ID: 1127674761

View in Genome Browser
Species Human (GRCh38)
Location 15:61228784-61228806
Sequence AGCCAGGGGGGTGAGCCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127674755_1127674761 -1 Left 1127674755 15:61228762-61228784 CCAGTGTTTGCAGAAAAATCAAA 0: 1
1: 1
2: 1
3: 65
4: 685
Right 1127674761 15:61228784-61228806 AGCCAGGGGGGTGAGCCCGCCGG 0: 1
1: 0
2: 0
3: 15
4: 196
1127674754_1127674761 2 Left 1127674754 15:61228759-61228781 CCTCCAGTGTTTGCAGAAAAATC 0: 1
1: 0
2: 0
3: 15
4: 181
Right 1127674761 15:61228784-61228806 AGCCAGGGGGGTGAGCCCGCCGG 0: 1
1: 0
2: 0
3: 15
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127674761 Original CRISPR AGCCAGGGGGGTGAGCCCGC CGG Intronic
900605999 1:3523811-3523833 GGACAGGGGAGTGAGCCCGTGGG - Intronic
900944612 1:5822773-5822795 ATCCAGGGGAGTGAGCCGACTGG + Intergenic
901631812 1:10651657-10651679 AGCTGGGCGGGTGAGGCCGCAGG + Intronic
901790149 1:11649712-11649734 AGGCAGAGGGGAGAGCCAGCTGG - Intronic
902375265 1:16027426-16027448 AGCGAGCAGGGTGAGCCCCCTGG + Exonic
902380227 1:16049236-16049258 AGCGAGCAGGGTGAGCCCCCTGG + Exonic
903271119 1:22188926-22188948 AGCCAGGAAGGTGAGACAGCAGG + Intergenic
905902664 1:41592077-41592099 AGCCAGGGGGCTGAGCACCTGGG + Intronic
915234588 1:154471106-154471128 AGGCGGAGTGGTGAGCCCGCGGG + Intronic
915309940 1:155001823-155001845 AGCCGGGGAGTTGAGCCTGCGGG - Intergenic
915324402 1:155073534-155073556 AGCCAGGGGTCTGGGCCCCCAGG - Intergenic
915913349 1:159927743-159927765 AGCTAGGTGTGTGAGCCCCCCGG - Exonic
916963887 1:169915405-169915427 AGCCGGGGGGGTGAGGTCGCTGG - Intergenic
918179032 1:182070125-182070147 AGCCAGGCTGGTGAGCCTTCAGG - Intergenic
921432673 1:215082568-215082590 AGCCAAGGGGTTGTGCCCCCAGG + Intronic
921699555 1:218252628-218252650 AGCCAGTGTGGTGAGGACGCTGG - Intergenic
922915765 1:229256337-229256359 AGCCAGGTGGGTGAGCCATCTGG + Intergenic
923339615 1:232996252-232996274 AGTCAGGGGGGTGTGGCTGCGGG - Intronic
924052846 1:240093866-240093888 ACCGTGGGGGGTGAGCTCGCTGG - Intronic
1063590892 10:7394526-7394548 TGCCAGGGGGGTGAGCGTGTCGG - Intronic
1065686822 10:28293934-28293956 AGCCAGAGGTGAGATCCCGCAGG + Intronic
1065993254 10:31032487-31032509 AGCCAGGGGCGGGAGCCGGAAGG - Intergenic
1066298391 10:34075818-34075840 TCCCAGAGGGGTGAGCCCACAGG + Intergenic
1066987044 10:42476462-42476484 AGCCCGGGGGGTGGGACCCCAGG - Intergenic
1067069074 10:43119450-43119472 AGCCAGGGGTGGGAGGCCGCAGG - Intronic
1067232453 10:44421600-44421622 GGCCAGGGTGGGGAGCCAGCCGG - Intergenic
1069915768 10:71785729-71785751 AGCCAGGAGGGTGAGACTGGAGG + Intronic
