ID: 1127670265

View in Genome Browser
Species Human (GRCh38)
Location 15:61188116-61188138
Sequence AAGCCCAGACAGCTTGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 220}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127670265_1127670278 28 Left 1127670265 15:61188116-61188138 CCAACCCCAAGCTGTCTGGGCTT 0: 1
1: 0
2: 3
3: 24
4: 220
Right 1127670278 15:61188167-61188189 CAGGGCCACCTTCCTCTAGATGG 0: 1
1: 0
2: 0
3: 21
4: 146
1127670265_1127670279 29 Left 1127670265 15:61188116-61188138 CCAACCCCAAGCTGTCTGGGCTT 0: 1
1: 0
2: 3
3: 24
4: 220
Right 1127670279 15:61188168-61188190 AGGGCCACCTTCCTCTAGATGGG 0: 1
1: 0
2: 0
3: 9
4: 96
1127670265_1127670271 10 Left 1127670265 15:61188116-61188138 CCAACCCCAAGCTGTCTGGGCTT 0: 1
1: 0
2: 3
3: 24
4: 220
Right 1127670271 15:61188149-61188171 TCCCCACCCGACACACCTCAGGG 0: 1
1: 0
2: 1
3: 20
4: 148
1127670265_1127670270 9 Left 1127670265 15:61188116-61188138 CCAACCCCAAGCTGTCTGGGCTT 0: 1
1: 0
2: 3
3: 24
4: 220
Right 1127670270 15:61188148-61188170 TTCCCCACCCGACACACCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127670265 Original CRISPR AAGCCCAGACAGCTTGGGGT TGG (reversed) Intronic
900012817 1:131405-131427 AACCCCACACACTTTGGGGTTGG + Intergenic
901532529 1:9862601-9862623 AAGGCATGACAGCTTGGGGTCGG - Intronic
901808142 1:11750543-11750565 AAGCCCAGCAAACTTGGGGGAGG - Exonic
903019910 1:20386723-20386745 AGGCACAGACAGCATGGGCTGGG + Intergenic
903207801 1:21795959-21795981 AAGCCTAGGCAGATAGGGGTGGG - Intergenic
903646201 1:24897691-24897713 CAGCCCCCACAGCTTGAGGTTGG - Intergenic
903736467 1:25532827-25532849 AAGCCCAGACTGCTGGGGAGTGG + Intergenic
904449348 1:30600967-30600989 ATGCCTAGGCAGCTAGGGGTGGG + Intergenic
905187664 1:36208196-36208218 AAGCTCAGAGAGCGTGGGGGAGG - Intergenic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
906685707 1:47761773-47761795 ATCCCCAGACAGCTTTGGCTTGG + Exonic
907243035 1:53091099-53091121 AAGCCCAGACAGCCTGGCCCAGG - Intronic
907469685 1:54665254-54665276 CAGCACAGTCAGCTAGGGGTTGG - Intronic
908392617 1:63697334-63697356 AAGTCCAGACAACGTAGGGTTGG + Intergenic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
911563138 1:99430882-99430904 CAACCCAGATAGCCTGGGGTTGG - Intergenic
914952485 1:152128896-152128918 GAGCCCAGAGAAATTGGGGTAGG - Intergenic
915520267 1:156437707-156437729 AAGGCCAGACAGCTTGGTGGAGG + Intergenic
916782970 1:168056316-168056338 AGGCCCTGGCAGCTGGGGGTGGG - Intronic
920362844 1:205431044-205431066 GAGCCCAGCGAGCTTGGGGGTGG + Intronic
920787007 1:209051321-209051343 GAGCCCAGAGGGCTTGGTGTGGG + Intergenic
922064493 1:222123978-222124000 AAGGCCAGACAGATGGGAGTAGG + Intergenic
922702674 1:227771013-227771035 GAGCCCAGTCACCTTGGGGGTGG - Intronic
922724371 1:227915587-227915609 GAGCCCAGACAGACTGTGGTGGG - Intergenic
922814896 1:228441586-228441608 AAGCCCAGGCACTTTGGGGGAGG + Intergenic
923889003 1:238190368-238190390 AAGCCCAGACAGTATTGGGTTGG + Intergenic
1063714539 10:8514070-8514092 CAGCTCAGACACCTTGGTGTTGG + Intergenic
