
1161724549 19:5921007-5921029 GTGTGTGAGGGTGGTGTTGAGGG + Intronic
1162154177 19:8665370-8665392 GTGTGTTTGAGGAGGGCTAAGGG + Intergenic
1162780451 19:13004159-13004181 TTGTGGTCGGCGAGGGTTGAGGG - Intronic
1162974063 19:14198327-14198349 CTGTGTGTGGGGAGGGTTGCTGG + Intronic
1163637142 19:18442236-18442258 GTGTGTTGGGGATGTGTTGAGGG - Intergenic
1164284518 19:23801237-23801259 TTTTTTTAGGGGAGGGTTGGGGG + Intronic
1164326964 19:24202293-24202315 TTGGGTCAGGGGAGGGTGGAGGG + Intergenic
1165157462 19:33796828-33796850 GTGGGTGGGGGGAGGGTTGGGGG + Intronic
1165660042 19:37570105-37570127 GTCTTTTAGGGGAGGGTGGGTGG - Intronic
1166066845 19:40365114-40365136 GTGTGTTTGGGGGAGCTTGAGGG + Intronic
1166203647 19:41254576-41254598 GAGGGTAAGGGGAGGGTAGAAGG + Intronic
1166917655 19:46206476-46206498 GTGTGTGTGGGGCGGGGTGAGGG + Intergenic
1166963618 19:46514876-46514898 GTGTGTCAGGGTCGGGGTGATGG - Intronic
1167635652 19:50653799-50653821 GTGACTTTGGGGAGGGTTCACGG + Intronic
925513470 2:4653325-4653347 GTGTGTTGGGGGTGGGGTCAAGG + Intergenic
925926530 2:8675183-8675205 GGGGGTTGGGAGAGGGTTGAGGG - Intergenic
926209134 2:10856132-10856154 GTGTGTTGGGGGGGGGTGGTGGG + Intergenic
926274995 2:11396827-11396849 GTGTGCTGAGGGAGGGGTGATGG + Intergenic
927369844 2:22341844-22341866 GTGAGTTTGGGAAAGGTTGAAGG - Intergenic
927394223 2:22631103-22631125 GTGTGTGTGGGAAGGGTTGGGGG - Intergenic
930194075 2:48491297-48491319 GGGTGTTGGGGGAGGGCTGTGGG + Intronic
930364206 2:50418365-50418387 GTGTGTTGGGGGAGGCTGCAAGG - Intronic
931694920 2:64864610-64864632 GTGTGTCGGGGGAGGGTATAAGG - Intergenic
931757818 2:65389390-65389412 GTGTGTTGGGGGAGGAAGGAGGG + Intronic
933609811 2:84422265-84422287 ATGGGTTTGGGGAGGTTTGATGG - Intergenic
933654967 2:84879978-84880000 GGGGGTTGGGGGTGGGTTGAGGG - Intronic
933820186 2:86104190-86104212 AGGTGTAAGGGGAGGGTGGAAGG + Intronic
935271130 2:101435317-101435339 GTGTGTTTCGGGAGGGATGAGGG + Intronic
935467879 2:103420863-103420885 GTGTGTTGGGGGAGGGGATAGGG + Intergenic
937171128 2:119870052-119870074 GTGTGTTAGGGTATGTTTGTTGG + Intronic
937977387 2:127589888-127589910 GTGTGTGAGTGGATGGGTGAAGG + Intronic
940154697 2:150643197-150643219 GTGTGCTGGGGGAGGATGGAGGG - Intergenic
940406161 2:153304927-153304949 GTGGGTTAGCTGAGGGTTAAGGG + Intergenic
941726980 2:168871206-168871228 GTGGGTTGGGGGAGGGGGGAGGG + Exonic
943059044 2:183018537-183018559 GTGTTTTAGGGGTGGGGTGGTGG - Intronic
943509630 2:188808518-188808540 GCCTGTTGGGGGAGGGTTGGGGG + Intergenic