1076880079 10:133235765-133235787 AGCCACGGTGGTGGGGCCGCTGG + Intergenic
1077205396 11:1340134-1340156 AGCCAGGCTGCTGAGACCGCAGG + Intergenic
1077233545 11:1469219-1469241 AGGCAGGGGGCTGAGGCAGCTGG + Intergenic
1078095107 11:8291925-8291947 AGGCAGGGAGGTGAGCCCACAGG + Intergenic
1079240695 11:18720514-18720536 AGCCAAGGGGGAGAGTCCGATGG - Intronic
1080726177 11:34901395-34901417 AGCTAGGGGTTTGAGCCCCCGGG - Intronic
1081472787 11:43391975-43391997 AGCCAGCGGGCTGAGCCAGCGGG + Intronic
1081566731 11:44265069-44265091 AGCCAGGGGGGTGGGCATGAGGG + Exonic
1081808599 11:45903069-45903091 AGGCAGGGGGCTGGGGCCGCGGG - Exonic
1083342368 11:61967206-61967228 AGGGAGGCGGGAGAGCCCGCGGG + Intronic
1083858330 11:65404906-65404928 AGCCAGGCGGCGGAGCCCGCAGG + Exonic
1084013623 11:66366243-66366265 AGGCAGGGGTGTGAGCAGGCAGG + Intronic
1084021308 11:66419952-66419974 AGGCAGGGCGGGGAGCCCTCCGG + Intergenic
1085458673 11:76680124-76680146 AGCCAGGGGAGAGAGCTGGCAGG + Intergenic
1085735012 11:79031412-79031434 AGCCAGGGTGGGGAGTCAGCAGG + Intronic
1090269259 11:125374444-125374466 AGTCAGGGGGGTGATCCTGCTGG + Intronic
1092104755 12:5913422-5913444 CGCCAGGGCCGTGAGCCCACTGG - Intronic
1096787764 12:54027380-54027402 AGGCAGGGGCTTGAGCCTGCAGG + Intronic
1097176740 12:57147655-57147677 AGCCAGCGAGGCCAGCCCGCTGG + Intronic
1097184946 12:57191529-57191551 AGGCAGGAGGGTGAGGCAGCTGG - Intronic
1102235381 12:111291304-111291326 AGCCAGCGGGGTGACTCCGATGG + Intronic
1102458219 12:113084158-113084180 AGACAGGGCGGGGAGCCAGCTGG + Intronic
1103017038 12:117503032-117503054 AGCCAGGGGAGTGTGCTGGCAGG + Intronic
1104462913 12:128969882-128969904 TGCCAGGAGTGTGAGCCCGCAGG + Intronic
1105290968 13:19053169-19053191 AGCCAAGGGTGTGTGCCCACTGG - Intergenic
1105291919 13:19058747-19058769 TGCCACGGAGGGGAGCCCGCAGG + Intergenic
1106558973 13:30832838-30832860 AGCCAGGGAGGCGGGCACGCAGG - Intergenic
1107779073 13:43879405-43879427 AGCCAGGCGGGTTAGCGGGCAGG - Exonic
1111164213 13:84436909-84436931 ACCCAGTGGGATGAGCCCACTGG - Intergenic
1112415507 13:99200733-99200755 AGTCAGGGGCGTGCGCCCGCTGG - Intergenic
1113808313 13:113122695-113122717 AGGCAGGGGAGTGACCACGCTGG - Intergenic
1113901420 13:113800423-113800445 AGCCTGGGGGGAGAGCGCCCTGG + Intronic
1114454635 14:22846862-22846884 AGCCCTGGGGGTGAGCCTGAAGG + Exonic
1118285342 14:64465622-64465644 AGGCAGGGCGGGGAGCCTGCGGG + Intronic
1118452229 14:65913394-65913416 AGACAGGGAGGTGAGCCTGTGGG - Intergenic
1118822317 14:69353493-69353515 AGCCAGTGGGGTGAGGAAGCAGG - Exonic
1118917555 14:70120621-70120643 AGCCAGGGGGTTGAGACAGCCGG + Intronic
1121430296 14:93881749-93881771 AGCCAGGGGGCTGAGGGCTCAGG - Intergenic
