ID: 1127679393

View in Genome Browser
Species Human (GRCh38)
Location 15:61278039-61278061
Sequence GCTTACCATTGGGTTTAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127679381_1127679393 20 Left 1127679381 15:61277996-61278018 CCTCCCAAAATGTTGAGATTACA No data
Right 1127679393 15:61278039-61278061 GCTTACCATTGGGTTTAAGCAGG No data
1127679379_1127679393 30 Left 1127679379 15:61277986-61278008 CCTACCTCGGCCTCCCAAAATGT No data
Right 1127679393 15:61278039-61278061 GCTTACCATTGGGTTTAAGCAGG No data
1127679386_1127679393 -5 Left 1127679386 15:61278021-61278043 CCTGAGCCACCGCGCCCGGCTTA No data
Right 1127679393 15:61278039-61278061 GCTTACCATTGGGTTTAAGCAGG No data
1127679384_1127679393 16 Left 1127679384 15:61278000-61278022 CCAAAATGTTGAGATTACAGGCC No data
Right 1127679393 15:61278039-61278061 GCTTACCATTGGGTTTAAGCAGG No data
1127679383_1127679393 17 Left 1127679383 15:61277999-61278021 CCCAAAATGTTGAGATTACAGGC No data
Right 1127679393 15:61278039-61278061 GCTTACCATTGGGTTTAAGCAGG No data
1127679380_1127679393 26 Left 1127679380 15:61277990-61278012 CCTCGGCCTCCCAAAATGTTGAG No data
Right 1127679393 15:61278039-61278061 GCTTACCATTGGGTTTAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127679393 Original CRISPR GCTTACCATTGGGTTTAAGC AGG Intergenic