945005290 2:205398919-205398941 GTGTGCTGGGGCAGGGTTGGGGG + Intronic
945868901 2:215205763-215205785 GTGTGTTGGGGGTGGGGTGGGGG - Intergenic
946549310 2:220783136-220783158 TTCTGTTAGGGGAGGGTTGTTGG + Intergenic
947245724 2:228046063-228046085 GTGTGTAGGGGGTGGGATGAAGG - Intronic
948201627 2:236133582-236133604 GTGTGTAAGTGGAGGCATGAGGG - Intergenic
1169381795 20:5113497-5113519 GTGTGGTAGTGGGGTGTTGACGG - Intergenic
1170175080 20:13459855-13459877 GTGTGTTCGGGCAGAGGTGAAGG - Intronic
1170494712 20:16913834-16913856 GTTGTTTTGGGGAGGGTTGAAGG - Intergenic
1170747229 20:19111071-19111093 GTGTGTGTGGGGAGGGGGGAGGG + Intergenic
1171267249 20:23781834-23781856 GGGCGTGAGAGGAGGGTTGAGGG + Intergenic
1172207801 20:33176768-33176790 GTGAGTAAGGGGAGGGTACAGGG - Intronic
1172479781 20:35264216-35264238 GTGTGGAAGGGGAGGGGTAAAGG - Intronic
1172850590 20:37960213-37960235 GTGTGTTGGGGGATGGTTTTGGG - Intergenic
1172989971 20:39028148-39028170 GTGGCTTAGGGGAGGTTGGAGGG + Intronic
1173271839 20:41543433-41543455 GTGTGTTGGGGAATGGGTGATGG - Intronic
1173656731 20:44704695-44704717 GTGTGTTAGGGGGAGGGTGGGGG - Intergenic
1173672224 20:44806575-44806597 GTGGGTTTGGGGAGGGGAGAAGG - Intronic
1173881084 20:46412710-46412732 GTGTGTGGGGGGGGGGTTGTTGG + Intronic
1174852137 20:54005880-54005902 ATGGGTTTGGGGAGGGTTTAGGG + Intronic
1176372868 21:6073139-6073161 GTGTGTTGGGGGGGGGTGGGGGG - Intergenic
1176960598 21:15154753-15154775 GTGTGTTGGGGGAGGGGAGGTGG + Intergenic
1177384303 21:20389003-20389025 GAGTTTTAGGGGAGGGGAGAAGG - Intergenic
1177408599 21:20701612-20701634 GTGTGTTCGGGGGGGGTGGGGGG - Intergenic
1178174607 21:30082049-30082071 GTGTGTTGGGGGATTGGTGAAGG - Intergenic
1178663044 21:34522722-34522744 GTGTGGTGGGGGCGGGTTGGGGG + Intronic
1179750609 21:43465104-43465126 GTGTGTTGGGGGGGGGTGGGGGG + Intergenic
1180256600 21:46634217-46634239 GTGTGTTGGGCGGGGGTTGGGGG - Intergenic
1181867433 22:25869782-25869804 GTGTGTTTAGGGTGGGCTGAGGG - Intronic
1182253165 22:29018071-29018093 GTGTGGGAGGGGAGGGCGGACGG + Intronic
1183285292 22:36958901-36958923 GTGTGTTTGTGGGGGGTTGGGGG - Intergenic
1183733838 22:39632580-39632602 GTGTGTGGGGGGAGGGTTGGGGG + Intronic
1183803193 22:40185613-40185635 GTGTGTCCAGGGAGGATTGAGGG + Intronic
1184048884 22:41989786-41989808 GAGAATTGGGGGAGGGTTGAGGG - Intronic
1184717543 22:46290522-46290544 GTGTGTTAGGGCAGCGTGGCTGG + Intronic
1185068019 22:48641635-48641657 GTGTGTGAGGGGAGGGTGTGCGG - Intronic