1122503270 14:102215904-102215926 AGGCAGGGGGGTAGGCCTGCGGG - Intronic
1123680264 15:22757918-22757940 AGCCAGCGGGGCGAGGCGGCTGG + Intergenic
1123990429 15:25679560-25679582 AGACAGGGGGGTCACCCTGCCGG + Exonic
1125896584 15:43307795-43307817 AGCCAGGAGGGTGAGGCAGGAGG + Intergenic
1127538907 15:59917931-59917953 AGCCTGTGGGGTGAGTCCCCAGG - Intergenic
1127674761 15:61228784-61228806 AGCCAGGGGGGTGAGCCCGCCGG + Intronic
1128232974 15:66048359-66048381 CACCAAGGGGGTGACCCCGCAGG + Intronic
1128969827 15:72098726-72098748 AGCCAGGGGGCTGAGGCAGGAGG + Intronic
1129607530 15:77032146-77032168 AGCCAGGGCCGTGACCCCTCAGG + Intronic
1132266976 15:100482719-100482741 ATCCAGAGGGATGAGCCCCCAGG - Intronic
1132464854 16:72637-72659 AGCGAGGGGCGTGCGCCCGGGGG + Intronic
1132640587 16:976514-976536 AGCCAGGGAGGTGAGCACCAAGG - Intronic
1132762737 16:1518839-1518861 CACCAGGGAGGTGAGCCTGCTGG + Intronic
1132796317 16:1725039-1725061 AGGCAGGAGGGTGGGCCCGCTGG + Intronic
1137655362 16:50153971-50153993 AGCCCGGGGCCTGGGCCCGCCGG + Exonic
1139157178 16:64457712-64457734 AGCCAAGGGAGTGAGGCCTCAGG - Intergenic
1139955468 16:70691067-70691089 AGCCAAGGGGTTGAGGCCTCTGG - Intronic
1141133161 16:81448535-81448557 GGCCAGGCGGGTGAGGCTGCTGG - Intronic
1141657275 16:85422900-85422922 AGCCAGGCAGGTGAGCAAGCGGG - Intergenic
1142121242 16:88387684-88387706 ACCCAGCGAGGAGAGCCCGCAGG + Intergenic
1142164245 16:88577285-88577307 AGCCAGGGGGCCGAGCCAGGAGG + Exonic
1142364985 16:89645478-89645500 GGCCAGGGGGCTCAGCCAGCTGG + Exonic
1142379033 16:89721464-89721486 GGCCAGGGGCGGGACCCCGCCGG - Intronic
1142864935 17:2785039-2785061 AGGCAGGGGGATGATGCCGCAGG - Intronic
1143223728 17:5282621-5282643 GGCCCCGGGGGTGACCCCGCCGG + Intronic
1144958708 17:19032878-19032900 GGGGTGGGGGGTGAGCCCGCGGG + Intronic
1144976451 17:19141646-19141668 GGGGTGGGGGGTGAGCCCGCGGG - Intronic
1145287680 17:21518563-21518585 AGCAAGGGTTGTGAGCGCGCTGG - Intergenic
1147044424 17:37742822-37742844 CGCCAGAGCGGTGAGGCCGCAGG + Intronic
1147769245 17:42856456-42856478 AGCTAGGGGGTTGACCTCGCAGG - Exonic
1147771979 17:42874275-42874297 AGCTAGGGGGTTGACCTCGCAGG - Intergenic
1150292614 17:63990459-63990481 AGCCAGGGGGGTGGGCGTGGGGG - Intergenic
1150521632 17:65873208-65873230 AGTCAGGCAGGTGAGCCCGATGG - Intronic
1152713430 17:81886465-81886487 AGCCTGGGATGTGTGCCCGCAGG + Intergenic
1156392139 18:36660429-36660451 AGCCACTGGGGTGAGGCTGCAGG + Intronic
1157586636 18:48805333-48805355 AGCCATGGGGGCCAGGCCGCAGG + Intronic
1158706871 18:59800572-59800594 AGCCAGGAGGTTGAGGCTGCAGG - Intergenic
