ID: 1127679376

View in Genome Browser
Species Human (GRCh38)
Location 15:61277972-61277994
Sequence CGAGGTAGGTGGATCACCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127679376_1127679385 22 Left 1127679376 15:61277972-61277994 CCTCAGGTGATCCACCTACCTCG No data
Right 1127679385 15:61278017-61278039 CAGGCCTGAGCCACCGCGCCCGG No data
1127679376_1127679382 3 Left 1127679376 15:61277972-61277994 CCTCAGGTGATCCACCTACCTCG No data
Right 1127679382 15:61277998-61278020 TCCCAAAATGTTGAGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127679376 Original CRISPR CGAGGTAGGTGGATCACCTG AGG (reversed) Intergenic