1185131335 22:49040809-49040831 GGGTGTCAGGGGAGGGCTGGGGG + Intergenic
949531387 3:4959252-4959274 GTGTGTCAGGGGAGAGTTGGGGG + Intergenic
949934747 3:9108051-9108073 GTGTGTTAGTGGAGGACTGTAGG + Intronic
950053211 3:10007583-10007605 GGGTGTCAGGGGAGGGTTGATGG + Intronic
950304863 3:11909898-11909920 GTGGGTCAGAAGAGGGTTGACGG + Intergenic
950416605 3:12872553-12872575 GGGGGTCTGGGGAGGGTTGATGG + Intergenic
951827969 3:26889577-26889599 GTGTGTGTGGTGAGGGTTGAGGG - Intergenic
952071068 3:29636478-29636500 ATGTGCGAGGGGAGGGTGGAAGG + Intronic
952755039 3:36858507-36858529 GAGTGGTCAGGGAGGGTTGATGG - Intronic
953871694 3:46632330-46632352 GTTTGTTAGGGGTGGGGTGGAGG - Intergenic
953876520 3:46669859-46669881 GCCTGTGAGGGGAGGGTTGAGGG - Exonic
953995436 3:47515826-47515848 GTGATTTAGGGGAGGGTTTAAGG - Intergenic
954108466 3:48421486-48421508 GGGTGTTTGGGGAGGCCTGAGGG - Intronic
954288480 3:49636389-49636411 GTGTGTATGGGGAGGGTGCAGGG + Intronic
955335013 3:58078084-58078106 GTTGGGTAGGGGAGGGCTGAAGG + Intronic
955450091 3:59057185-59057207 CTGATTTAGGGGAGGGTTTAGGG - Intergenic
957655469 3:83068116-83068138 GGGTCCTAGGCGAGGGTTGATGG + Intergenic
957803272 3:85114191-85114213 GTGTGTTAGGGGCTGGATGGGGG + Intronic
958536030 3:95404751-95404773 GGGTGGAAGGGGAGGGTTGGAGG + Intergenic
958686841 3:97408970-97408992 CTGTGTTAGGCAAGGATTGAGGG - Intronic
959105940 3:102064084-102064106 GTGTGTTTGGTGAGGGTAGGAGG - Intergenic
959113786 3:102152098-102152120 CTTTGCTAGGGGAGTGTTGAAGG - Intronic
959194448 3:103161008-103161030 GTGTTTTAAGGTATGGTTGATGG + Intergenic
959511632 3:107219529-107219551 GAGTGTTAGGGAAGGCTTGTTGG - Intergenic
959618569 3:108375328-108375350 GTGGGGTAGGGGAGGGGGGAGGG + Intronic
960403895 3:117236432-117236454 GGGTGTTGGGAGAGGGTGGAAGG - Intergenic
960483283 3:118219533-118219555 GTGTGTTGGGGGAGGGGGCAGGG + Intergenic
961145960 3:124593579-124593601 GCAGGTTAGGGGAGGGTGGAGGG - Intronic
961403182 3:126661595-126661617 GTGGGTCAGGGGAGGGTGGCTGG - Intergenic
961739288 3:129022658-129022680 GGGTGTGAGGGGAGGGTGGGTGG + Intronic
961786092 3:129347754-129347776 GGGGGTCAGGGGAGGGTTGACGG + Intergenic
961849703 3:129803337-129803359 GAGAGTGAGGGGAGGGTAGAAGG + Intronic
962473965 3:135739772-135739794 GTGTGATGGGGGAGGGGTGCTGG - Intergenic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
965871401 3:173269534-173269556 ATGTGGAAGGGGATGGTTGAAGG + Intergenic
967171037 3:186824003-186824025 TTGTGTTAGGAGAGGGCTGAAGG + Intergenic
