ID: 1127679383

View in Genome Browser
Species Human (GRCh38)
Location 15:61277999-61278021
Sequence GCCTGTAATCTCAACATTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 605483
Summary {0: 112, 1: 3269, 2: 44589, 3: 279817, 4: 277696}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127679383_1127679393 17 Left 1127679383 15:61277999-61278021 CCCAAAATGTTGAGATTACAGGC 0: 112
1: 3269
2: 44589
3: 279817
4: 277696
Right 1127679393 15:61278039-61278061 GCTTACCATTGGGTTTAAGCAGG No data
1127679383_1127679385 -5 Left 1127679383 15:61277999-61278021 CCCAAAATGTTGAGATTACAGGC 0: 112
1: 3269
2: 44589
3: 279817
4: 277696
Right 1127679385 15:61278017-61278039 CAGGCCTGAGCCACCGCGCCCGG 0: 491
1: 34132
2: 89308
3: 152461
4: 169741
1127679383_1127679388 6 Left 1127679383 15:61277999-61278021 CCCAAAATGTTGAGATTACAGGC 0: 112
1: 3269
2: 44589
3: 279817
4: 277696
Right 1127679388 15:61278028-61278050 CACCGCGCCCGGCTTACCATTGG No data
1127679383_1127679389 7 Left 1127679383 15:61277999-61278021 CCCAAAATGTTGAGATTACAGGC 0: 112
1: 3269
2: 44589
3: 279817
4: 277696
Right 1127679389 15:61278029-61278051 ACCGCGCCCGGCTTACCATTGGG No data
1127679383_1127679394 18 Left 1127679383 15:61277999-61278021 CCCAAAATGTTGAGATTACAGGC 0: 112
1: 3269
2: 44589
3: 279817
4: 277696
Right 1127679394 15:61278040-61278062 CTTACCATTGGGTTTAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127679383 Original CRISPR GCCTGTAATCTCAACATTTT GGG (reversed) Intergenic
Too many off-targets to display for this crispr