1159907948 18:74115149-74115171 GGCCTGGGAGCTGAGCCCGCTGG + Intronic
1160568143 18:79799216-79799238 AGGCAGCTGGGTGACCCCGCGGG + Intergenic
1160796459 19:947944-947966 AGGCAGGCGGGGGAGCCCCCCGG + Intronic
1162361924 19:10225683-10225705 AGCCAGGCGGCTGGGCCCGGTGG - Intronic
1162421609 19:10568821-10568843 TGACAGGGGGAGGAGCCCGCCGG - Exonic
1165291291 19:34888278-34888300 AGCCAGAAGGGGGAGCACGCTGG - Intergenic
1165359830 19:35329464-35329486 AGCCAGGGAGGTCAGCCCCAAGG + Intronic
1166218481 19:41351527-41351549 AGGGAGGGGGATGAGGCCGCCGG + Intronic
1167220426 19:48195434-48195456 AGCCAGGGAGGGGAGCCCAGGGG + Exonic
1167971493 19:53190282-53190304 AGACAGGTGGGTGGGCCCGTTGG + Intronic
925347957 2:3183617-3183639 AGCAGGGCGGGTGAGCCTGCTGG - Intergenic
928365157 2:30694713-30694735 AGCAAGGGGAGAGAGCCAGCAGG + Intergenic
929051556 2:37841314-37841336 CCCCAGGGAGGTGAGCCCACAGG + Intergenic
929795185 2:45053762-45053784 AGCCAGGGTGGGGAGTCCTCAGG - Intergenic
935645375 2:105329799-105329821 AGCCAGGCGGCAGGGCCCGCGGG - Exonic
936152662 2:110030174-110030196 AGCCAGGGAGGGGAGCAGGCGGG + Intergenic
936159091 2:110070637-110070659 AGCCTGTGGGGAGAGTCCGCTGG - Intergenic
936185570 2:110300695-110300717 AGCCTGTGGGGAGAGTCCGCTGG + Intergenic
936192018 2:110341238-110341260 AGCCAGGGAGGGGAGCAGGCGGG - Intergenic
936860515 2:117012467-117012489 AGGCGGGGGGGTGAGCCCCGAGG + Intergenic
937085733 2:119170524-119170546 ATGCAGGAGGGTGAGCCAGCTGG + Intergenic
937222676 2:120350848-120350870 AGGCAAGGGGATGAGACCGCAGG + Exonic
938105861 2:128529357-128529379 AGCCAGGGGGTTGAGTGCTCAGG - Intergenic
938412141 2:131074062-131074084 AGCCAGAGGGGTCAGCCCAAAGG - Intronic
940237946 2:151530740-151530762 AGCCATGGGAGTGAGCCACCTGG + Intronic
942209062 2:173652367-173652389 AGCCTTGGGGGTGAGCCTCCTGG - Intergenic
944426070 2:199584672-199584694 AGCCAGGTGGGTGAACTCTCAGG - Intergenic
947715822 2:232338358-232338380 AGCCAGGGGGGTGAACAAGGGGG + Intronic
947734846 2:232449104-232449126 AGCCAGGGGGGTGAACAAGGGGG + Intergenic
1171013838 20:21522737-21522759 AGCTAGGAGGGTGGGGCCGCTGG - Intergenic
1172037386 20:32019400-32019422 AGCCAACAGGGTGAGCCCGAGGG + Exonic
1172684795 20:36745763-36745785 ACCCAGGGTGTTGAGCCCGGAGG + Intronic
1175996026 20:62812696-62812718 AGCCAGGGGGATGAGGCAGGGGG + Exonic
1176214192 20:63940559-63940581 AGCCGGGGTGATGAGCCCGGGGG - Intronic
1176308031 21:5134584-5134606 AGCCAGGGGTCTGTGCCCTCGGG - Intronic
1178617320 21:34145429-34145451 AGCCAGGGGGCAGGGCCCACTGG - Intergenic
1178915645 21:36704446-36704468 ATCCAGGAGGGAAAGCCCGCAGG + Intronic
1179849029 21:44127448-44127470 AGCCAGGGGTCTGTGCCCTCGGG + Intronic