967195538 3:187022366-187022388 GAGGGTTAGGGGAGGGCTGAGGG + Intronic
967279001 3:187804571-187804593 ATGTGTTGGGGGTGGGTTGGGGG - Intergenic
969111069 4:4844605-4844627 TTGTGGCAGGGGAGGGTTGGGGG - Intergenic
969692171 4:8709788-8709810 GTGTGGAAGGGGAGGGCTGTGGG - Intergenic
969718686 4:8881153-8881175 GTGTGTTAAGGCAGGGGTGTGGG - Intergenic
970254382 4:14152254-14152276 GTGTGTTTGGTGATGGTTGAGGG + Intergenic
970402972 4:15735558-15735580 GTGTGTGAGGGGAGCCGTGAGGG + Intronic
970714306 4:18904147-18904169 GTGTGTTAGGTGGGGGGTGGGGG - Intergenic
971412650 4:26391450-26391472 GTGTGTGGGGGGTGGGTTGAAGG - Intronic
972332737 4:38078931-38078953 CTTTGTTAGGGGAGATTTGAGGG + Intronic
973773774 4:54228078-54228100 GTGTGTTGGGGTGGGGTTGAGGG + Intronic
979002863 4:115247742-115247764 GAGACTTAGGGGAGAGTTGATGG - Intergenic
980085453 4:128385967-128385989 GTGGGTGAGGGGAGGAGTGAGGG + Intergenic
980960636 4:139471003-139471025 TGGGGTTAGGGGAGGGGTGATGG + Intronic
982120690 4:152140302-152140324 GTGAGTTGGGGGAGGGGAGAGGG + Intergenic
982739976 4:159046968-159046990 GTGTGGTAAGGCGGGGTTGATGG + Intergenic
983118706 4:163852641-163852663 GATTGTAAGGGGAGGGCTGAAGG - Intronic
983469806 4:168142313-168142335 TTGTGTTAGGGAAGGGGAGAGGG - Intronic
985054621 4:186025590-186025612 GAGTGTGAGAGGAGGGTGGATGG + Intergenic
986806301 5:11311764-11311786 GTGTGTGAGGTGAGGGTGCATGG - Intronic
987141411 5:14950765-14950787 GTGTTTTCAGGGAGGGTTTAAGG + Intergenic
987363150 5:17124680-17124702 TTGTGTTGGGGGAGGGTTTTTGG + Intronic
987529962 5:19105029-19105051 ATGTGTCAGGGGAGGTGTGACGG + Intergenic
989251297 5:39319047-39319069 CTGTGCTATGGGAGGGTTGGGGG - Intronic
991584780 5:68190810-68190832 GTGTGTGGGTGGAGGGTTGGGGG - Intronic
992272669 5:75081654-75081676 GTGTGTTTGGGGTGGGTGGTGGG + Intronic
994652556 5:102546872-102546894 GTGTGTTAGGGGCTGGGAGAGGG - Intergenic
995636669 5:114201251-114201273 GTGGGTTAGTGGAGGGATAAAGG - Intergenic
995782913 5:115796956-115796978 GTGTGTTTGTGGAGGATTGAGGG + Intergenic
996789426 5:127276868-127276890 GTGTGTTGGGGAAGGGGTGATGG + Intergenic
997087981 5:130823600-130823622 GTGGGTTGGGGGAGGGGGGAGGG + Intergenic
997270731 5:132535599-132535621 GGGTGTTGAGGGAGGGTTGTGGG - Intergenic
997597851 5:135119067-135119089 AGGTGTTAGGGCAGGGCTGAGGG + Intronic
997909076 5:137850942-137850964 GTATGTGAGATGAGGGTTGAGGG - Intergenic
999030881 5:148289919-148289941 GTGTGTTGGGGGAGGGGGGAGGG - Intergenic
999143453 5:149377797-149377819 GTGTGGGAGGGGTGGGTTGGGGG + Intronic
