ID: 1127679388

View in Genome Browser
Species Human (GRCh38)
Location 15:61278028-61278050
Sequence CACCGCGCCCGGCTTACCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127679383_1127679388 6 Left 1127679383 15:61277999-61278021 CCCAAAATGTTGAGATTACAGGC 0: 112
1: 3269
2: 44589
3: 279817
4: 277696
Right 1127679388 15:61278028-61278050 CACCGCGCCCGGCTTACCATTGG No data
1127679378_1127679388 22 Left 1127679378 15:61277983-61278005 CCACCTACCTCGGCCTCCCAAAA 0: 66
1: 4347
2: 71594
3: 207290
4: 209716
Right 1127679388 15:61278028-61278050 CACCGCGCCCGGCTTACCATTGG No data
1127679380_1127679388 15 Left 1127679380 15:61277990-61278012 CCTCGGCCTCCCAAAATGTTGAG 0: 31
1: 1240
2: 21564
3: 172885
4: 296992
Right 1127679388 15:61278028-61278050 CACCGCGCCCGGCTTACCATTGG No data
1127679384_1127679388 5 Left 1127679384 15:61278000-61278022 CCAAAATGTTGAGATTACAGGCC No data
Right 1127679388 15:61278028-61278050 CACCGCGCCCGGCTTACCATTGG No data
1127679379_1127679388 19 Left 1127679379 15:61277986-61278008 CCTACCTCGGCCTCCCAAAATGT 0: 163
1: 5348
2: 61364
3: 220755
4: 280074
Right 1127679388 15:61278028-61278050 CACCGCGCCCGGCTTACCATTGG No data
1127679381_1127679388 9 Left 1127679381 15:61277996-61278018 CCTCCCAAAATGTTGAGATTACA 0: 155
1: 4541
2: 58513
3: 354081
4: 252051
Right 1127679388 15:61278028-61278050 CACCGCGCCCGGCTTACCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127679388 Original CRISPR CACCGCGCCCGGCTTACCAT TGG Intergenic
No off target data available for this crispr