1068044707 10:51871541-51871563 CAGCACTGACAGCTTGGGGCTGG - Intronic
1068049243 10:51928154-51928176 AGGGCCAGAAAGCTTGAGGTGGG + Intronic
1069633554 10:69912135-69912157 AAGCCCAGAGTGCTCAGGGTGGG - Intronic
1069851153 10:71405797-71405819 AAGCACAGACAGGATGGGTTTGG - Intronic
1072010749 10:91301057-91301079 AAGGCCTGAGAACTTGGGGTGGG + Intergenic
1072461959 10:95627506-95627528 GTGCCCAGACACCTTTGGGTGGG + Exonic
1074676120 10:115853140-115853162 AAGTCATGACAGTTTGGGGTGGG + Intronic
1075091609 10:119446957-119446979 AGGAGCAGACTGCTTGGGGTAGG - Intronic
1076179158 10:128392627-128392649 AAGCCCAGACTACTGGTGGTGGG - Intergenic
1077275658 11:1706299-1706321 AATCCCAGGCAGATGGGGGTGGG + Intergenic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1078735291 11:14014102-14014124 AAGCCAAGGCAGTTTGGGCTGGG - Intronic
1079599621 11:22295145-22295167 AAGCCCAAACAGAGTGAGGTTGG + Intergenic
1081819974 11:45983222-45983244 AAGCCGTGGAAGCTTGGGGTGGG + Intronic
1082784361 11:57308791-57308813 GAGTCCAAAGAGCTTGGGGTGGG - Exonic
1083657978 11:64239067-64239089 GTGGCCAGAGAGCTTGGGGTAGG + Intergenic
1083659467 11:64245527-64245549 AAGGCCAGACAGCCAGGGTTGGG + Intronic
1086493291 11:87377291-87377313 AAGCCCAGGCAGCTGAGGGAGGG + Intergenic
1087614374 11:100471343-100471365 AACCCCACACACCATGGGGTAGG - Intergenic
1090712939 11:129404226-129404248 AACCCCAGTCAGCTTGGAGAGGG + Intronic
1091652572 12:2320802-2320824 AGGCCAAGGCAGCTAGGGGTAGG + Intronic
1092048715 12:5452645-5452667 AAGCCCTGACAGCTCTGAGTGGG + Intronic
1093567906 12:20630199-20630221 CAGCCCACGCAGCTTGGGGTAGG + Intronic
1094661074 12:32471143-32471165 AAGACCTGAGAGCTTGGTGTGGG - Intronic
1097057249 12:56257632-56257654 AAGCCCAGATCACTTGGGCTGGG - Intronic
1101233276 12:102763723-102763745 AGGCTCAGACAGCTTGGAGTGGG + Intergenic
1102166080 12:110807870-110807892 AAGCCCAGGCAGCCTGCTGTGGG + Intergenic
1104338959 12:127929611-127929633 ATGCCCAGACAGACAGGGGTGGG + Intergenic
1104965253 12:132506049-132506071 GAGAACAGACAGCATGGGGTGGG - Intronic
1106481111 13:30137541-30137563 AAGCCCTGACATCATGTGGTGGG - Intergenic
1108033422 13:46261078-46261100 AAGCCCTGACTCCTAGGGGTTGG - Intronic
1110554042 13:76838491-76838513 AAGAGCAGACAGCTTGGGTGTGG + Intergenic
1113088532 13:106593145-106593167 AAGCACAGAGAGCCTGGGGCAGG - Intergenic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116090349 14:40296278-40296300 AAGCCCAGAAAGTTTTGTGTAGG - Intergenic
1118709031 14:68504595-68504617 AAGCTCAGACAGCTAGAGATGGG + Intronic
1119199514 14:72742334-72742356 AAGCACTGACAGATGGGGGTGGG + Intronic
1120443113 14:84562947-84562969 AACCCCAGAGATCCTGGGGTTGG + Intergenic
1121126590 14:91411297-91411319 AAGCCCAGTGAGCTTTGGCTGGG - Intronic
1121857424 14:97282938-97282960 AAGCCCAGAGAGGTTGAGGCAGG + Intergenic
1122023694 14:98859450-98859472 AAGCTCCCACAGCTTGGGGCTGG - Intergenic
1122935863 14:104955847-104955869 AAGTCCTGGCAGGTTGGGGTGGG - Intronic
1123053815 14:105560057-105560079 AGGCCCAGACAGCCCAGGGTGGG + Intergenic
1123078398 14:105680474-105680496 AGGCCCAGACAGCCCAGGGTGGG + Intergenic