999387932 5:151168534-151168556 GTGTGTTGGGAGGGGGCTGATGG + Intergenic
1001292982 5:170477997-170478019 AGGTGTCAGGGGAGGGTTCATGG + Intronic
1001930852 5:175672054-175672076 GTGTGTGTGTGGAGGGGTGAAGG - Intronic
1002466748 5:179412211-179412233 GTCGGTTGGGGGAGGGTGGAAGG - Intergenic
1002466898 5:179412554-179412576 GTCGGTTGGGGGAGGGTGGAAGG - Intergenic
1003186393 6:3835143-3835165 TTGTGTTAGGGCAGGGTGGAAGG + Intergenic
1003874441 6:10423629-10423651 GTGTGTTGGGGGAGGGGGGATGG + Intergenic
1005282135 6:24285349-24285371 GTGTGTCAGGGGAGGCCTCATGG - Intronic
1005341193 6:24845340-24845362 ATCTTTTAGGGGAGGGATGAAGG + Intronic
1005472122 6:26171899-26171921 GCGTTTTTGGCGAGGGTTGATGG - Intergenic
1006298623 6:33181298-33181320 GAGTTTTAGGGGAGGGCTGTGGG - Intronic
1006507515 6:34498976-34498998 CAGGGTTAGGGGAGGGTTGGGGG + Intronic
1006718047 6:36132516-36132538 GTGTATTAGGAAAGGGTGGATGG + Intronic
1007224418 6:40302863-40302885 CTGTGTGAGGGGAGGGCTGGTGG + Intergenic
1007732322 6:43954699-43954721 GTGGGGTGGGGGAGGGTGGAGGG - Intergenic
1008623993 6:53300132-53300154 GTGTGGTAGGGGAGAGTTTGGGG - Intronic
1009425339 6:63507325-63507347 GTGAGTTAAGGGAGGGTTATTGG + Intergenic
1009857970 6:69288962-69288984 TTGGGTTGGGGGAGGGTTGGGGG - Intronic
1010053172 6:71532161-71532183 GCGTGGGAGGGGAGGGTTGCTGG + Intergenic
1010364942 6:75040240-75040262 GTGTGTTTGTGGGGGGATGAAGG - Intergenic
1010830610 6:80523798-80523820 GTGTGATAGGGGCGGATTAACGG - Intergenic
1010977588 6:82333241-82333263 GTGTGGCAGTGGAGGGGTGAGGG - Intergenic
1011203986 6:84871943-84871965 GTGTGTGTGCGGAGGGTGGAGGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013647147 6:112156233-112156255 GTGTGAAAGGGCAGGGGTGAGGG - Intronic
1014040800 6:116822710-116822732 GTGGGTTGGGGGAGGGGGGAGGG + Intronic
1015592368 6:134834073-134834095 GTGGGTTAGGGGAGGGAGGGAGG + Intergenic
1015755025 6:136598171-136598193 GTGTGTTAAGGGAGGCTTGCTGG - Intronic
1016831407 6:148436892-148436914 GTATGTTAGGGGAGGAGAGAAGG + Intronic
1017227096 6:152034140-152034162 GTGTGGTTGGGGAGGGGGGAGGG + Intronic
1017286264 6:152680157-152680179 GTGTGTGAGGGGAGGGGAGATGG - Intergenic
1017301619 6:152867593-152867615 GTATGTGAGGTGAGGGTGGATGG - Intergenic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1017720593 6:157240828-157240850 GTGTTTTGGGGGAGGGCTGATGG + Intergenic
1018466148 6:164047479-164047501 CTCTGTTAGGGTAGGGTGGAAGG + Intergenic
1018526707 6:164718791-164718813 GCCTGTCAGGGGAGGGTTGCGGG + Intergenic
