ID: 1127679378

View in Genome Browser
Species Human (GRCh38)
Location 15:61277983-61278005
Sequence TTTTGGGAGGCCGAGGTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127679378_1127679388 22 Left 1127679378 15:61277983-61278005 CCACCTACCTCGGCCTCCCAAAA No data
Right 1127679388 15:61278028-61278050 CACCGCGCCCGGCTTACCATTGG No data
1127679378_1127679389 23 Left 1127679378 15:61277983-61278005 CCACCTACCTCGGCCTCCCAAAA No data
Right 1127679389 15:61278029-61278051 ACCGCGCCCGGCTTACCATTGGG No data
1127679378_1127679382 -8 Left 1127679378 15:61277983-61278005 CCACCTACCTCGGCCTCCCAAAA No data
Right 1127679382 15:61277998-61278020 TCCCAAAATGTTGAGATTACAGG No data
1127679378_1127679385 11 Left 1127679378 15:61277983-61278005 CCACCTACCTCGGCCTCCCAAAA No data
Right 1127679385 15:61278017-61278039 CAGGCCTGAGCCACCGCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127679378 Original CRISPR TTTTGGGAGGCCGAGGTAGG TGG (reversed) Intergenic