1123457134 15:20436436-20436458 CAGCACAGAGAGCATGGGGTGGG + Intergenic
1123660928 15:22563923-22563945 CAGCACAGAGAGCATGGGGTGGG - Intergenic
1123786872 15:23683408-23683430 AAGCCCAGACTGCTGTGGGTGGG - Intergenic
1124263288 15:28211589-28211611 CAGCACAGAGAGCATGGGGTGGG + Intronic
1124314729 15:28658157-28658179 CAGCACAGAGAGCATGGGGTGGG - Intergenic
1125149721 15:36518003-36518025 AATCCCACACAGCTTGCAGTAGG + Intergenic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1125919923 15:43519283-43519305 AACCCCATACAGCGTGGGTTGGG - Intronic
1125956242 15:43792821-43792843 AGGCCCAGGCTGCTTGGGGTAGG - Intronic
1126795188 15:52254558-52254580 CAGCACAGAAAGCTTTGGGTAGG - Intronic
1126832661 15:52624286-52624308 CAGTCCAGAAAGCTTTGGGTTGG - Intronic
1127670265 15:61188116-61188138 AAGCCCAGACAGCTTGGGGTTGG - Intronic
1128815131 15:70602562-70602584 GAGCCCAGTCAGCTGTGGGTTGG + Intergenic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129873465 15:78956680-78956702 AAGTCTAGACATCTTGGGGAGGG + Intergenic
1133650204 16:7805603-7805625 AAGCCGAGACAGCTTTGGGTTGG - Intergenic
1135545005 16:23359704-23359726 AAGTCCAGGCAGTTTGGTGTTGG - Intronic
1135859631 16:26044084-26044106 GAGACCAGACAGCCTGGGTTGGG - Intronic
1136300410 16:29330242-29330264 AGGCACAGACAGGTTGGGGCTGG + Intergenic
1138710978 16:58970122-58970144 ATGCCTAGACAGATAGGGGTGGG - Intergenic
1139099059 16:63743876-63743898 GAGCCCAGAGAGTTTGGTGTAGG + Intergenic
1139483254 16:67242388-67242410 CAGGACAGACAGCTGGGGGTGGG - Intronic
1141086012 16:81096172-81096194 AGGCCCTGGCAGCTGGGGGTGGG - Exonic
1141102779 16:81210219-81210241 CAGCCCTGACACCTTGGTGTCGG - Intergenic
1141820069 16:86439608-86439630 AAGCCAAGACAGGTGAGGGTGGG - Intergenic
1141850287 16:86640458-86640480 CAGCCCAGACAGCAGGGGGTTGG + Intergenic
1143141009 17:4741776-4741798 AAGCCCCGACAGCTTACTGTGGG + Exonic
1144395490 17:14838883-14838905 CAGACCAGACAGGTTGGGGAAGG + Intergenic
1146462370 17:33056402-33056424 AACCCCTGACAGTTTGGGGTTGG + Intronic
1152287606 17:79421890-79421912 AGGACCGGGCAGCTTGGGGTGGG - Intronic
1152320927 17:79608596-79608618 AAGCCGAGACAGCCTGGGCCTGG - Intergenic
1152800698 17:82329478-82329500 CAGCCCTGACAGGGTGGGGTGGG - Intronic
1153819661 18:8822584-8822606 AAACCCAGGCAGTTTGGGCTGGG - Intronic
1155491517 18:26405757-26405779 ATGCCTAGAAAGCTTGGGGCAGG - Intergenic
1155774221 18:29738108-29738130 GAGCCCAGAGGGCTTGGAGTGGG - Intergenic
1156988974 18:43383153-43383175 AAGCCCAGATGGCTTGGCTTGGG - Intergenic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1158332646 18:56379951-56379973 AAGGCCGGACAGCTTAGGTTAGG + Intergenic
1158889293 18:61858404-61858426 AGGTCCAGAGAGCTTGGGGGAGG - Intronic
1160508925 18:79442539-79442561 AAGCCCAGACACCTTGGAGCCGG + Intronic
1163725826 19:18922523-18922545 CAGCCCAGACAGCGTGGGGAGGG + Intronic
1163747900 19:19058969-19058991 ACCCCCAGAATGCTTGGGGTGGG - Intronic
1163839028 19:19594433-19594455 AAGCCTAGGCAGATGGGGGTAGG + Intronic
1165638498 19:37364060-37364082 ATGCCCAGGCAGATAGGGGTGGG + Exonic