1019323597 7:426469-426491 GAGTGTTGGTGGAGGGTGGAGGG - Intergenic
1019353876 7:568955-568977 CTCTGGGAGGGGAGGGTTGAGGG + Intronic
1019401886 7:859487-859509 GTGTGTGTGGGGAGGAGTGAGGG + Intronic
1019853941 7:3585693-3585715 GTTTGGTAGGGGAGGGAAGAAGG + Intronic
1022607209 7:31827266-31827288 GTGAGCTAGGGGTGGGTAGAAGG - Intronic
1024987967 7:55212284-55212306 GTGTGGCAGGGGAGGGTTCTAGG + Intronic
1025274873 7:57571278-57571300 GTGTGTTATGGAAGGGCTGGAGG - Intergenic
1026189628 7:68112961-68112983 GTGTGGTGTGGGAGGGTTGAAGG + Intergenic
1027988658 7:85329858-85329880 GTGGGTGGGGGGAGGGTGGAGGG - Intergenic
1028239761 7:88405238-88405260 GTGTGTTTGGGGAGAGTTGGGGG - Intergenic
1028539693 7:91928161-91928183 GTATGCTAGGGGAGAGCTGAAGG + Intergenic
1028713181 7:93934394-93934416 TTGAGTTAGGGGTGGGTGGAAGG - Intergenic
1029126026 7:98295750-98295772 GTGTGCTTGGGGTGGGTGGAGGG - Intronic
1029162661 7:98563587-98563609 ATGTGTTGGGGGAGGGGTGGTGG + Intergenic
1029418864 7:100461618-100461640 GGTTGTTAGGGGAAGGTGGAGGG - Intronic
1029471719 7:100758780-100758802 TTCTGTAAGGTGAGGGTTGAAGG + Intronic
1029863820 7:103603774-103603796 GTGTGTTTGTGGGGGGCTGAGGG + Intronic
1030721438 7:112875607-112875629 GTGTGATAGGGAAAGGTTAAGGG - Intronic
1032219135 7:129980789-129980811 CTGAGTTAGGGGTGGCTTGATGG - Intergenic
1032311586 7:130792421-130792443 GTCTGTGGGGAGAGGGTTGAGGG - Intergenic
1032496824 7:132368979-132369001 CTGAATTAGGGGAGGGTGGATGG - Intronic
1033061780 7:138116396-138116418 GTGTGTTGAGGGAAGGTTGGTGG - Intronic
1033671089 7:143493926-143493948 GTGTGTGGGAGGAGGGGTGAAGG - Intergenic
1033921322 7:146396073-146396095 ATGTGTCAGGGCAGGGATGAAGG - Intronic
1034195136 7:149240377-149240399 GGGTGTTGGGGGGGGGGTGAAGG - Intronic
1035288043 7:157818876-157818898 GTGTGTTGGGCGAGGGCTGCTGG - Intronic
1037671238 8:21016980-21017002 AGGTGTCAGGAGAGGGTTGACGG + Intergenic
1037681577 8:21102046-21102068 GTGTGTTAGGGTGGGGTTTATGG + Intergenic
1037808237 8:22070103-22070125 GTGTGAGGGGGGAGGGGTGAAGG + Intronic
1039477192 8:37845381-37845403 GCTTGTTAGGGGAAGGTGGAGGG + Intronic
1040791665 8:51237681-51237703 GTGTGTTTGGGTGGGGTTGGGGG - Intergenic
1041829194 8:62133641-62133663 GTGGGGTGGGGGAGGGGTGAGGG - Intergenic
1042253717 8:66781938-66781960 ATGTGTGAGGGGAGGGGAGAAGG + Intronic
1042864507 8:73345517-73345539 ATGTGTTAGGGGTGGGAGGAGGG - Intergenic
1042949325 8:74184860-74184882 GTGTATTAGGGGTGGGGTGCAGG - Intergenic
1043511608 8:80955526-80955548 GTGGGGTAGGGGAGGGGGGAGGG + Intergenic