1180064454 21:45405512-45405534 AGCCAGGGCGGCGAGGCCGGCGG - Intronic
1181051867 22:20241750-20241772 GCCCAGGGGGGTGAGGCTGCAGG + Exonic
1181584128 22:23843704-23843726 AGCCAGGGGGCTGAGGCTGGAGG + Intergenic
1182358122 22:29731422-29731444 AGCCAGGGTGGTGAGGCAGGTGG - Exonic
1182425406 22:30268947-30268969 AGCCAGGGGAGAGAAGCCGCTGG + Intergenic
1183105294 22:35610980-35611002 ACCCAGGGCGGTGAGCACGGTGG + Exonic
1185332884 22:50259525-50259547 AGCCCAGGGGGTGGGCCCACAGG + Intronic
950261367 3:11545104-11545126 AGCCAGGAGGCTGCGGCCGCTGG + Intronic
950651598 3:14410627-14410649 AGGCAGAGGGCTGAGCCCTCAGG + Intronic
954367510 3:50154522-50154544 AGGCTGGAGGCTGAGCCCGCGGG + Intergenic
954371538 3:50171710-50171732 AGCCAGGCGGGTGAGCGGCCAGG + Intronic
954778868 3:53045329-53045351 AGCCCGGGGGGCGGGTCCGCGGG + Intronic
954809363 3:53238635-53238657 GGCCAGTGGGGCCAGCCCGCAGG - Intronic
960955343 3:123027322-123027344 AGCCAGGTAGGTGAGGCTGCGGG - Intronic
967272797 3:187744682-187744704 AGCCAGCGGGGCGAGCGAGCGGG + Intronic
967999600 3:195195769-195195791 GGCCAGAGGGGTGAGCCTGCTGG - Intronic
968513482 4:1005312-1005334 GGGGCGGGGGGTGAGCCCGCTGG + Intergenic
968907954 4:3463267-3463289 GGCCAGGAGGGCGGGCCCGCGGG - Intergenic
968938112 4:3624228-3624250 AGCCTGGGGGGTGGGCCCTGTGG + Intergenic
984805297 4:183746481-183746503 AGGCAGGGGGCCGTGCCCGCTGG + Intergenic
985629932 5:1008981-1009003 AGCCGGGGCCGGGAGCCCGCGGG - Exonic
987710225 5:21495173-21495195 AGACAAGGGGGTGAGCCTGGGGG + Intergenic
988749388 5:34179000-34179022 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
991737643 5:69642192-69642214 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
991760551 5:69914233-69914255 AGACAAGGGGGTGAGCCTGGGGG + Intergenic
991786781 5:70203868-70203890 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
991789219 5:70221918-70221940 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
991817101 5:70518308-70518330 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
991839782 5:70789283-70789305 AGACAAGGGGGTGAGCCTGGGGG + Intergenic
991879227 5:71204253-71204275 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
991881667 5:71222282-71222304 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
993483285 5:88451012-88451034 AGGTAGGGGGGTGAGCCAGATGG - Intergenic
994460193 5:100062262-100062284 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
994484341 5:100375687-100375709 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
999143919 5:149380454-149380476 AGCCAGGAGGGTGGGCCTGAGGG - Intronic