1165828706 19:38719961-38719983 ATGCCCAGTCAGGTAGGGGTGGG - Intronic
1166985767 19:46659468-46659490 AAGCCGAGCCAGCTTGGGGTGGG + Intronic
1167119271 19:47507112-47507134 AAGCAGAGGCAGCTTGGGGGAGG - Intronic
1167435966 19:49478909-49478931 AAGCGAAGACAGCTGGGGGGGGG - Exonic
925885756 2:8392588-8392610 ACCCCAAGACAGCGTGGGGTGGG + Intergenic
926332021 2:11833393-11833415 AAGCACAGAGAGCTTGGTATGGG - Intergenic
931375739 2:61706296-61706318 AAGCCCAGAGAGGTAGTGGTTGG - Intergenic
931951217 2:67364455-67364477 GAACCCAGACATCTTTGGGTTGG - Intergenic
932360366 2:71100374-71100396 ATGCCCAGAGAGCTGGAGGTTGG - Intergenic
933996991 2:87677361-87677383 AAGCCCACAGGCCTTGGGGTTGG + Intergenic
936082746 2:109446089-109446111 AGTCCCAGCCAGCTCGGGGTTGG + Intronic
936296860 2:111273549-111273571 AAGCCCACAGGCCTTGGGGTTGG - Intergenic
937487698 2:122332939-122332961 AAGCCCACACAGCTAGGAATTGG + Intergenic
939223812 2:139339613-139339635 AAGCCCAGTCATTTTGGGGGTGG + Intergenic
941747354 2:169101141-169101163 AAGCCCAGGCAGCTTGATGTTGG + Intergenic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
942563460 2:177244508-177244530 AAGCCCAGGCAGCATGGAGGAGG + Intronic
943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG + Intergenic
943830318 2:192452686-192452708 GAGCCCAGACAGTTTTGTGTGGG + Intergenic
945084337 2:206116394-206116416 AGGCCCTGGCAGCTTGGGATGGG - Intronic
946289557 2:218733771-218733793 AAGCCAAGCCAGCTGGGTGTTGG + Intronic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
947564566 2:231185752-231185774 AGGCCTAGACAGCTTGGATTCGG + Intergenic
947614299 2:231545270-231545292 AAGCCCAGAAAGCATGGTGAGGG - Intergenic
1168799707 20:636338-636360 AAGACCAGCCTTCTTGGGGTGGG - Intergenic
1168902136 20:1373947-1373969 AAACCCAGACACCTGGGAGTGGG + Intronic
1169927646 20:10799515-10799537 AATCCCAGGCATCTTGGGTTTGG + Intergenic
1170207780 20:13817924-13817946 AAGCTCAGACAGCTTAGGATAGG + Exonic
1171312314 20:24154511-24154533 AAGCCCAGGGAGCTTGTGGCAGG + Intergenic
1176524927 21:7858798-7858820 ATTCCCAGGCAGATTGGGGTGGG - Intergenic
1177646866 21:23909758-23909780 AAGTGCAGAAAGCTAGGGGTGGG + Intergenic
1177701057 21:24639934-24639956 AATTCCACACAGCTTGGGGTTGG + Intergenic
1178413098 21:32382116-32382138 GAGCCCAGACAGCGTGGGAAAGG - Intronic
1178658947 21:34488811-34488833 ATTCCCAGGCAGATTGGGGTGGG - Intergenic
1182428938 22:30289163-30289185 AAGCGCAAACAGCCTGGGATGGG - Intronic
1182619616 22:31611704-31611726 CAGCCTAGACAGCCTGGGGTGGG - Intronic
1182622319 22:31624922-31624944 AGGCACAGACAGGGTGGGGTGGG - Intronic
1183969832 22:41468567-41468589 CTGCCCAGACAGCCAGGGGTAGG + Intronic
1184302413 22:43569455-43569477 AAGCCCAGGCACCTTGGCATGGG - Intronic
1184890483 22:47376096-47376118 AAGCCCAGGCTGCTCGGGCTGGG - Intergenic
949095145 3:76988-77010 AAGCCAAGAAACCTTGAGGTAGG - Intergenic
949696856 3:6707490-6707512 AAGAGAAGACAGCATGGGGTTGG - Intergenic
951187468 3:19730445-19730467 CAGCCCAGACAGTTTTGGTTTGG + Intergenic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