1043694569 8:83203131-83203153 GTGTGTTGGGGGAGCGGTTATGG - Intergenic
1045717236 8:105062404-105062426 GTGTGTGGGGGCAGGGTTGGGGG - Intronic
1045797445 8:106062457-106062479 GTGTGGCTGGGGAGGATTGAGGG + Intergenic
1045947794 8:107816449-107816471 GTGGGGTAGGGGAGGGGGGAGGG - Intergenic
1047235549 8:123039231-123039253 GTGTGTATGGAGGGGGTTGAAGG - Intronic
1047597757 8:126395742-126395764 GTGTGTTGGGGGTGGGGTGTGGG - Intergenic
1047668250 8:127116192-127116214 GTGTGTTTGGAGAAGGCTGAGGG + Intergenic
1048294366 8:133203359-133203381 GTGTGTGATGGGCGGGTGGAGGG + Intronic
1048307880 8:133296467-133296489 GTGTGTGGGGGGAGGGTCCAGGG - Intronic
1049351670 8:142167910-142167932 GTGCGTTGGGGGAGGATTAAGGG - Intergenic
1050070973 9:1813834-1813856 GTGTTTTAGGGGATGGGTAAGGG - Intergenic
1051479955 9:17548968-17548990 GTCTGTTAGGGGAGGGGTCAGGG + Intergenic
1051718076 9:20006331-20006353 GTGGGTGAGGGGAGGGGGGATGG + Intergenic
1052183009 9:25553881-25553903 TTGTCCTAGTGGAGGGTTGAAGG + Intergenic
1052399028 9:27977399-27977421 GTGTGTCGGGGGCGGGTTGGGGG + Intronic
1052438388 9:28460815-28460837 GTGTGTGGGGGGAGGGGTGGAGG + Intronic
1052710352 9:32047930-32047952 GTGGGTTGGAAGAGGGTTGAGGG + Intergenic
1053858358 9:42359988-42360010 GTGAGAGAGGGGAGGGTTAAGGG + Intergenic
1054810932 9:69433302-69433324 GTGTGTGAGGTAAGGGTGGAGGG - Intronic
1055152583 9:73020465-73020487 CTGAGTTAGGGGATGGTTGAAGG + Intronic
1055408997 9:76007557-76007579 GGGTGTGAGAGGAGGGTAGATGG + Intronic
1055500728 9:76900072-76900094 GTGGGTTAGGGAAGAGATGAAGG + Intronic
1055575081 9:77652809-77652831 GTTTGGTAGGTGAGAGTTGATGG + Intergenic
1056868641 9:90255365-90255387 GTGCTTTAGGGCAGGGTTTATGG - Intergenic
1057273861 9:93665878-93665900 GGGTGTTGGGGGAGGGGTGTGGG + Intronic
1057388844 9:94626541-94626563 GTGTGACGGGGGAGGCTTGATGG - Intronic
1057588810 9:96353752-96353774 GGGTGTTAGGAGTGGGTAGAAGG - Intronic
1057869566 9:98708167-98708189 GTGTGTGTGGGGAGGGGTGGGGG - Intronic
1058299267 9:103349730-103349752 GTGTGGTGGGGTGGGGTTGAGGG - Intergenic
1058653407 9:107198031-107198053 TTGTGTTAGGGGAGAGTTCAAGG - Intergenic
1058840516 9:108903218-108903240 GTGGGGTGGGGGAGGGTGGAGGG - Intronic
1058844178 9:108939385-108939407 TTGTGTTAGAGGACGTTTGATGG + Exonic
1059400606 9:114067864-114067886 GTGTTTTTGAGGAGGGTTCATGG - Intronic
1059705457 9:116819211-116819233 GTGTGTTTGGGGTGGGGTGGGGG - Intronic
1059709150 9:116851319-116851341 GTGTGTTGGGGGAGGGCTTATGG + Intronic
