ID: 1127679385

View in Genome Browser
Species Human (GRCh38)
Location 15:61278017-61278039
Sequence CAGGCCTGAGCCACCGCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 446133
Summary {0: 491, 1: 34132, 2: 89308, 3: 152461, 4: 169741}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127679376_1127679385 22 Left 1127679376 15:61277972-61277994 CCTCAGGTGATCCACCTACCTCG 0: 304
1: 13317
2: 50253
3: 84858
4: 97513
Right 1127679385 15:61278017-61278039 CAGGCCTGAGCCACCGCGCCCGG 0: 491
1: 34132
2: 89308
3: 152461
4: 169741
1127679384_1127679385 -6 Left 1127679384 15:61278000-61278022 CCAAAATGTTGAGATTACAGGCC No data
Right 1127679385 15:61278017-61278039 CAGGCCTGAGCCACCGCGCCCGG 0: 491
1: 34132
2: 89308
3: 152461
4: 169741
1127679383_1127679385 -5 Left 1127679383 15:61277999-61278021 CCCAAAATGTTGAGATTACAGGC 0: 112
1: 3269
2: 44589
3: 279817
4: 277696
Right 1127679385 15:61278017-61278039 CAGGCCTGAGCCACCGCGCCCGG 0: 491
1: 34132
2: 89308
3: 152461
4: 169741
1127679378_1127679385 11 Left 1127679378 15:61277983-61278005 CCACCTACCTCGGCCTCCCAAAA 0: 66
1: 4347
2: 71594
3: 207290
4: 209716
Right 1127679385 15:61278017-61278039 CAGGCCTGAGCCACCGCGCCCGG 0: 491
1: 34132
2: 89308
3: 152461
4: 169741
1127679375_1127679385 27 Left 1127679375 15:61277967-61277989 CCTGACCTCAGGTGATCCACCTA 0: 796
1: 32766
2: 73984
3: 99463
4: 106138
Right 1127679385 15:61278017-61278039 CAGGCCTGAGCCACCGCGCCCGG 0: 491
1: 34132
2: 89308
3: 152461
4: 169741
1127679379_1127679385 8 Left 1127679379 15:61277986-61278008 CCTACCTCGGCCTCCCAAAATGT 0: 163
1: 5348
2: 61364
3: 220755
4: 280074
Right 1127679385 15:61278017-61278039 CAGGCCTGAGCCACCGCGCCCGG 0: 491
1: 34132
2: 89308
3: 152461
4: 169741
1127679381_1127679385 -2 Left 1127679381 15:61277996-61278018 CCTCCCAAAATGTTGAGATTACA 0: 155
1: 4541
2: 58513
3: 354081
4: 252051
Right 1127679385 15:61278017-61278039 CAGGCCTGAGCCACCGCGCCCGG 0: 491
1: 34132
2: 89308
3: 152461
4: 169741
1127679380_1127679385 4 Left 1127679380 15:61277990-61278012 CCTCGGCCTCCCAAAATGTTGAG 0: 31
1: 1240
2: 21564
3: 172885
4: 296992
Right 1127679385 15:61278017-61278039 CAGGCCTGAGCCACCGCGCCCGG 0: 491
1: 34132
2: 89308
3: 152461
4: 169741

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127679385 Original CRISPR CAGGCCTGAGCCACCGCGCC CGG Intergenic
Too many off-targets to display for this crispr