957820144 3:85362080-85362102 AAGCCCATACAACTTTGGTTTGG + Intronic
957966175 3:87324309-87324331 CAGCTCATACAGCTTGGTGTTGG - Intergenic
960700453 3:120434297-120434319 AAGCCCAGCCAGTTCTGGGTAGG + Intronic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
962833268 3:139162634-139162656 AAGGCTAGACAGCTTGAGGCAGG + Intronic
963042045 3:141077229-141077251 AAGCCGAGACAGCGTGAGCTTGG + Intronic
965179830 3:165388264-165388286 TAGCCCACACAGCCTGGTGTTGG - Intergenic
967106966 3:186261845-186261867 AAGCCAAGACAGCTTCGGAGAGG + Intronic
967672965 3:192260978-192261000 AGGCCAAGACAGATGGGGGTAGG + Intronic
970716373 4:18930502-18930524 AACCCCAGATGGCCTGGGGTTGG + Intergenic
971317927 4:25582905-25582927 AAGGCCACACAGCTTGTGATGGG + Intergenic
973042297 4:45485381-45485403 GAGCCCAGACAGATTGTTGTTGG - Intergenic
973843063 4:54882099-54882121 AAGACCAGAGAGCTTGAGGGAGG - Intergenic
973947959 4:55979501-55979523 AAGCTGAGACAGTTGGGGGTTGG + Intronic
974073720 4:57149299-57149321 AAGTACATACAGCCTGGGGTAGG + Intergenic
974279650 4:59775957-59775979 AAGCCAAGACAGTTTGGCTTCGG + Intergenic
979156694 4:117401383-117401405 AAGCCCAGACGGTTTGGTGTGGG + Intergenic
981478796 4:145214442-145214464 ATGCCCAGGCAGATAGGGGTGGG - Intergenic
985544897 5:504607-504629 GAGCCCAGAGGGCTCGGGGTGGG + Intronic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
990905987 5:60803624-60803646 AAACACAGACAGCATAGGGTTGG + Intronic
992185007 5:74235461-74235483 AAGCACAGAGAGTTGGGGGTTGG - Intergenic
993504310 5:88692341-88692363 GAGCACAGCCCGCTTGGGGTTGG + Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
997021467 5:130007675-130007697 AAGCCCAGAGAGTTTGGTGTGGG + Intronic
999085612 5:148886173-148886195 AAGCCCAGGCAGCATGTGGACGG + Intergenic
1000569579 5:162895516-162895538 AAGCCCAGAAAGTTTGGTGTGGG + Intergenic
1002081846 5:176742079-176742101 AAGCCCAGACAGTCTGGGGTAGG - Intergenic
1002705607 5:181159510-181159532 AAGCACAGACAGCATGGGGCAGG + Intergenic
1003500282 6:6697417-6697439 GGGCCCAGACTGCTTGGGGCTGG - Intergenic
1003651190 6:7961767-7961789 GAGCCCTAACAGCGTGGGGTGGG - Intronic
1005026322 6:21466168-21466190 AAGTACAGACAGCTTGGGAGGGG - Intergenic
1006519043 6:34561011-34561033 AAGGCTGGACAGCTTGGGGGAGG + Intergenic
1007323818 6:41045361-41045383 AGGCCCAGACACCTTGCAGTAGG + Intronic
1008716563 6:54295977-54295999 AAGCCCAGAATGTTTGGTGTGGG - Intergenic
1013665350 6:112342050-112342072 AAGATCACACAGCTTGGGGGTGG + Intergenic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1018425563 6:163677345-163677367 ATGCCCACTCAGCTTGGGGGTGG - Intergenic
1019378662 7:710318-710340 ATACGCAGACAGCCTGGGGTGGG + Intronic
1020430376 7:8111795-8111817 AGGCCCAGAGAGCTTGGTGGGGG - Intergenic
1020607855 7:10360546-10360568 GAGCCCAGAAAGTTTGGGATGGG - Intergenic
1023223718 7:37947766-37947788 AAGCTGAGACATCTTGGTGTTGG - Intronic
1023289658 7:38656239-38656261 CAGCTCAGACAGCTTGGCTTTGG - Intergenic
1023369597 7:39499805-39499827 AAGGCCAGATAACTTGGTGTTGG - Intergenic