1060066937 9:120510534-120510556 GTGTGTTTGGTGAAGGGTGAGGG - Intronic
1060912445 9:127361871-127361893 GTGTGTTTGGGGTGGGGTGAGGG - Intronic
1061433221 9:130544404-130544426 GTGTGTTTGGGGAGTGTTTAAGG + Intergenic
1061507995 9:131042916-131042938 GTGTGAAAGGGGAGAGTTGATGG - Intronic
1061541292 9:131278910-131278932 GTGTGTGAGGGCAGGGCTGGAGG + Intergenic
1062621446 9:137424048-137424070 GTGGGCTGGGGGAGGGCTGAGGG - Intronic
1203492345 Un_GL000224v1:118994-119016 GTGGGGAAGGGGAGGGATGAGGG + Intergenic
1203504968 Un_KI270741v1:60866-60888 GTGGGGAAGGGGAGGGATGAGGG + Intergenic
1185749201 X:2597161-2597183 TTGTGTTTGGGGAGGGTGGGCGG + Intergenic
1186477350 X:9867831-9867853 GTGTGGTGGGGGAAGGCTGATGG + Intronic
1186612313 X:11149457-11149479 GTGTGTTGGGGGAGGGGGGCAGG + Intronic
1186844950 X:13521528-13521550 GTGATTTAGGGGAGGGTTTAAGG + Intergenic
1189192533 X:39122915-39122937 GTGTGTTGGGGATGGGATGATGG - Intergenic
1190732364 X:53234344-53234366 GGGTGTGAGGGGAGGGTGGGGGG + Exonic
1192531318 X:71889159-71889181 TGGTGTTGGGGGAGGGTGGAGGG + Intergenic
1192827931 X:74717925-74717947 GTGGGTTGGGGGAGGGGTAAGGG + Intergenic
1193259853 X:79392528-79392550 GTGGGGTGGGGGAGGGGTGACGG + Intergenic
1193505179 X:82333868-82333890 GGGTGTTAGGGGAGTAATGATGG + Intergenic
1194517112 X:94868237-94868259 GTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1195162530 X:102184564-102184586 GTGAGTTGGGGGAGGGAGGAGGG + Intergenic
1195339373 X:103891259-103891281 GTGTGGTGGGGGAGGGTGGAGGG - Intergenic
1195596475 X:106696935-106696957 GTGTTTTGGGGGAGAGTTGAAGG + Intronic
1195655477 X:107327833-107327855 GTGTGTTAGGGATGGGAGGATGG + Intergenic
1195679288 X:107531719-107531741 GTGTGGTAGCAGAGGGTGGAGGG - Intronic
1196189156 X:112777124-112777146 GGGTGTTAGGTAAGGGTTGGGGG - Exonic
1196196895 X:112846278-112846300 GTGTGGTTGGGAAGGGTGGAAGG - Intergenic
1196441147 X:115721337-115721359 GAGAGTTGGGGGAGGGTTTAAGG - Intergenic
1196444675 X:115839325-115839347 GAGAGTTGGGGGAGGGTTTAAGG - Intergenic
1197115202 X:122823828-122823850 GTCTGTTGGGGGTGGGTGGAAGG + Intergenic
1197853386 X:130888992-130889014 GTGTGTTGGGGGAGGATTCAAGG + Intronic
1198094348 X:133363827-133363849 GTGTGTTGGGGAAGGGTTGGAGG - Intronic
1199096597 X:143749190-143749212 GTGTGTGTGGGGGAGGTTGAAGG - Intergenic
1199435099 X:147804248-147804270 GTGAGTGAGGGGTGGGTGGAAGG + Intergenic
1201651294 Y:16290570-16290592 GTGGGTTGGGGGAGGGGGGAGGG - Intergenic
1201721065 Y:17097926-17097948 GTGTGGTGGGGGAGGGGGGAGGG - Intergenic