ID: 1127679384

View in Genome Browser
Species Human (GRCh38)
Location 15:61278000-61278022
Sequence GGCCTGTAATCTCAACATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127679384_1127679389 6 Left 1127679384 15:61278000-61278022 CCAAAATGTTGAGATTACAGGCC No data
Right 1127679389 15:61278029-61278051 ACCGCGCCCGGCTTACCATTGGG No data
1127679384_1127679394 17 Left 1127679384 15:61278000-61278022 CCAAAATGTTGAGATTACAGGCC No data
Right 1127679394 15:61278040-61278062 CTTACCATTGGGTTTAAGCAGGG No data
1127679384_1127679388 5 Left 1127679384 15:61278000-61278022 CCAAAATGTTGAGATTACAGGCC No data
Right 1127679388 15:61278028-61278050 CACCGCGCCCGGCTTACCATTGG No data
1127679384_1127679385 -6 Left 1127679384 15:61278000-61278022 CCAAAATGTTGAGATTACAGGCC No data
Right 1127679385 15:61278017-61278039 CAGGCCTGAGCCACCGCGCCCGG 0: 491
1: 34132
2: 89308
3: 152461
4: 169741
1127679384_1127679393 16 Left 1127679384 15:61278000-61278022 CCAAAATGTTGAGATTACAGGCC No data
Right 1127679393 15:61278039-61278061 GCTTACCATTGGGTTTAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127679384 Original CRISPR GGCCTGTAATCTCAACATTT TGG (reversed) Intergenic
No off target data available for this crispr