1001018995 5:168166889-168166911 AGCCAAGGGGGTGAGAAGGCAGG - Intronic
1001200333 5:169710262-169710284 GGCCAGGTGGGTGAGCACCCTGG + Intronic
1005547462 6:26885346-26885368 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
1005996476 6:30934387-30934409 GGCCAGGTGGGGGAGCCCGCAGG + Intergenic
1006797069 6:36738627-36738649 AGCCTGGGGGGTGAGCTCAGAGG + Intergenic
1007098620 6:39229512-39229534 AGCAAGGGGGCAGAGCGCGCCGG - Intergenic
1007673329 6:43575315-43575337 GGCCAGGGGAGTGGGCCAGCAGG + Intronic
1008440191 6:51524133-51524155 AGCTAGGGAGGTGAGCAGGCTGG + Intergenic
1009018224 6:57926413-57926435 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
1015626210 6:135182512-135182534 CGCCTGGGGGCAGAGCCCGCGGG - Intronic
1017899029 6:158704631-158704653 AGGCGGAGGGGTGACCCCGCAGG + Intronic
1018962763 6:168459771-168459793 AGCCGGGGTGGTGAGCCCTCTGG + Intronic
1019783131 7:2956410-2956432 AGCCAGGAGGTTGAGGCTGCAGG + Intronic
1019901771 7:4026491-4026513 AGCACGTGGGGAGAGCCCGCAGG - Intronic
1025927301 7:65970269-65970291 AGACAAGGGGGTGAGCCTGGGGG - Exonic
1026628790 7:72019642-72019664 AGCCAGGTGAGTGAGCCACCAGG + Intronic
1034675873 7:152892217-152892239 AGCCAGGGGGGAAAGTCTGCAGG - Intergenic
1034904174 7:154929360-154929382 AGCCAGGTGGTTGAGGCTGCAGG + Intronic
1036776022 8:11613624-11613646 AGCCAGGGAGGGGAGCCGGAGGG + Intergenic
1038544017 8:28412010-28412032 GCCCAGGGGGTTGAGCCGGCAGG - Intronic
1039456467 8:37710744-37710766 AGCCAGGAGGGTGGGCCCTGGGG - Intergenic
1040567797 8:48582655-48582677 AGCCAGGGGTGGGAGGCCGGTGG + Intergenic
1041075973 8:54170467-54170489 AGCCAGGAGGGTGAGGCCTGTGG - Intergenic
1044821779 8:96160217-96160239 AGCCAGGGAGCTGTTCCCGCTGG - Intronic
1049268338 8:141681385-141681407 GGCCTGGGGTGGGAGCCCGCAGG - Intergenic
1049582983 8:143421140-143421162 AGGGAGGGGGAAGAGCCCGCCGG - Intronic
1049746496 8:144265398-144265420 TGCCAGGGGAGGGAGCCCGTGGG - Intronic
1050138808 9:2496108-2496130 AGCCCAGGGGGTGAGACCACTGG - Intergenic
1053312130 9:37026810-37026832 AGCCAGGGAGGGAAGCCAGCCGG - Intronic
1054462409 9:65472441-65472463 AGACAGTGGGCTGAGCCCACTGG + Intergenic
1055324190 9:75111433-75111455 AGCCAGTGAAGTGAGCCAGCAGG + Intronic
1062049085 9:134437983-134438005 AGCCCGGGGGCAGAGCCTGCGGG - Intronic
1190056055 X:47181641-47181663 AGCCAGGTGAGTGAGCCCTGTGG + Exonic
1190761552 X:53441764-53441786 AGCCAGCCGGCTGACCCCGCCGG - Intergenic
1191846487 X:65551157-65551179 AGCCAGGCGGCGGAGCCCGCAGG - Intergenic
1192416847 X:70988688-70988710 AGCTAGGGGGGTGGGCACGGTGG + Intergenic
1199445048 X:147911827-147911849 GGCCGAGGGGCTGAGCCCGCGGG + Intergenic