ID: 1127679387

View in Genome Browser
Species Human (GRCh38)
Location 15:61278027-61278049
Sequence CAATGGTAAGCCGGGCGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127679387_1127679394 -10 Left 1127679387 15:61278027-61278049 CCACCGCGCCCGGCTTACCATTG No data
Right 1127679394 15:61278040-61278062 CTTACCATTGGGTTTAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127679387 Original CRISPR CAATGGTAAGCCGGGCGCGG TGG (reversed) Intergenic