1025829281 7:65035923-65035945 GAGCCCAGAGGGCTTGGGGCAGG - Intergenic
1025916499 7:65870876-65870898 GAGCCCAGAGGGCTTGGGGCAGG - Intergenic
1026417196 7:70194658-70194680 AACCCCTGACTGCTTGGGATGGG - Intronic
1026610872 7:71858751-71858773 AAGGCAAGACAACTTGAGGTGGG - Intronic
1028918633 7:96287209-96287231 AAGCCAAGGCAGATTTGGGTTGG + Intronic
1028961530 7:96754446-96754468 AAGGCCTGAGAGCCTGGGGTGGG - Intergenic
1029453957 7:100657902-100657924 CAGCTCTGACAACTTGGGGTAGG + Intergenic
1029536213 7:101159356-101159378 AAGCCCTGACCCCATGGGGTGGG + Intronic
1029580891 7:101436065-101436087 AGGCCCCCACTGCTTGGGGTGGG - Intronic
1030267530 7:107635571-107635593 CAGCTCAGACAACTTTGGGTGGG + Intergenic
1035625335 8:1066973-1066995 GGGCCCAGGCAGCTTGGGCTGGG - Intergenic
1037195364 8:16182066-16182088 TAGACCACACAGCCTGGGGTGGG - Intronic
1038222518 8:25624241-25624263 AAGCCCAGACATCTCTGTGTAGG - Intergenic
1039450384 8:37669342-37669364 ATGCCCACACAGATTGGGGAAGG - Intergenic
1040466983 8:47704546-47704568 AAGCTCAGTCAGCATGTGGTTGG - Intronic
1044026959 8:87184477-87184499 AAGCCCAGAGGGTTTGGCGTGGG - Intronic
1044132983 8:88549375-88549397 ATGCCTAGACAGATAGGGGTTGG - Intergenic
1045260872 8:100572412-100572434 AATCCCAGACAACATGTGGTTGG - Intergenic
1047214145 8:122863305-122863327 AAGCCCAGAGATTTTGAGGTTGG + Intronic
1047762032 8:127961521-127961543 ATGCTCACCCAGCTTGGGGTGGG - Intergenic
1048345565 8:133572150-133572172 AAGCCGAGCCAAGTTGGGGTGGG - Intergenic
1048836655 8:138525096-138525118 AAGATCAGACAGCTTGGAGATGG - Intergenic
1049988660 9:973225-973247 AAGCAGAGGCCGCTTGGGGTCGG - Intergenic
1050928609 9:11297309-11297331 AAGCCCAGAGAGTTTGGTGTAGG - Intergenic
1053171763 9:35892128-35892150 AATCCCAGAAAGCTTTGGTTGGG - Intergenic
1053325181 9:37138337-37138359 AATCCCATGCAGCTTTGGGTTGG + Intronic
1053409202 9:37904628-37904650 AAGCTCAGACAGCTTGCGGGGGG + Intronic
1055306505 9:74934915-74934937 ATACCCAGAAAGCTTAGGGTGGG + Intergenic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1059442166 9:114314524-114314546 AAGCCCAGCCACATTGGGGAGGG + Intergenic
1059745363 9:117195262-117195284 ATGCCCTGACAGATTGGGGAAGG + Intronic
1060129575 9:121081948-121081970 ACACCCAGACAGCTTTGGGATGG - Intronic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1190973734 X:55379227-55379249 AAGCCCAGAAGGTTTGGTGTAGG + Intergenic
1191089587 X:56606001-56606023 AAGCCCAGAGGGTTTGGTGTGGG - Intergenic
1191249210 X:58252068-58252090 AGGCCCAGAGTGCCTGGGGTAGG - Intergenic
1191858284 X:65645101-65645123 AAGCCCAGACAGGGGAGGGTGGG - Intronic
1193056673 X:77159752-77159774 AAGCCCAGAGGGTTTGGTGTGGG + Intergenic
1193198601 X:78662151-78662173 CAGCCCAGCCAGCTTAGGGGAGG - Intergenic
1195325088 X:103751982-103752004 AATACCCCACAGCTTGGGGTTGG - Intergenic
1197692831 X:129522381-129522403 AAGCCTGGAAAGCTTGGGGCCGG + Intronic
1198045105 X:132893713-132893735 AAGCCAAGACAGATAGGGTTGGG + Intronic
1199665455 X:150093186-150093208 AAGCCCAGACATCTGGGACTTGG + Intergenic
1200394931 X:155979444-155979466 CAGGGCAGGCAGCTTGGGGTGGG - Intergenic