ID: 1127679386

View in Genome Browser
Species Human (GRCh38)
Location 15:61278021-61278043
Sequence TAAGCCGGGCGCGGTGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127679386_1127679394 -4 Left 1127679386 15:61278021-61278043 CCTGAGCCACCGCGCCCGGCTTA No data
Right 1127679394 15:61278040-61278062 CTTACCATTGGGTTTAAGCAGGG No data
1127679386_1127679393 -5 Left 1127679386 15:61278021-61278043 CCTGAGCCACCGCGCCCGGCTTA No data
Right 1127679393 15:61278039-61278061 GCTTACCATTGGGTTTAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127679386 Original CRISPR TAAGCCGGGCGCGGTGGCTC AGG (reversed) Intergenic