ID: 1127679379

View in Genome Browser
Species Human (GRCh38)
Location 15:61277986-61278008
Sequence ACATTTTGGGAGGCCGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127679379_1127679389 20 Left 1127679379 15:61277986-61278008 CCTACCTCGGCCTCCCAAAATGT No data
Right 1127679389 15:61278029-61278051 ACCGCGCCCGGCTTACCATTGGG No data
1127679379_1127679388 19 Left 1127679379 15:61277986-61278008 CCTACCTCGGCCTCCCAAAATGT No data
Right 1127679388 15:61278028-61278050 CACCGCGCCCGGCTTACCATTGG No data
1127679379_1127679393 30 Left 1127679379 15:61277986-61278008 CCTACCTCGGCCTCCCAAAATGT No data
Right 1127679393 15:61278039-61278061 GCTTACCATTGGGTTTAAGCAGG No data
1127679379_1127679385 8 Left 1127679379 15:61277986-61278008 CCTACCTCGGCCTCCCAAAATGT No data
Right 1127679385 15:61278017-61278039 CAGGCCTGAGCCACCGCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127679379 Original CRISPR ACATTTTGGGAGGCCGAGGT AGG (reversed) Intergenic